"

 

From 2008.igem.org

Contents 1 Testing Thermoinducible Lac System 1.1 Restreaked Plates of P92-3 in S1 7/21 1.1.1 Results 7/22 1.2 Thermoinducible Test 7/24 2 Sequencing Parts, Plasmids, Etc. 2.1 Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21 2.2 Analytical Digest of Composite Parts 7/22 2.2.1 Gel Results 7/23 3 Making Thermoinducible cI Lambda System 3.1 Primers for Taking Out cI857 from PGW7 7/21 3.2 Minipreps of Transformed Parts in S1 7/22 3.3 Adding Terminator Before pLambda GFP 3.3.1 Digestion of Terminator (P64) and pLambda GFP 7/22 3.3.2 Digestion Gel Results 7/23 3.3.3 Digestion of (Almost) All of Our Terminators 7/23 3.3.4 Gel? 7/24 3.3.5 Ligation of P75 with old P63 7/24 3.3.6 Digestion of P63 (7/24) and E1 P75b (7/25) 3.3.7 Gel Results 7/25 3.4 Ligation of pLambda+GFP Vector P75 with Terminator P63 7/25 3.5 Transformation of P75+ P63 Ligations and PGW7 3.6 Gradient PCR of PGW7 Plasmid to Isolate cI857 7/25 3.6.1 PCR Gels 7/25 3.6.1.1 PCR using RBS Primer Set: 3.6.1.2 PCR using BIG Primer Set: 4 Housekeeping 4.1 Making Competent Cells 7/22 5 Ligations 07/22 6 Recombination Update 07/22 7 07/23 Ligations/Transformations 8 Ligations 07/24 9 PCR 9.1 mtrB 9.1.1 7/22: gradient + new R primer 9.1.2 Lower gradient 9.2 P51, 52, 17 MIT 9.3 P1, P3 backbones; HO-pcyA; P51 MIT 9.3.1 Conditions optimization 9.3.1.1 P1, P3 9.3.1.2 HO-pcyA 9.3.1.3 P51 MIT 9.3.1.4 Gels 9.3.2 Full Rx 10 RE digests 07/22 10.1 Ligation w/ purified products 7/22: CDF into P1 vector 11 RE digests 07/23 11.1 Ligations with purified digest fragments 07/23: mtrB+RBS, CDF into pSB3K3 11.1.1 Results 11.1.2 RE digests of miniprepped ligations 07/25 11.1.2.1 Ligations with purified parts and PCR products 07/26 11.1.2.1.1 Results 7/27 12 RE digests 07/24 12.1 Ligations w/ purified digest fragments 07/24 12.1.1 Results 7/25 12.1.2 Cultures for miniprep 12.1.3 RE digests of minipreps 07/26 12.1.3.1 Results

Testing Thermoinducible Lac System

Restreaked Plates of P92-3 in S1 7/21

Restreaked P93 (1:3), P92a, and P93b--all successfully transformed in S1--to detect YFP at 30 and 40 degrees.

Results 7/22

S1 P93 (1:3), P92a, and P93b plates grown at 30 and 40 degrees failed to demonstrate any difference in YFP expression. Both expressed very low, if any, YFP.

Thermoinducible Test 7/24

'	'	'	Time	'	'	'	'	'	'	'	'	'	'	'	'
			0 hrs	2 hrs				4 hrs				6 hrs
Strain	Replicate		Before Splitting	30	30 + 1mM IPTG	40	42	30	30 + 1mM IPTG	40	42	30	30 + 1mM IPTG	40	42* DID NOT SHAKE
LB	N/A	Dilution	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A
		OD	0	0	0	0	0	0	0	0	0	0	0	0	0
		YFP	36.78	40.72	40.72	40.72	40.72	41.32	41.32	41.32	41.32	45.4	45.4	45.4	45.4
P84	A	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 5.5	1 in 6.5	1 in 5.5
		OD	0.269	0.229	0.218	0.216	0.214	0.241	0.224	0.227	0.219	0.243	0.234	0.243	0.224
		YFP	291.95	242.89	226.53	216.85	211.21	226.95	222.07	196.83	196.3	250.22	238.06	224.98	215.35
		YFP/OD	1085.315985	1060.655022	1039.12844	1003.935185	986.9626168	941.7012448	991.3839286	867.092511	896.347032	1029.711934	1017.350427	925.8436214	961.3839286
	B	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 5.5	1 in 6.5	1 in 5.5
		OD	0.269	0.221	0.218	0.203	0.208	0.231	0.228	0.221	0.228	0.233	0.23	0.228	0.268
		YFP	291.95	225.35	229.19	208.3	199.34	215.49	208.55	195.39	192.62	233.83	233.99	215.07	241.39
		YFP/OD	1085.315985	1019.683258	1051.330275	1026.108374	958.3653846	932.8571429	914.6929825	884.1176471	844.8245614	1003.562232	1017.347826	943.2894737	900.7089552
	C	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 5.5	1 in 6.5	1 in 5.5
		OD	0.269	0.239	0.225	0.22	0.203	0.24	0.218	0.225	0.225	0.231	0.244	0.236	0.237
		YFP	291.95	243.21	233.06	207.05	195.54	221.06	202.99	193.67	188.6	233.191	242.86	219.04	218.02
		YFP/OD	1085.315985	1017.615063	1035.822222	941.1363636	963.2512315	921.0833333	931.146789	860.7555556	838.2222222	1009.484848	995.3278689	928.1355932	919.9156118
P85	A	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 5.5	1 in 6.5	1 in 5.5
		OD	0.221	0.227	0.218	0.2	0.196	0.232	0.226	0.212	0.217	0.239	0.234	0.218	0.221
		YFP	245.2	236.07	228.69	202.98	190.63	220.43	208.21	184.71	187.91	239.59	236.01	212.75	209.69
		YFP/OD	1109.502262	1039.955947	1049.036697	1014.9	972.6020408	950.1293103	921.2831858	871.2735849	865.9447005	1002.468619	1008.589744	975.9174312	948.8235294
	B	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6.5	1 in 5.5	1 in 6.5	1 in 5.5
		OD	0.221	0.233	0.219	0.202	0.192	0.244	0.223	0.213	0.22	0.229	0.225	0.225	0.225
		YFP	245.2	232.52	224.04	200.66	190.6	220	204.88	181.33	179.51	233.89	227.6	211.73	209.61
		YFP/OD	1109.502262	997.9399142	1023.013699	993.3663366	992.7083333	901.6393443	918.7443946	851.314554	815.9545455	1021.353712	1011.555556	941.0222222	931.6
	C	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 6	1 in 6.5	1 in 5.5
		OD	0.221	0.23	0.226	0.2	0.199	0.238	0.229	0.216	0.217	0.238	0.232	0.234	0.227
		YFP	245.2	233.88	229.97	199.54	193.24	215.08	208.23	182.57	182.58	234.45	232.47	217.81	210.75
		YFP/OD	1109.502262	1016.869565	1017.566372	997.7	971.0552764	903.697479	909.30131	845.2314815	841.3824885	985.0840336	1002.025862	930.8119658	928.4140969
(-) Ctrl (P41)	A	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 5.5	1 in 6.5	1 in 5.5
		OD	0.216	0.232	0.215	0.197	0.199	0.237	0.221	0.217	0.223	0.234	0.237	0.226	0.234
		YFP	234.27	227.67	216.53	186.19	198.19	214.86	204.3	190.44	205.31	236.74	234.19	211.12	215.13
		YFP/OD	1084.583333	981.3362069	1007.116279	945.1269036	995.9296482	906.5822785	924.4343891	877.6036866	920.6726457	1011.709402	988.1434599	934.159292	919.3589744
	B	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 6	1 in 6.5	1 in 5.5
		OD	0.216	0.227	0.234	0.199	0.197	0.235	0.223	0.217	0.219	0.242	0.233	0.225	0.228
		YFP	234.27	237.44	226.99	190.07	186.35	215.29	210.32	190.44	188.45	239.24	234.96	209.83	207.08
		YFP/OD	1084.583333	1045.991189	970.042735	955.1256281	945.9390863	916.1276596	943.1390135	877.6036866	860.5022831	988.5950413	1008.412017	932.5777778	908.245614
	C	Dilution	N/A	1 in 4	1 in 4	1 in 4.5	1 in 4.5	1 in 5	1 in 5	1 in 5.5	1 in 5.5	1 in 6	1 in 6	1 in 6.5	1 in 5.5
		OD	0.216	0.219	0.218	0.193	0.194	0.238	0.228	0.214	0.219	0.241	0.229	0.22	0.223
		YFP	234.27	224.51	227.38	201.61	190.81	216.18	209.61	185.68	183.13	240.67	227.78	208.24	207.36
		YFP/OD	1084.583333	1025.159817	1043.027523	1044.611399	983.556701	908.3193277	919.3421053	867.6635514	836.2100457	998.6307054	994.6724891	946.5454545	929.8654709

Data for the 1000fold Dilutions after 2 Hours

'	'	'	Time	'	'	'	'	'	'	'	'	'
			2hrs				Diluted 1000 fold, grown for 5 hours.				Diluted 1000 fold, grown for 5 hours, diluted to same OD range.
Strain	Replicate		30	30 + 1mM IPTG	40	42	30	30 + 1mM IPTG	40	42* DID NOT SHAKE FOR TWO HOURS IN THE MIDDLE.	40	42* DID NOT SHAKE FOR TWO HOURS IN THE MIDDLE.
LB	N/A	Dilution	N/A	N/A	N/A	N/A	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0	0	0	0	0	0	0	0	0	0
		YFP	40.72	40.72	40.72	40.72	46.8	46.8	46.8	46.8	46.8	46.8
P84	A	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.229	0.218	0.216	0.214	0.018	0.015	0.12	0.139	0.015	0.018
		YFP	242.89	226.53	216.85	211.21	63.52	59.56	164.97	169.15	59.29	61.78
		YFP/OD	1060.655022	1039.12844	1003.935185	986.9626168	3528.888889	3970.666667	1374.75	1216.906475	3952.666667	3432.222222
	B	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.221	0.218	0.203	0.208	0.015	0.016	0.134	0.127	0.02	0.018
		YFP	225.35	229.19	208.3	199.34	62.13	63.2	169.54	170.49	61.6	62.48
		YFP/OD	1019.683258	1051.330275	1026.108374	958.3653846	4142	3950	1265.223881	1342.440945	3080	3471.111111
	C	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.239	0.225	0.22	0.203	0.017	0.016	0.131	0.127	0.021	0.016
		YFP	243.21	233.06	207.05	195.54	60.86	62.2	164.97	163.9	59.74	64.82
		YFP/OD	1017.615063	1035.822222	941.1363636	963.2512315	3580	3887.5	1259.312977	1290.551181	2844.761905	4051.25
P85	A	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.227	0.218	0.2	0.196	0.014	0.017	0.121	0.122	0.018	0.016
		YFP	236.07	228.69	202.98	190.63	59.28	62.21	155.08	173.29	63.34	61.37
		YFP/OD	1039.955947	1049.036697	1014.9	972.6020408	4234.285714	3659.411765	1281.652893	1420.409836	3518.888889	3835.625
	B	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.233	0.219	0.202	0.192	0.014	0.012	0.121	0.114	0.018	0.016
		YFP	232.52	224.04	200.66	190.6	60.47	56.56	149.74	175	60.99	57.54
		YFP/OD	997.9399142	1023.013699	993.3663366	992.7083333	4319.285714	4713.333333	1237.520661	1535.087719	3388.333333	3596.25
	C	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.23	0.226	0.2	0.199	0.015	0.013	0.126	0.107	0.021	0.016
		YFP	233.88	229.97	199.54	193.24	57.31	58.69	171.68	148.36	60.58	63.76
		YFP/OD	1016.869565	1017.566372	997.7	971.0552764	3820.666667	4514.615385	1362.539683	1386.542056	2884.761905	3985
(-) Ctrl (P41)	A	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.232	0.215	0.197	0.199	0.016	0.015	0.111	0.133	0.019	0.018
		YFP	227.67	216.53	186.19	198.19	65.69	65.34	150.96	162.94	60.46	59.28
		YFP/OD	981.3362069	1007.116279	945.1269036	995.9296482	4105.625	4356	1360	1225.112782	3182.105263	3293.333333
	B	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 20	1 in 10
		OD	0.227	0.234	0.199	0.197	0.029	0.027	0.228	0.125	0.021	0.022
		YFP	237.44	226.99	190.07	186.35	71.71	71.9	241.84	160.57	59.6	61.7
		YFP/OD	1045.991189	970.042735	955.1256281	945.9390863	2472.758621	2662.962963	1060.701754	1284.56	2838.095238	2804.545455
	C	Dilution	1 in 4	1 in 4	1 in 4.5	1 in 4.5	N/A	N/A	N/A	N/A	1 in 10	1 in 10
		OD	0.219	0.218	0.193	0.194	0.017	0.018	0.134	0.118	0.021	0.019
		YFP	224.51	227.38	201.61	190.81	59.56	61.47	167.86	162.14	59.57	57.91
		YFP/OD	1025.159817	1043.027523	1044.611399	983.556701	3503.529412	3415	1252.686567	1374.067797	2836.666667	3047.894737

Sequencing Parts, Plasmids, Etc.

Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21

Primer Name	Sequence
P4P13fwd	GGATCTCGACGCTCTCCCTT
P12fwd	ATGCGTCCGGCGTAGAGGA
DuetRev	TGCTAGTTATTGCTCAGCGG

These arrived 7/25/08, and were reconstituted to 100uM.

Analytical Digest of Composite Parts 7/22

Digested composite plasmids to verify size.

Plasmid	DNA Added (uL)	10x Buffer 3 (uL)	100x BSA (uL)	XbaI (uL)	PstI (uL)	Water (uL)	Total (uL)	< 1 ug DNA?	Expected Size
S1 P75a 1 (7/22)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		925bp, 2750bp
S1 P75a 2 (7/22)	5	2.5 uL	0.25 uL	1 uL	1 uL	15.25	25 uL		925bp, 2750bp
S1 P75b 1 (7/22)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		925bp, 2750bp
S1 P75b 2 (7/22)	4	2.5 uL	0.25 uL	1 uL	1 uL	16.25	25 uL		925bp, 2750bp
E1 P92a 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P92b 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P93a 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P93b 1:1 (7/17)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL		2314bp, 2750bp
E1 P92a PCR (7/18)	15	2.5 uL	0.25 uL	1 uL	1 uL	5.25	25 uL	Yes	2314bp, 2750bp
S1 P93 1:3 1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P93 1:3 2 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P92a PCR 1 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P92a PCR 2 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P93b PCR 1 (7/18)	4	2.5 uL	0.25 uL	1 uL	1 uL	16.25	25 uL		2314bp, 2750bp
S1 P93b PCR 2 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P58b 1 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		937bp, 2750bp
E1 P58b 2 (7/18)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL		937bp, 2750bp
S1 P58b A (7/15)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	937bp, 2750bp
S1 P58b B (7/15)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	937bp, 2750bp
S1 P59 (7/9)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	1122bp, 2750bp
S1 P59b 1 (7/22)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	1122bp, 2750bp
S1 P59b 2 (7/18)	3	2.5 uL	0.25 uL	1 uL	1 uL	17.25	25 uL		1122bp, 2750bp

Gel Results 7/23

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	1	1 kB ladder
	2	S1 P75a 1 (7/22)
	3	S1 P75a 2 (7/22)
	4	S1 P75b 1 (7/22)
	5	S1 P75b 2 (7/22)
	6	E1 P92b 1:1 (7/17)
	7	E1 P92a 1:1 (7/17)
	8	E1 P93a 1:1 (7/17)
	9	E1 P93b 1:1 (7/17)
	10	E1 P92a PCR (7/18)
	11	S1 P93 1:3 1 (7/17)
	12	S1 P93 1:3 2 (7/17)

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	1	1 kB ladder
	2	S1 P92a PCR 1 (7/18)
	3	S1 P92a PCR 2 (7/18)
	4	S1 P93b PCR 1 (7/18)
	5	S1 P93b PCR 2 (7/18)
	6	E1 P58b 1 (7/18)
	7	E1 P58b 2 (7/18)
	8	S1 P58b A (7/15)
	9	S1 P58b B (7/15)
	10	S1 P59 (7/9)
	11	S1 P59b 1 (7/22)
	12	S1 P59b 2 (7/18)

Making Thermoinducible cI Lambda System

Primers for Taking Out cI857 from PGW7 7/21

Primer Name	Sequence
CI857_RBSfwd	Atcgagaattcgcggccgcttctagagaaagaggagaaaatgagcacaaaaaagaaac
CI857_RBSrev	Atcgatactagtagcggccgctgcagtcagccaaacgtctcttcag
CI857_BIGfwd	Atcgagaattcgcggccgcttctagagtcatgacattaacctataaa
CI857_BIGrev	atcgatactagtagcggccgctgcagcagccagcagagaattaagg

Minipreps of Transformed Parts in S1 7/22

Also includes transformed P28 and the thermoinducible lac system.

Plasmid Name	ng/uL	A260	260/280	260/230	Constant
S1 P75a 1	156.2	3.124	1.99	2.27	50
S1 P75a 2	203.24	4.065	2.04	2.23	50
S1 P75b 1	177.41	3.548	2.02	2.16	50
S1 P75b 2	258.85	5.177	2.01	2.3	50
S1 P28a 1	155.42	3.108	2.03	2.27	50
S1 P28a 2	239.51	4.79	2.06	2.26	50
S1 P28a 3	204.5	4.09	2.01	2.24	50
S1 P93 1:3 1	175.27	3.505	2.07	2.32	50
S1 P93 1:3 2	166.9	3.338	2.12	2.38	50
S1 P92a PCR 1	152.58	3.052	2.02	2.28	50
S1 P92a PCR 2	157.59	3.152	2.02	2.22	50
S1 P93b PCR 1	291.87	5.837	2.13	2.23	50
S1 P93b PCR 2	152	3.04	2.07	2.21	50

Adding Terminator Before pLambda GFP

Digestion of Terminator (P64) and pLambda GFP 7/22

'	P75a 1 (vector)	P75b 1 (vector)	P64a 07 (insert)
DNA	10 uL	10 uL	10 uL
100x BSA	0.25 uL	0.25 uL	0.25 uL
10x Buffer	2.5 uL EcoRI buffer	2.5 uL EcoRI buffer	2.5 uL EcoRI buffer
Enzyme 1	1 uL EcoRI	1 uL EcoRI	1 uL EcoRI
Enzyme 2	1 uL XbaI	1 uL XbaI	1 uL SpeI
Water	5.25 uL	5.25 uL	5.25 uL
Total	25 uL	25 uL	25 uL

Digestion Gel Results 7/23

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	1	1kB Ladder
	3	S1 P75a (2750/925)
	4	100bp Ladder
	5	S1 P75b 1 (2750/925)
	7	P64a 07 (~3kb/129bp)
	9	1kB Ladder

Extracted and purified S1 P75a 1 and P75b 1, but P64 07 has incorrect bands.

Desphosphorylated S1 P75a 1 and P75b 1 same day.

Digestion of (Almost) All of Our Terminators 7/23

'	P41	P61	P62a 07	P64
DNA	5 uL	8 uL	8 uL	8 uL
100x BSA	0.25 uL	0.25 uL	0.25 uL	0.25 uL
10x EcoRI Buffer	2.5 uL	2.5 uL	2.5 uL	2.5 uL
Enzyme 1	1 uL EcoRI	1 uL EcoRI	1 uL EcoRI	1 uL EcoRI
Enzyme 2	1 uL SpeI	1 uL SpeI	1 uL SpeI	1 uL SpeI
Water	15.25 uL	15.25 uL	15.25 uL	15.25 uL
Total	25 uL	25 uL	25 uL	25 uL

Gel? 7/24

Faint band was detected in P64 (?) but was not visible under UV when cutting, so not extracted. Will try digestion of P63, which has worked for Meng Xiao and Thilini before.

Ligation of P75 with old P63 7/24

Purified P63 cut with ES was ligated with the dephosphorylated P75 vector. Very little of the insert was available (~2 uL)

Transformed on Kan plates.

7/25: Almost all plates were blank except for positive control. One faint, questionable colony found on plate with 1 uL ligation reaction-- picked for Saturday.

Digestion of P63 (7/24) and E1 P75b (7/25)

'	P63a	P63b	E1 P75b
DNA	?	?	10 uL
100x BSA	0.25 uL	0.25 uL	0.25 uL
10x EcoRI Buffer	2.5 uL	2.5 uL	2.5 uL
Enzyme 1	1 uL EcoRI	1 uL EcoRI	1 uL EcoRI
Enzyme 2	1 uL SpeI	1 uL SpeI	1 uL XbaI
Water	?	?	10.25 uL
Total	25 uL	25 uL	25 uL

Gel Results 7/25

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	3	E1 P75b (2750/ 925 bp)
	5	1 kb Ladder
	7	P63a (95 bp)
	8	100 bp Ladder
	9	P63b (95 bp)

95 bp bands became fainter (and undetectable with gel mold on) after running the gel for more time.

E1 P75b, P63a, and P63b were extracted and purified. E1 P75b was dephosphorylated using the Roche T4 Ligation Kit Alkaline Phosphatase.

Ligation of pLambda+GFP Vector P75 with Terminator P63 7/25

'	E1 P75b + P63a (6:2)	E1 P75b + P63b (6:2)	S1 P75a + P63a (6:2)	S1 P75a + P63b (6:2)	S1 P75b + P63a (6:2)	S1 P75b + P63b (6:2)	E1 P75b + P63a (5:1)	E1 P75b + P63b (5:1)	S1 P75a + P63a (5:1)	S1 P75b + P63b (5:1)
Insert	6 uL	6 uL	6 uL	6 uL	6 uL	6 uL	5 uL	5 uL	5 uL	5 uL
Vector	2 uL	2 uL	2 uL	2 uL	2 uL	2 uL	1 uL	1 uL	1 uL	1 uL
DNA Dilution Buffer	2 uL	2 uL	2 uL	2 uL	2 uL	2 uL	2 uL	2 uL	2 uL	2 uL
Water (to 20 uL)	0 uL	0 uL	0 uL	0 uL	0 uL	0 uL	2 uL	2 uL	2 uL	2 uL
Ligation Buffer	10 uL	10 uL	10 uL	10 uL	10 uL	10 uL	10 uL	10 uL	10 uL	10 uL
Ligase	1 uL	1 uL	1 uL	1 uL	1 uL	1 uL	1 uL	1 uL	1 uL	1 uL

Transformation of P75+ P63 Ligations and PGW7

Plate	Marker	# Colonies	Plate Description
E1 P75b + P63a (6:2)	Kan	0
E1 P75b + P63b (6:2)	Kan	0
S1 P75a + P63a (6:2)	Kan	1	Single colony is fluorescent.
S1 P75a + P63b (6:2)	Kan	0
S1 P75b + P63a (6:2)	Kan	1	Single colony NOT fluorescent.
S1 P75b + P63b (6:2)	Kan	0
E1 P75b + P63a (5:1)	Kan	0
E1 P75b + P63b (5:1)	Kan	0
S1 P75a + P63a (5:1)	Kan	0
S1 P75b + P63b (5:1)	Kan	0
PGW7 1 (1 uL plasmid in 50 uL cells)	Amp	200+
PGW7 2 (1 uL plasmid in 100 uL cells)	Amp	200+
puc19 30s Heatshock	Amp	18
puc19 45s Heatshock	Amp	15
puc19 1m Heatshock	Amp	6
puc19 2m Heatshock	Amp	14
Kan (-) ctrl	Kan	0
Amp (-) ctrl	Amp	0

Gradient PCR of PGW7 Plasmid to Isolate cI857 7/25

Used primer sets RBS and BIG. Prepared enough for 4 standard reactions (50 uL each), and split into 8 reactions in strip top tubes.

Reaction Recipe:

Fwd Primer	1 uL
Rev Primer	1 uL
Platinum Supermix	45 uL
Water	2 uL

Added a total of 2 uL of PGW7 plasmid to each reaction mix (0.25 uL plasmid per 25 uL reaction).

PCR Gels 7/25

PCR using RBS Primer Set:

• Amplified region is cI857 coding region only, and primers have Biobricks prefix, suffix, and RBS.
• 675bp

	1% Agarose, visualized using EtBr/UV
	Lane	Annealing Temperature
	1	100 bp Ladder
	2	40.8
	3	41.5
	4	42.5
	5	43.9
	7	100bp Ladder
	8	45.4
	9	46.7
	10	47.6
	11	48.3
	13	1 kB Ladder

All bands were extracted and purified.

PCR using BIG Primer Set:

• Amplified region is cI857 coding region and 200bp upstream and downstream, and primers have Biobricks prefix and suffix.
• 1193bp

	1% Agarose, visualized using EtBr/UV
	Lane	Annealing Temperature
	1	1 kB Ladder
	2	40.8
	3	41.5
	4	42.5
	5	43.9
	6	45.4
	7	46.7
	8	47.6
	9	48.3
	10	100 bp Ladder

All bands were extracted and purified.

Housekeeping

Making Competent Cells 7/22

Made ~600 100uL (some were 200 uL, indicated by green dot on top) aliquots from 1L of culture. Done as per Jason's lab's protocol.

New cells seem to work, but tested heatshock times with puc19 7/25/08.

Ligations 07/22

• Attempted to ligate p40 cut with SP (w/ RBS) to mtrB cut with XP. Thus far, the ligation has not worked.

Recombination Update 07/22

• Thus far, none of the attempts to extract flanking regions from the genomic DNA have worked. We are troubleshooting this now and will run positive controls with known DNA samples to check the efficiency of our Phusion Polimerase.

07/23 Ligations/Transformations

• Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan)

Ligations 07/24

We ligated p75a w/ p63 w/ a ratio of 4ul p63:1ul p75a

Transformed into new dh5α competent cells w/ volumes of 1, 3, and 5uL, using Jason's new protocol. As a control transformed 1uL of pUC19.

PCR

mtrB

7/22: gradient + new R primer

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of mtrB BB from gel purification, 12μL water Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52-58 gradient}°C → 2m38s @72°C] → 5min @ 72°C → ∞ @ 4°C

No bands on gel from any of the conditions.

Lower gradient

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of WT S. oneidensis MR-1, 12μL water Rx: 10min @ 94°C → 40x[45s @ 94°C → 45s @ {44-51 gradient}°C → 2m45s @72°C] → 5min @ 72°C → ∞ @ 4°C

7/23: gel

All the temperatures seem to have worked (51 was not loaded due to # lanes on gel). Expected product size ~2.1kb. Ladder is 1KB.

Products from different temperatures combined and gel purified.

P51, 52, 17 MIT

17, 52:
Rx mix (split into 4 samples): 180μL Platinum PCR supermix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 8μL water
51:
Rx mix (split into 4 samples): 100μL AmpliTaq Gold Master Mix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 88μL water

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52.7, 53.6, 54.6, 55.5}°C → 1m25s @72°C] → 5min @ 72°C → ∞ @ 4°C

Results

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-4	P17 (902) (annealing temp increase LTR)
	5-8	P51 (1370) (annealing temp increase LTR)
	9-11	P53 (987) (annealing temp increase LTR)
	12	1KB plus ladder

P1, P3 backbones; HO-pcyA; P51 MIT

Conditions optimization

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {middle 8 of 41-55 gradient: 43.3, 44.9, 47.0, 49.3, 51.3, 52.8, 53.9, 54.7}°C → 3m30s @72°C] → 5min @ 72°C → ∞ @ 4°C

P1, P3

PCR product is the backbone of P1 and P3, including the RBS (B0032), weak and strong promoter respectively, and terminator. The ends have unique ApaLI and KpnI cut sites.

Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL P3minusGFP-F primer (20μM), 4μL P3minusGFP-R primer (20μM), 4μL miniprepped DNA (P1/P3), 8μL water

HO-pcyA

Ends have unique ApaLI and KpnI cut sites.

Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL HO-pcyA-F primer (20μM), 4μL HO-pcyA-R primer (20μM), 4μL miniprepped P86, 8μL water

P51 MIT

Rx mix (split into 4 samples): 90μL Platinum PCR supermix, 2μL BBsfx primer (20μM), 2μL BBpfx primer (20μM), 2μL miniprepped P51, 4μL water

Used highest 4 temps of gradient.

Gels

Annealing temp increases LTR.

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-8	P1 backbone (~3kb)
	9	1 KB ladder
	10-12	HO-pcyA (~1.4 kb)

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-5	HO-pcyA (~1.4 kb)
	6	1 KB ladder
	7-12	P3 backbone (~3 kb)

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-2	P3 backbone (~3kb)
	3	1 KB ladder
	4-7	P51 MIT (~1.4 kb)

Full Rx

400 μL (8 reactions) each of P1 and P3 were set up using a doubling of above reaction mix. The reaction conditions were the same except that annealing temperature was 45°C, and cycles occur 40 times.

100 μL (2 reactions) each of HO-pcyA and P51 MIT were set up using above reaction ratios. 40 cycles were performed with 55°C annealing temp and 1:35 extension time.

Products will be gel purified along with products from optimization PCRs.

RE digests 07/22

Gel 1

	1 agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb plus ladder
	2	CDF PCR cut XP (~900)
	3	CDF PCR uncut (~900)
	4	P1A cut XP (2750)
	5	P1A uncut (3669)
	6	P17 cut EX (5327)
	7	P17 uncut (5327)
	8	P48 cut XP (769)
	9	P48 uncut (3477)

Gel 2

	1 agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb plus ladder
	2	P49B cut XP (943)
	3	P49B uncut (3651)
	4	P51 cut EX (5795)
	5	P51 uncut (5795)
	6	P52 cut EX (5412)
	7	P52 uncut (5412)
	8	P63 cut EX (3284)
	9	P63 uncut (3284)

Gel 3

	1 agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb plus ladder
	2	P97A cut EX (2091)
	3	P97A uncut (2091)
	4	P97B cut EX (2091)
	5	P97B uncut (2091)

Ligation w/ purified products 7/22: CDF into P1 vector

• We ligated P1A (vector) to CDF. We used three different ratios of vector to insert for the ligation: 2/6, 1/5, 1/7.

RE digests 07/23

Gel 1: 1% agarose gel visualized using EtBr/UV	Lane	Contents
	1	1 kb plus ladder
	2	P97A cut SP (2091)
	3	P97A uncut
	4	P97B cut SP (2091)
	5	P97B uncut
	6	P51 cut EX (5795)
	7	P51 uncut
	8	P52 cut EX (5412)
	9	P52 uncut
	10	P90ζ cut SP (~3600)
	11	P90ζ uncut
	12	P90ε cut SP (~3600)
	13	P90ε uncut
	14	mtrB (not BioBrick) uncut PCR product (~2.1kb)

Gel 2: 1% agarose gel visualized using EtBr/UV	Lane	Contents
	1	1 kb plus ladder
	2	P17 cut EX (5327)
	3	P17 uncut
	4	S1P3A B cut XP (2750)
	5	S1P3A B uncut
	6	S1P3A C cut XP (2750)
	7	S1P3A C uncut
	8	P3A cut XP (2750)
	9	P3A uncut
	10	P3B cut XP (2750)
	11	P3B uncut
	12	mtrB BB cut XP (2100)
	13	mtrB BB uncut

Ligations with purified digest fragments 07/23: mtrB+RBS, CDF into pSB3K3

We ligated

• P97 and mtrB BB
• P3 and CDF

We used three different ratios of insert to vector for the ligation: 6/2, 5/1, 7/1.

We used 5 μL of the ligation to transform TOP10 cells and 5 μL to transform the new DH5α cells. We also used 1 μL and 3 μL to transform DH5α. We used pUC19 (1 μL) as a positive control to test the efficacy of the new DH5α cells.

We used Jason's protocol to transform the new DH5α cells:

• Thaw cells by resting tubes on ice
• Then add DNA and mix by swirling with the pipette tip
• Incubate the cells with DNA in ice for 10min
• Heat shock at 42C for 2min
• Then incubate in ice for 2-5min
• Add 500-700ml LB (or SOC) and incubate + 250rpm shaking for 1hr at 37C
• Plate

Results

Strain	DNA	Vector:Insert (μL)	Amount transformed (μL)	Plate	# colonies
E1	pUC19	n/a	1	AMP	40
E1	-	n/a	-	CARB	0
E2	P97+ mtrB BioBrick	2:6	5	CARB	136
E2	P97+ mtrB BioBrick	1:5	5	CARB	48
E2	P97+ mtrB BioBrick	1:7	5	CARB	64
E1	P97+ mtrB BioBrick	1:7	1	CARB	0
E1	P97+ mtrB BioBrick	1:7	3	CARB	0
E1	P97+ mtrB BioBrick	1:7	5	CARB	4
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	2:6	1	CARB	1
E1	P97+ mtrB BioBrick	2:6	1	CARB	7
E1	P97+ mtrB BioBrick	2:6	1	CARB	9
E2	P3+CDF	2:6	5	KAN	7
E2	P3+CDF	1:5	5	KAN	56
E2	P3+CDF	1:7	5	KAN	5
E1	P3+CDF	1:7	1	KAN	0
E1	P3+CDF	1:7	3	KAN	2
E1	P3+CDF	1:7	5	KAN	0
E1	P3+CDF	1:5	1	KAN	0
E1	P3+CDF	1:5	3	KAN	0
E1	P3+CDF	1:5	5	KAN	0
E1	P3+CDF	2:6	1	KAN	0
E1	P3+CDF	2:6	3	KAN	1
E1	P3+CDF	2:6	5	KAN	0

• Try 45s heat shock and SOC for new cells
• Try 3 or 5 μL transformations
• New Carb plates seem fine

RE digests of miniprepped ligations 07/25

Lane 1: 1 kb ladder

Lanes 2-7: P90 A-F cut SP (~3600)

Lanes 8-13: P98 A-F cut ES (~2100)

Lane 14: P3 cut XP (2750)

Ligations with purified parts and PCR products 07/26

Ligations were performed using standard protocol. New homemade cells were heat shocked for 40s, and incubated in 200μL SOC for 1 hour prior to plating on prewarmed plates. Vectors were dephosphorylated with Antarctic Phosphatase as per NEB's protocol.

Results 7/27

DNA	Strain	Vector,Insert	Plate	No. of Colonies
P3+HO-pcyA not BB PCR	E1	3,5	Kan	1
P3+HO-pcyA not BB PCR	E2	2,6	Kan	~50
P1+HO-pcyA not BB PCR	E2	2,6	Kan	~50
P1+HO-pcyA not BB PCR	E1	3,5	Kan	0
P1+mtrB not BB PCR	E2	2,6	Kan	32
P1+mtrB not BB PCR	E1	3,5	Kan	0
P3+mtrB not BB PCR	E1	3,5	Kan	13
P3+mtrB not BB PCR	E2	2,6	Kan	~80
P63+98	E1	1,7	Amp	TMTC
P63+98	E2	2,6	Amp	TMTC
P3+51 PCR	E2	2,6	Kan	~120
P3+51 PCR	E1	3,5	Kan	59
P90+49	E1	1.5,6.5	Amp	TMTC
P90+49	E2	2,6	Amp	TMTC
P90+48	E1	1.5,6.5	Cm	~80
P90+48	E2	2,6	Cm	TMTC
pUC19 (positive control)	E1	1 ul	Carb	~200

2 non-fluorescent colonies picked for 5mL cultures for each plate when possible.

RE digests 07/24

	1% agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb ladder
	2	P1A uncut (~3600)
	3	P1A cut EP (~2750)
	4	P3A uncut (~3600)
	5	P3A cut EP (~2750)
	6	P17 PCR cut XP (902)
	7	P52 PCR cut XP (987)
	8	P90.4 uncut (~3600)
	9	P90.1 cut SP (~3600)
	10	P90.2 cut SP (~3600)
	11	P90.3 cut SP (~3600)
	12	P90.4 cut SP (~3600)

Ligations w/ purified digest fragments 07/24

Vector:insert ratio: 2:6 μL, volume used in transformation: 4μL

Note that 45s heat shock was used for DH5α, and cells were split onto 2 plates to accelerate drying.

Results 7/25

DNA	Strain	Plate	# Colonies
P1+P17	E2	KAN	184
P1+P17	E1	KAN	9
P1+P17	E1	KAN	9
P1+P52	E2	KAN	40
P1+P52	E1	KAN	0
P1+P52	E1	KAN	0
P3+P17	E2	KAN	10
P3+P17	E1	KAN	0
P3+P17	E1	KAN	0
P3+P52	E2	KAN	48
P3+P52	E1	KAN	1
P3+P52	E1	KAN	1
P38+P17	E2	KAN	1
P38+P17	E1	KAN	0
P38+P17	E1	KAN	0
P38+P51	E2	KAN	32
P38+P51	E1	KAN	1
P38+P51	E1	KAN	0
P38+P52	E2	KAN	1
P38+P52	E1	KAN	0
P38+P63	E1	KAN	0
P39+P17	E1	KAN	0
P39+P17	E1	KAN	0
P39+P17	E2	KAN	0
P39+P51	E2	KAN	5
P39+P51	E1	KAN	2
P39+P51	E1	KAN	2
P39+P52	E2	KAN	6
P39+P52	E1	KAN	1
P39+P52	E1	KAN	1
P90+P48	E2	CM	16
P90+P48	E1	CM	5
P90+P48	E1	CM	1
P90+P49	E2	AMP	TMTC
P90+P49	E1	AMP	19
P90+P49	E1	AMP	4
pUC19	E1	AMP	192

Cultures for miniprep

When possible, 2 non-fluorescent colonies were picked from each plate (fluorescence in the P1/P3 derived plasmids indicates P1/P3 vector religation).

• The 2 E2 P90+49 cultures failed to grow. Note that Kan selection was used, as that's carried on P90, although the transformation plates were Amp.

RE digests of minipreps 07/26

We digested

• P46 with NheI
• P90+49 and P90+48 with XbaI and SpeI
• When these parts are combined, we will have a plasmid with the CDF origin (CDF+Amp and CDF+Cm in the base vector)

• P3+17 and P1+17 with EcoRI and XbaI
• We can add the high and low constitutive promoters to give us the complete Tet system (without GFP) in a p15A vector

• P39+51, P38+51, P38+17 with XbaI and PstI
• We can put these parts into P1 and P3 to give us the complete Tet and Lac systems in a p15A vector

Results

Gel 1: 1% agarose gel visualized using EtBr/UV	Lane	Contents (expected band sizes)
	1	1KB PLUS LADDER
	2	E2 90+48A XS (1650+2750)
	3	E2 90+48B XS (1650+2750)
	4	E1 90+48A XS (1650+2750)
	5	E1 90+48B XS (1650+2750)
	6	E1 90+48C XS (1650+2750)
	7	E1 90+49A XS (1800+2750)
	8	E1 90+49B XS (1800+2750)
	9	E1 39+51A XP (1400+4425)
	10	E2 39+51B XP (1400+4425)
	11	E2 39+51A XP (1400+4425)
	12	E1 90+49D XS (1800+2750)
	13	E1 90+49C XS (1800+2750)
	14	E1 39+51B XP (1400+4425)
	15	E1 39+51C XP (1400+4425)

Gel 2: 1% agarose gel visualized using EtBr/UV	Lane	Contents (expected band sizes)
	1	E1 39+51D XP (1400+4425)
	2	E2 38+51A XP (1400+4425)
	3	E2 38+51B XP (1400+4425)
	4	E2 38+17 XP (950+2750)
	5	E1 38+51 XP (1400+4425)
	6	P46B NheI (943+1495)
	7	E1 1+17A EX
	8	E1 1+17B EX
	9	E1 1+17C EX
	10	E1 1+17D EX
	11	E2 1+17A EX
	12	E2 1+17B EX
	13	E2 3+17A EX
	14	E2 3+17B EX
	15	P1B XP (919+2750)
	16	P3A XP (919+2750)
	17	1KB PLUS LADDER

Cultures were set up again for samples 7-14, since the DNA seems to have not run properly.

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Permanent link
• Privacy policy
• Disclaimers