EPF-Lausanne/5 September 2008
From 2008.igem.org
<<Previous - Back to Notebook - Next>>
Sequencing
We want to sequence AB and CD. We designed the following primers:
tcacgaggcagaatttcaga, pSB1A2FW
aaccgtattaccgcctttga, pSB1A2RV
gcgaccagcagaacatctc, AB1seqFW
ccagactctaagcggctcac, AB2seqFW
caattagcctttttatgccaaca, CD1FW
The first two primers are on the plasmid pSB1A2 and can thus be reused as primers for all parts in the same plasmid. The 3 others are specific to AB resp. CD. The primers have been ordered today.