User:Caleb Dulaney/How to make BioBricks
From 2008.igem.org
BioBrick Construction
BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix.
- Prefix: the prefix is DNA located before the actual gene you're using.
- If the sequence codes for protein it is: gaattcgcggccgcttctag
- If not, the sequence is: gaattcgcggccgcttctagag
- Suffix: the suffix is DNA located after the gene.
- No matter what type of part you're using, the suffix is: tactagtagcggccgctgcag
These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.