User contributions
From 2008.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 06:18, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:59, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:57, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:56, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:33, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:04, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Results) (top)
- 05:00, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Results)
- 02:35, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Results)
- 02:33, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Reporting Assay 3)
- 02:24, 30 October 2008 (diff | hist) N File:NYMU RA3 sine.png (top)
- 02:24, 30 October 2008 (diff | hist) N File:NYMU RA3 osctun.png (top)
- 02:23, 30 October 2008 (diff | hist) N File:NYMU RA3 osc.png (top)
- 02:23, 30 October 2008 (diff | hist) N File:NYMU RA3 LB.png (top)
- 02:03, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Reporting Assay 2)
- 01:58, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Reporting Assay 1)
- 01:49, 30 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (New page: Only the Oscillator, Tuner, and Reporter was successfully ligated together, so we performed a few Reporting As...)
- 01:30, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator (→Experimental Results) (top)
- 01:15, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Cyanoxilator)
- 01:13, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence (→Seq pOmpF) (top)
- 01:12, 30 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence (New page: ==Seq pOmpF== GACGGTGTTCACAAAGTTCCTTAAATTTTACTTTTGGTTACATATTTTTTCTTTTTGAAACCAAATCTTTATCTTTGTAG CACTTTCACGGTAGCGAAACGTTAGTTTGAATGGAAAGATGCCTGC ==Seq RpaA== ATGAAACCCCGCATCCTCGTGATCGA...)
- 01:07, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Cyanoxilator)
- 01:06, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Cyanoxilator)
- 00:53, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments
- 00:47, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Experimental Results)
- 00:46, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Experimental Results)
- 00:45, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments
- 00:36, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project
- 00:35, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project
- 00:32, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator (top)
- 00:32, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator
- 00:31, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator
- 00:28, 30 October 2008 (diff | hist) N File:NYMU PCR rpaa sasa.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU FRpfu47.JPG (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 20080930 od lb.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 20080929 od m9.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 1004ODm9m.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 1004odlbm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 1004GFPm9m.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 1004gfplbm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0930GFPm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0929GFPm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0914BR,FS49.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0910cyanopfu47M.JPG (top)
- 00:26, 30 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator (New page: {{:Team:NYMU-Taipei/Header}} === Extraction of the genomic DNA of S. elongatus PCC 7942=== {| | Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG | * tube 1: 101.3 ng/uL (26...)
- 00:25, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Cyanoxilator (top)
- 00:22, 30 October 2008 (diff | hist) N File:NYMU Cyano promoter reporter.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Timer cyano.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Takao.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Susan.jpg (top)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)