EPF-Lausanne/5 September 2008

From 2008.igem.org

Revision as of 08:36, 10 September 2008 by Serge (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

<<Previous - Back to Notebook - Next>>

Sequencing

We want to sequence AB and CD. We designed the following primers:

tcacgaggcagaatttcaga, pSB1A2FW aaccgtattaccgcctttga, pSB1A2RV gcgaccagcagaacatctc, AB1seqFW ccagactctaagcggctcac, AB2seqFW caattagcctttttatgccaaca, CD1FW

The first two primers are on the plasmid pSB1A2 and can thus be reused as primers for all parts in the same plasmid. The 3 others are specific to AB resp. CD. The primers have been ordered today.

Retrieved from "http://2008.igem.org/EPF-Lausanne/5_September_2008"