http://2008.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Dirkvandepol&year=&month=2008.igem.org - User contributions [en]2024-03-29T10:08:09ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/CCSF_ProtocolsTemplate:Team:CityColSanFrancisco/Notebook/Notebook/CCSF Protocols2009-07-09T19:42:04Z<p>Dirkvandepol: </p>
<hr />
<div><Br><br />
BASIC TRANSFORMATION PROTOCOL FOR USING CCSF COMPETENT CELLS<br><br />
1. Thaw competent cells on ice for 10 min.<br><br />
2. Pipet 200uL cells into chilled 1.5mL rube containing 1 uL plasmid of interest <br><br />
3. Mix gently by tapping <br><br />
4. Incubate cells on ice in presence of plasmid for ~20 min. <br><br />
5. Heat shock at 42C for 90 sec. <br><br />
6. Return to ice for 2 min. <br><br />
7. Plate 100uL of transformation onto LB-amp plate <br><br />
<br />
<br><br />
BASIC PROTOCOL FOR ACCESSING iGEM PARTS DISTRIBUTION DNA<br><br />
1. Find desired part at partsregistry.org <br><br />
2. Click "get this part" to find distribution plate number and coordinates.<br><br />
3. Clean foil surface of desired plate with a little ethanol. <br><br />
4. Pierce through foil surface with sterile pipet tip (on a pipet of course) containing 15uL sterile dH2O.<br><br />
5. Pipet up & down a couple of times to dissolve the DNA and buffer in the dH2O.<br><br />
6. Pipet the plasmid dilution into a labelled, sterile 1.5mL tube.<br><br />
7. Put the labelled tube into the CCSF DNA box, and note the box coordinates into which the tube is placed.<br><br />
8. Document the location of the tube on the Google doc "CCSF DNA box index", found at http://spreadsheets.google.com/ccc?key=t0CX5NWkXQL0_8v-w2MZaGA&inv=dirkvandepol%40gmail.com&t=7890798853979134080<br></div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/CCSF_ProtocolsTemplate:Team:CityColSanFrancisco/Notebook/Notebook/CCSF Protocols2009-07-09T19:41:28Z<p>Dirkvandepol: </p>
<hr />
<div><Br><br />
BASIC TRANSFORMATION PROTOCOL FOR USING CCSF COMPETENT CELLS<br><br />
1. Thaw competent cells on ice for 10 min.<br><br />
2. Pipet 200uL cells into chilled 1.5mL rube containing 1 uL plasmid of interest <br><br />
3. Mix gently by tapping <br><br />
4. Incubate cells on ice in presence of plasmid for ~20 min. <br><br />
5. Heat shock at 42C for 90 sec. <br><br />
6. Return to ice for 2 min. <br><br />
7. Plate 100uL of transformation onto LB-amp plate <br><br />
<br />
<br><br />
BASIC PROTOCOL FOR ACCESSING iGEM PARTS DISTRIBUTION DNA<br><br />
1. Find desired part at partsregistry.org <br><br />
2. Click "get this part" to find distribution plate number and coordinates.<br />
3. Clean foil surface of desired plate with a little ethanol.<br />
4. Pierce through foil surface with sterile pipet tip (on a pipet of course) containing 15uL sterile dH2O.<br />
5. Pipet up & down a couple of times to dissolve the DNA and buffer in the dH2O.<br />
6. Pipet the plasmid dilution into a labelled, sterile 1.5mL tube<br />
7. Put the labelled tube into the CCSF DNA box, and note the box coordinates into which the tube is placed.<br />
8. Document the location of the tube on the Google doc "CCSF DNA box index", found at http://spreadsheets.google.com/ccc?key=t0CX5NWkXQL0_8v-w2MZaGA&inv=dirkvandepol%40gmail.com&t=7890798853979134080</div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/CCSF_ProtocolsTemplate:Team:CityColSanFrancisco/Notebook/Notebook/CCSF Protocols2009-07-09T19:23:37Z<p>Dirkvandepol: </p>
<hr />
<div><Br><br />
BASIC TRANSFORMATION PROTOCOL FOR USING CCSF COMPETENT CELLS<br><br />
1. Thaw competent cells on ice for 10 min.<br><br />
2. Pipet 200uL cells into chilled 1.5mL rube containing 1 uL plasmid of interest <br><br />
3. Mix gently by tapping <br><br />
4. Incubate cells on ice in presence of plasmid for ~20 min. <br><br />
5. Heat shock at 42C for 90 sec. <br><br />
6. Return to ice for 2 min. <br><br />
7. Plate 100uL of transformation onto LB-amp plate <br></div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/CCSF_ProtocolsTemplate:Team:CityColSanFrancisco/Notebook/Notebook/CCSF Protocols2009-07-09T19:19:48Z<p>Dirkvandepol: New page: <Br> BASIC TRANSFORMATION PROTOCOL FOR USING CCSF COMPETENT CELLS 1. Thaw competent cells on ice for 10 min. 2. Pipet 200uL cells into chilled 1.5mL rube containing 1 uL plasmid of interes...</p>
<hr />
<div><Br><br />
BASIC TRANSFORMATION PROTOCOL FOR USING CCSF COMPETENT CELLS<br />
1. Thaw competent cells on ice for 10 min.<br />
2. Pipet 200uL cells into chilled 1.5mL rube containing 1 uL plasmid of interest<br />
3. Mix gently by tapping<br />
4. Incubate cells on ice in presence of plasmid for ~20 min.<br />
5. Heat shock at 42C for 90 sec.<br />
6. Return to ice for 2 min.<br />
7. Plate 100uL of transformation onto LB-amp plate</div>Dirkvandepolhttp://2008.igem.org/Team:CityColSanFrancisco/Notebook/LabBooks/DirkTeam:CityColSanFrancisco/Notebook/LabBooks/Dirk2009-07-09T19:13:56Z<p>Dirkvandepol: </p>
<hr />
<div>Welcome to Dirk's CCSF iGEM 2009 Notebook!<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/CCSF Protocols| CCSF Protocols]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/DV_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_construction | My Construction Files]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notes| My Notes]]<br></div>Dirkvandepolhttp://2008.igem.org/Team:CityColSanFrancisco/Notebook/LabBooks/DirkTeam:CityColSanFrancisco/Notebook/LabBooks/Dirk2009-07-09T19:10:57Z<p>Dirkvandepol: </p>
<hr />
<div>Welcome to Dirk's CCSF iGEM 2009 Notebook!<br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notes| CCSF Protocols]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/DV_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_construction | My Construction Files]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notes| My Notes]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notes| CCSF Protocols]]<br></div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notesTemplate:Team:CityColSanFrancisco/Notebook/Notebook/DV notes2009-06-30T17:37:29Z<p>Dirkvandepol: </p>
<hr />
<div>Hello <br><br />
6/29/2009<br />
R. palustris TIE-1 and S. oneidensis WT strains appear to have grown. Gram staining of S. oneidensis WT revealed what appeared to be gram-negative rods; primers being designed for a unique S. oneidensis sequence to confirm species is what we suspect.<br />
Plan now to:<br />
- inoculate liquid media with single colonies from these strains.<br />
-Inoculate <br />
- Re-streak individual colonies from these strains, along with TIE-3 (R. palustris) and MtrB and OmpB strains (S. oneidensis) <br />
<br />
Tomorrow:<br />
-Order designed primers<br />
-Grow mutants in liquid media<br><br />
<br />
6/30/2009 <br><br />
Grew mutants alongside WT Shewanella. They don't look alike. I'm suspicious.</div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notesTemplate:Team:CityColSanFrancisco/Notebook/Notebook/DV notes2009-06-29T20:51:13Z<p>Dirkvandepol: </p>
<hr />
<div>Hello <br><br />
6/29/2009<br />
R. palustris TIE-1 and S. oneidensis WT strains appear to have grown. Gram staining of S. oneidensis WT revealed what appeared to be gram-negative rods; primers being designed for a unique S. oneidensis sequence to confirm species is what we suspect.<br />
Plan now to:<br />
- inoculate liquid media with single colonies from these strains.<br />
-Inoculate <br />
- Re-streak individual colonies from these strains, along with TIE-3 (R. palustris) and MtrB and OmpB strains (S. oneidensis) <br />
<br />
Tomorrow:<br />
-Order designed primers<br />
-Grow mutants in liquid media</div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notesTemplate:Team:CityColSanFrancisco/Notebook/Notebook/DV notes2009-06-29T20:16:13Z<p>Dirkvandepol: </p>
<hr />
<div>Hello <br><br />
6/29/2009<br />
R. palustris TIE-1 and S. oneidensis WT strains appear to have grown. Gram staining of S. oneidensis WT revealed what appeared to be gram-negative rods; primers being designed for a unique S. oneidensis sequence to confirm species.</div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notesTemplate:Team:CityColSanFrancisco/Notebook/Notebook/DV notes2009-06-29T20:11:38Z<p>Dirkvandepol: </p>
<hr />
<div>'Hello'</div>Dirkvandepolhttp://2008.igem.org/Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notesTemplate:Team:CityColSanFrancisco/Notebook/Notebook/DV notes2009-06-29T20:11:23Z<p>Dirkvandepol: New page: ''Hello''</p>
<hr />
<div>''Hello''</div>Dirkvandepolhttp://2008.igem.org/Team:CityColSanFrancisco/Notebook/LabBooks/DirkTeam:CityColSanFrancisco/Notebook/LabBooks/Dirk2009-06-25T17:59:14Z<p>Dirkvandepol: </p>
<hr />
<div>Welcome to Dirk's CCSF iGEM 2009 Notebook!<br />
<br />
[[Template:Team:CityColSanFrancisco/Notebook/DV_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_construction | My Construction Files]]<br><br />
[[Template:Team:CityColSanFrancisco/Notebook/Notebook/DV_notes| My Notes]]<br></div>Dirkvandepolhttp://2008.igem.org/Team:CityColSanFrancisco/Notebook/LabBooks/DirkTeam:CityColSanFrancisco/Notebook/LabBooks/Dirk2009-06-25T17:57:44Z<p>Dirkvandepol: New page: Welcome to Dirk's CCSF iGEM 2009 Notebook!</p>
<hr />
<div>Welcome to Dirk's CCSF iGEM 2009 Notebook!</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-30T03:20:14Z<p>Dirkvandepol: /* Layered Assembly */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transferred to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayGenomicTeam:UC Berkeley/GatewayGenomic2008-10-30T03:18:39Z<p>Dirkvandepol: /* Details about Plasmids and Strains */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Genomic Based Gateway'''</font></div><br><br />
<br />
==Introduction==<br />
The ''in vivo'' plasmid based gateway scheme was successful and produced the desired product, but it also yielded a considerable amount of background. Closer analysis of the side products revealed that the background resulted from ''ccdB'' mutations that arose when the gene replicated and recombined ''in vivo''. In an effort to circumvent background resulting from mutations in a negative selection gene, we decided to use positive selection. This way, we would be able to select for the desired products rather than selecting against unwanted side products and unreacted starting materials.<br />
<br />
In order to implement positive selection, we used inducible origins of replication on our plasmids. These origins of replication will only be functional and allow plasmid replication if a specific protein is expressed in the cell. In our design, the assembly vector with an ''oriR6K'' origin (induced by the protein Pir) is integrated into the genome. The gene of interest alongside an ''oriV'' origin (induced by the protein TrfA) can then recombine with the genome. In this manner, the gene of interest can be moved to an assembly vector by inserting the entry vector into the genome. We could allow selective replication of the plasmids in our scheme by performing the reaction in a cell expressing TrfA and then transforming the resulting mixture of plasmids into a cell expressing Pir.<br />
<br />
We also incorporated our lysis device into our new entry vector in order to simplify the experimental protocol for this scheme by eliminating mini-preps.<br />
<br />
==Details about Plasmids and Strains==<br />
<br />
===Plasmids===<br />
The entry plasmid in this scheme contains both the part of interest and an ''oriV'' origin of replication within the attL recombination sites, thereby allowing this origin to be transferred to the desired product. Since the entry plasmid has no constitutive origin of replication, it can only replicate in the presence of the protein TrfA. With the exception of the change in type and placement of the origin of replication, the entry plasmid maintains the same features as the traditional entry plasmid, pBca1256.<br />
<br />
[[Image:OriV entry vector.jpg]]<br />
<br />
In variations on this scheme where Xis and Int are not integrated into the genome, they are placed prior to the'' attL1'' site under the control of a temperature sensitive promoter. In an effort to streamline this method, we also considered a variation where the lysis device was placed before Xis and Int in the entry plasmid.<br />
<br />
===Strains===<br />
This scheme utilizes strains that include the assembly vector in the genome. The traditional double-antibiotic assembly vector has been modified to include an ''oriR6K'' origin of replication (which can be induced by the Pir protein) in place of a constitutively active replication origin. Since the integrated vector includes the ''attR2'' sites that usually flank the vector region of the assembly plasmid, the ''attL1'' sites in the entry plasmid can recombine with the genome to produce the desired product.<br />
<br />
In addition to the integrated assembly vector, the strains also include TrfA in the genome to allow the replication of the entry vector containing an ''oriV'' origin. Additionally, one variation on this scheme has ''xis'' and ''int'' placed in the the genome to catalyze the recombination reaction.<br />
<br />
[[Image:Genomic Gateway Overview.jpg]]<br />
<br />
==General Procedure==<br />
In this scheme, the ''oriV'' version of the entry plasmid can simply be transformed into the integrated strain containing the desired assembly vector and TrfA. In order to catalyze the reaction, Xis and Int must be present either on the plasmid or in the genome. <br />
<br />
Once the entry plasmid has been transformed and the reaction has been catalyzed, the desired product will be able to replicate in the cytoplasm of the cell using the ''oriV'' origin that was transferred with the part from the entry vector to the assembly vector. The product can be released from the cell by inducing our self-lysis device (which can be installed in the entry vector) or by doing a mini-prep.<br />
<br />
Once the plasmids in the cell's cytoplasm have been obtained, they need to be transformed into cells that express the Pir protein. This will allow for the selective replication of the desired product, which contains an ''oriR6K'' origin obtained from the assembly vector that was originally in the genome. <br />
<br />
The potential source of background in this scheme is the unreacted entry plasmid. However, this plasmid does not have an ''oriR6K'' origin (it only contains an ''oriV'' origin), so it is unable to replicate in cells that express Pir instead of TrfA. Differential antibiotic markers would assist in screening against the bleed-through of the starting plasmid, but only positive selection can eliminate the need to screen for contransformants (which contain both the starting plasmid in addition to the desired product).<br />
<br />
==Conclusion==<br />
With the incorporation of the lysis device, the genomic Gateway scheme promises to be an improvement to the plasmid based Gateway scheme because it eliminates unwanted background by using positive selection. However, the protocol for this scheme still requires that the plasmid mixture is transformed into another cell strain to select for the desired product. We sought to further streamline this scheme by utilizing phagemids, which can lyse the cell and infect other cells without the need for either mini-preps or transformation.<br />
<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPhagemid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/ModelingTeam:UC Berkeley/Modeling2008-10-30T02:45:09Z<p>Dirkvandepol: /* Graphs */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Modeling'''</font></div><br><br />
<br />
=='''Motivation'''==<br />
<br />
Since several phage systems and many promoters are currently in use, understanding the important parameters of the system allows one to choose appropriate promoters and phage proteins to optimize lysis behavior. Therefore we have created a model that is in agreement with our experimental results and published data regarding the T4 and λ phage systems.<br />
<br />
=='''Introduction'''==<br />
<br />
The holin-lysozyme phage lysis device consists of three proteins: <br />
<br />
Holin - inner membrane-bound proteins that when complexed with other holin proteins, create holes in the membrane that allow lysozyme access to the periplasm. <br />
<br />
Antiholin - inner membrane-bound protein that binds to and inactivates holin, producing an inactive holin-antiholin dimer. This dimer becomes active after holin forms enough pores in the plasma membrane to cause a loss of proton motive force between the periplasm and the cytosol.<br />
<br />
Lysozyme - once holin forms pores in the inner membrane, lysozyme enters the periplasm and degrades peptidoglycan, resulting in cell lysis.<br />
<br />
[[Image:holinantiholin1.jpg]]<br />
<br />
=='''Governing Equations'''==<br />
Our holin-lysozyme lysis device consists of holin and lysozyme under an inducible promoter and antiholin under a constitutive promoter. For more information on our lysis device, click here [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]].<br />
<br />
The kinetics of our phage lysis device was modeled to help our team gain an insight into the behavior of our system. The below equations describe our system <br />
<br />
[[Image:cdb1.jpg]]<br />
<br />
Where P<sub>H</sub> represent the holin mRNA promoter strength as a function of arabinose concentration and P<sub>AH</sub> represents the antiholin mRNA promoter strength. γ<sub>mRNA,H</sub> and γ<sub>mRNA,AH</sub> represent the degradation rates for holin and antiholin respectively and γ represents the protein degradation rate. k<sub>H</sub> and k<sub>AH</sub> represent the rate constants for holin and antiholin formation. and k<sub>c</sub> and k<sub>u</sub> represent the coupling and uncoupling rates for the holin-antiholin dimer.<br />
<br />
=='''Transfer Function and Dimensionless Parameters'''== <br />
<br />
At steady state, <br />
<br />
[[Image:cdb2.jpg]] <br />
<br />
By making this assumption, the system of equations can be simplified into the following transfer function<br />
<br />
[[Image:cdb3.jpg]] <br />
<br />
Where the system can be divided into three dimensionless parameters which describe the behavior of the holin-antiholin dimer and the holin and antiholin proteins.<br />
<br />
[[Image:cdb4.jpg]] <br />
<br />
These dimensionless numbers can assist in the optimization of lysis device design because they describe the important parameters in the system.<br />
<br />
For example, Ω<sub>H</sub> consists of the rate constants for the formation of holin mRNA and the holin protein divided by their degradation rates. Strong promoters on holin will increase the value of Ω<sub>H</sub>, while high protein degradation rates will decrease Ω<sub>H</sub>.<br />
<br />
Ω<sub>AH</sub> describes the rate constants and degradation rates for antiholin.<br />
<br />
Φ describes the importance of the coupling and uncoupling rates of holin-antiholin dimer as well as the degradation rate of the dimer.<br />
<br />
=='''Graphs'''==<br />
<br />
Physiologically relevant values for Ω<sub>H</sub>, Ω<sub>AH</sub> and Φ were estimated based on rate constants for similar proteins. This system was input into MatLab to produce the following graph. Since there is a degree of uncertainty in these estimates, the graph spans several orders of magnitude above and below our estimated values. For the MatLab code used to produce these graphs, please click here: [[Matlab code]]. <br />
<br />
[[Image:cdb5.jpg]]<br />
<br />
The literature indicates that at the time of lysis, cells infected with λ phage have approximately 1000 holin proteins<sup>1</sup>. Therefore, the critical concentration of holin (H<sub>c</sub>) was set at 1000 holin proteins per cell. <br />
<br />
The horizontal line at y=1 represents the critical holin concentration needed induce lysis. If the system produces more than the critical concentration of holin (>1000 free holin proteins), lysis is expected to occur.<br />
<br />
As one would expect by looking at the dimensionless value for holin (omega<sub>H</sub>), as the strength of the holin promoter increases, the amount of holin at steady state increases. <br />
<br />
The graph also shows that the system is not very sensitive to small amounts of antiholin. Larger amounts of antiholin push the system equilibrium to the left and would require a stronger promoter on holin or a weaker binding interaction between holin and antiholin to reach critical concentration. This is supported by the observation that in a system with no antiholin, lysis can occur with holin under a weaker promoter.<br />
<br />
Varying Φ, the dimensionless parameter that describes the coupling and uncoupling behavior of the holin-antiholin dimer, reveals that when the binding of holin-antiholin is stronger, a stronger promoter is required to reach the critical holin concentration.<br />
<br />
=='''Conclusions'''==<br />
There are several aspects of the model that agree with our experimental results and published data regarding phage lysis: <br />
<br />
1. Our experimental results show that at higher concentrations of arabinose, lysis occurs more readily. In our model, higher concentrations of arabinose increase the value of P<sub>H</sub> and thus increase the value of omega<sub>H</sub>. Our model predicts that as omega<sub>H</sub> increases, lysis is more likely to occur.<br />
<br />
2. Our experimental results showed that the T4 lysis device results in lysis at a lower concentration of arabinose than our λ lysis device when the systems are under the same promoter. λ antiholin and holin should have similar degradation rates because both are membrane-bound and only differ by two amino acids<sup>2</sup>. In contrast, T4 antiholin is an unstable cytoplasmic protein with a rapid degradation rate (t<sub>1/2</sub> = 2 min)<sup>3</sup>. Therefore γ should be larger in the T4 system, resulting in a larger value for Φ. This will shift the graph up and allow the system to reach the critical holin concentration more readily (see graph with Φ =400). <br />
<br />
3. Our model shows that systems with low values of omega<sub>AH</sub> (weaker antiholin mRNA or protein promoter) will lyse more readily than systems with large values of omega<sub>AH</sub>. This is in agreement with previously published results that show that in cells with little or no antiholin, lysis occurs more readily <sup>2</sup>. <br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/Assembly" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
<small>1. Christos G. Savva, Jill S. Dewey, John Deaton, Rebecca L. White, Douglas K. Struck, Andreas Holzenburg and Ry Young. The holin of bacteriophage lambda forms rings with large diameter. Molecular Microbiology 69(4), 784–793. 2008.<br />
<br />
2. Martin Steiner and Udo Bläs. Charged amino-terminal amino acids affect the lethal capacity of Lambda lysis proteins S107 and S105. Molecular Microbiology. 8(3), 525 - 533. Oct. 2006.<br />
<br />
3. Tram Anh T. Tran, Douglas K. Struck, and Ry Young*. The T4 RI Antiholin Has an N-Terminal Signal Anchor Release Domain That Targets It for Degradation by DegP. Journal of Bacteriology. 7618–7625. Nov. 2007. </small></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/ModelingTeam:UC Berkeley/Modeling2008-10-30T02:43:52Z<p>Dirkvandepol: /* Transfer Function and Dimensionless Parameters */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Modeling'''</font></div><br><br />
<br />
=='''Motivation'''==<br />
<br />
Since several phage systems and many promoters are currently in use, understanding the important parameters of the system allows one to choose appropriate promoters and phage proteins to optimize lysis behavior. Therefore we have created a model that is in agreement with our experimental results and published data regarding the T4 and λ phage systems.<br />
<br />
=='''Introduction'''==<br />
<br />
The holin-lysozyme phage lysis device consists of three proteins: <br />
<br />
Holin - inner membrane-bound proteins that when complexed with other holin proteins, create holes in the membrane that allow lysozyme access to the periplasm. <br />
<br />
Antiholin - inner membrane-bound protein that binds to and inactivates holin, producing an inactive holin-antiholin dimer. This dimer becomes active after holin forms enough pores in the plasma membrane to cause a loss of proton motive force between the periplasm and the cytosol.<br />
<br />
Lysozyme - once holin forms pores in the inner membrane, lysozyme enters the periplasm and degrades peptidoglycan, resulting in cell lysis.<br />
<br />
[[Image:holinantiholin1.jpg]]<br />
<br />
=='''Governing Equations'''==<br />
Our holin-lysozyme lysis device consists of holin and lysozyme under an inducible promoter and antiholin under a constitutive promoter. For more information on our lysis device, click here [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]].<br />
<br />
The kinetics of our phage lysis device was modeled to help our team gain an insight into the behavior of our system. The below equations describe our system <br />
<br />
[[Image:cdb1.jpg]]<br />
<br />
Where P<sub>H</sub> represent the holin mRNA promoter strength as a function of arabinose concentration and P<sub>AH</sub> represents the antiholin mRNA promoter strength. γ<sub>mRNA,H</sub> and γ<sub>mRNA,AH</sub> represent the degradation rates for holin and antiholin respectively and γ represents the protein degradation rate. k<sub>H</sub> and k<sub>AH</sub> represent the rate constants for holin and antiholin formation. and k<sub>c</sub> and k<sub>u</sub> represent the coupling and uncoupling rates for the holin-antiholin dimer.<br />
<br />
=='''Transfer Function and Dimensionless Parameters'''== <br />
<br />
At steady state, <br />
<br />
[[Image:cdb2.jpg]] <br />
<br />
By making this assumption, the system of equations can be simplified into the following transfer function<br />
<br />
[[Image:cdb3.jpg]] <br />
<br />
Where the system can be divided into three dimensionless parameters which describe the behavior of the holin-antiholin dimer and the holin and antiholin proteins.<br />
<br />
[[Image:cdb4.jpg]] <br />
<br />
These dimensionless numbers can assist in the optimization of lysis device design because they describe the important parameters in the system.<br />
<br />
For example, Ω<sub>H</sub> consists of the rate constants for the formation of holin mRNA and the holin protein divided by their degradation rates. Strong promoters on holin will increase the value of Ω<sub>H</sub>, while high protein degradation rates will decrease Ω<sub>H</sub>.<br />
<br />
Ω<sub>AH</sub> describes the rate constants and degradation rates for antiholin.<br />
<br />
Φ describes the importance of the coupling and uncoupling rates of holin-antiholin dimer as well as the degradation rate of the dimer.<br />
<br />
=='''Graphs'''==<br />
<br />
Physiologically relevant values for Ω<sub>H</sub>, Ω<sub>AH</sub> and Φ were estimated based on rate constants for similar proteins. This system was input into MatLab to produce the following graph. Since there is a degree of uncertainty in these estimates, the graph spans several orders of magnitude above and below our estimated values. For the MatLab code used to produce these graphs, please click here [[Matlab code]]. <br />
<br />
[[Image:cdb5.jpg]]<br />
<br />
The literature indicates that at the time of lysis, cells infected with λ phage have approximately 1000 holin proteins<sup>1</sup>. Therefore, the critical concentration of holin (H<sub>c</sub>) was set at 1000 holin proteins per cell. <br />
<br />
The horizontal line at y=1 represents the critical holin concentration needed induce lysis. If the system produces more than the critical concentration of holin (>1000 free holin proteins), lysis is expected to occur.<br />
<br />
As one would expect by looking at the dimensionless value for holin (omega<sub>H</sub>), as the strength of the holin promoter increases, the amount of holin at steady state increases. <br />
<br />
The graph also shows that the system is not very sensitive to small amounts of antiholin. Larger amounts of antiholin push the system equilibrium to the left and would require a stronger promoter on holin or a weaker binding interaction between holin and antiholin to reach critical concentration. This is supported by the observation that in a system with no antiholin, lysis can occur with holin under a weaker promoter.<br />
<br />
Varying Φ, the dimensionless parameter that describes the coupling and uncoupling behavior of the holin-antiholin dimer, reveals that when the binding of holin-antiholin is stronger, a stronger promoter is required to reach the critical holin concentration.<br />
<br />
=='''Conclusions'''==<br />
There are several aspects of the model that agree with our experimental results and published data regarding phage lysis: <br />
<br />
1. Our experimental results show that at higher concentrations of arabinose, lysis occurs more readily. In our model, higher concentrations of arabinose increase the value of P<sub>H</sub> and thus increase the value of omega<sub>H</sub>. Our model predicts that as omega<sub>H</sub> increases, lysis is more likely to occur.<br />
<br />
2. Our experimental results showed that the T4 lysis device results in lysis at a lower concentration of arabinose than our λ lysis device when the systems are under the same promoter. λ antiholin and holin should have similar degradation rates because both are membrane-bound and only differ by two amino acids<sup>2</sup>. In contrast, T4 antiholin is an unstable cytoplasmic protein with a rapid degradation rate (t<sub>1/2</sub> = 2 min)<sup>3</sup>. Therefore γ should be larger in the T4 system, resulting in a larger value for Φ. This will shift the graph up and allow the system to reach the critical holin concentration more readily (see graph with Φ =400). <br />
<br />
3. Our model shows that systems with low values of omega<sub>AH</sub> (weaker antiholin mRNA or protein promoter) will lyse more readily than systems with large values of omega<sub>AH</sub>. This is in agreement with previously published results that show that in cells with little or no antiholin, lysis occurs more readily <sup>2</sup>. <br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/Assembly" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
<small>1. Christos G. Savva, Jill S. Dewey, John Deaton, Rebecca L. White, Douglas K. Struck, Andreas Holzenburg and Ry Young. The holin of bacteriophage lambda forms rings with large diameter. Molecular Microbiology 69(4), 784–793. 2008.<br />
<br />
2. Martin Steiner and Udo Bläs. Charged amino-terminal amino acids affect the lethal capacity of Lambda lysis proteins S107 and S105. Molecular Microbiology. 8(3), 525 - 533. Oct. 2006.<br />
<br />
3. Tram Anh T. Tran, Douglas K. Struck, and Ry Young*. The T4 RI Antiholin Has an N-Terminal Signal Anchor Release Domain That Targets It for Degradation by DegP. Journal of Bacteriology. 7618–7625. Nov. 2007. </small></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/ModelingTeam:UC Berkeley/Modeling2008-10-30T02:41:30Z<p>Dirkvandepol: /* Introduction */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Modeling'''</font></div><br><br />
<br />
=='''Motivation'''==<br />
<br />
Since several phage systems and many promoters are currently in use, understanding the important parameters of the system allows one to choose appropriate promoters and phage proteins to optimize lysis behavior. Therefore we have created a model that is in agreement with our experimental results and published data regarding the T4 and λ phage systems.<br />
<br />
=='''Introduction'''==<br />
<br />
The holin-lysozyme phage lysis device consists of three proteins: <br />
<br />
Holin - inner membrane-bound proteins that when complexed with other holin proteins, create holes in the membrane that allow lysozyme access to the periplasm. <br />
<br />
Antiholin - inner membrane-bound protein that binds to and inactivates holin, producing an inactive holin-antiholin dimer. This dimer becomes active after holin forms enough pores in the plasma membrane to cause a loss of proton motive force between the periplasm and the cytosol.<br />
<br />
Lysozyme - once holin forms pores in the inner membrane, lysozyme enters the periplasm and degrades peptidoglycan, resulting in cell lysis.<br />
<br />
[[Image:holinantiholin1.jpg]]<br />
<br />
=='''Governing Equations'''==<br />
Our holin-lysozyme lysis device consists of holin and lysozyme under an inducible promoter and antiholin under a constitutive promoter. For more information on our lysis device, click here [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]].<br />
<br />
The kinetics of our phage lysis device was modeled to help our team gain an insight into the behavior of our system. The below equations describe our system <br />
<br />
[[Image:cdb1.jpg]]<br />
<br />
Where P<sub>H</sub> represent the holin mRNA promoter strength as a function of arabinose concentration and P<sub>AH</sub> represents the antiholin mRNA promoter strength. γ<sub>mRNA,H</sub> and γ<sub>mRNA,AH</sub> represent the degradation rates for holin and antiholin respectively and γ represents the protein degradation rate. k<sub>H</sub> and k<sub>AH</sub> represent the rate constants for holin and antiholin formation. and k<sub>c</sub> and k<sub>u</sub> represent the coupling and uncoupling rates for the holin-antiholin dimer.<br />
<br />
=='''Transfer Function and Dimensionless Parameters'''== <br />
<br />
At steady state, <br />
<br />
[[Image:cdb2.jpg]] <br />
<br />
By making this assumption, the system of equations can be simplified into the following transfer function<br />
<br />
[[Image:cdb3.jpg]] <br />
<br />
Where the system can be divided into three dimensionless parameters which describe the behavior of the holin-antiholin dimer and the holin and antiholin proteins.<br />
<br />
[[Image:cdb4.jpg]] <br />
<br />
These dimensionless numbers can assist in the optimization of lysis device design because they describe the important parameters in the system.<br />
<br />
For example, Ω<sub>H</sub> consists of the rate constants for the formation of holin mRNA and the holin protein divided by their degradation rates. Strong promoters on holin will increase the value of Ω<sub>H</sub>, while high protein degradation rates will decrease Ω<sub>H</sub>.<br />
<br />
Ω<sub>AH</sub> describes the rate constants and degradation rates for anti-holin.<br />
<br />
Φ describes the importance of the coupling and uncoupling rates of holin-antiholin dimer as well as the degradation rate of the dimer.<br />
<br />
=='''Graphs'''==<br />
<br />
Physiologically relevant values for Ω<sub>H</sub>, Ω<sub>AH</sub> and Φ were estimated based on rate constants for similar proteins. This system was input into MatLab to produce the following graph. Since there is a degree of uncertainty in these estimates, the graph spans several orders of magnitude above and below our estimated values. For the MatLab code used to produce these graphs, please click here [[Matlab code]]. <br />
<br />
[[Image:cdb5.jpg]]<br />
<br />
The literature indicates that at the time of lysis, cells infected with λ phage have approximately 1000 holin proteins<sup>1</sup>. Therefore, the critical concentration of holin (H<sub>c</sub>) was set at 1000 holin proteins per cell. <br />
<br />
The horizontal line at y=1 represents the critical holin concentration needed induce lysis. If the system produces more than the critical concentration of holin (>1000 free holin proteins), lysis is expected to occur.<br />
<br />
As one would expect by looking at the dimensionless value for holin (omega<sub>H</sub>), as the strength of the holin promoter increases, the amount of holin at steady state increases. <br />
<br />
The graph also shows that the system is not very sensitive to small amounts of antiholin. Larger amounts of antiholin push the system equilibrium to the left and would require a stronger promoter on holin or a weaker binding interaction between holin and antiholin to reach critical concentration. This is supported by the observation that in a system with no antiholin, lysis can occur with holin under a weaker promoter.<br />
<br />
Varying Φ, the dimensionless parameter that describes the coupling and uncoupling behavior of the holin-antiholin dimer, reveals that when the binding of holin-antiholin is stronger, a stronger promoter is required to reach the critical holin concentration.<br />
<br />
=='''Conclusions'''==<br />
There are several aspects of the model that agree with our experimental results and published data regarding phage lysis: <br />
<br />
1. Our experimental results show that at higher concentrations of arabinose, lysis occurs more readily. In our model, higher concentrations of arabinose increase the value of P<sub>H</sub> and thus increase the value of omega<sub>H</sub>. Our model predicts that as omega<sub>H</sub> increases, lysis is more likely to occur.<br />
<br />
2. Our experimental results showed that the T4 lysis device results in lysis at a lower concentration of arabinose than our λ lysis device when the systems are under the same promoter. λ antiholin and holin should have similar degradation rates because both are membrane-bound and only differ by two amino acids<sup>2</sup>. In contrast, T4 antiholin is an unstable cytoplasmic protein with a rapid degradation rate (t<sub>1/2</sub> = 2 min)<sup>3</sup>. Therefore γ should be larger in the T4 system, resulting in a larger value for Φ. This will shift the graph up and allow the system to reach the critical holin concentration more readily (see graph with Φ =400). <br />
<br />
3. Our model shows that systems with low values of omega<sub>AH</sub> (weaker antiholin mRNA or protein promoter) will lyse more readily than systems with large values of omega<sub>AH</sub>. This is in agreement with previously published results that show that in cells with little or no antiholin, lysis occurs more readily <sup>2</sup>. <br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/Assembly" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
<small>1. Christos G. Savva, Jill S. Dewey, John Deaton, Rebecca L. White, Douglas K. Struck, Andreas Holzenburg and Ry Young. The holin of bacteriophage lambda forms rings with large diameter. Molecular Microbiology 69(4), 784–793. 2008.<br />
<br />
2. Martin Steiner and Udo Bläs. Charged amino-terminal amino acids affect the lethal capacity of Lambda lysis proteins S107 and S105. Molecular Microbiology. 8(3), 525 - 533. Oct. 2006.<br />
<br />
3. Tram Anh T. Tran, Douglas K. Struck, and Ry Young*. The T4 RI Antiholin Has an N-Terminal Signal Anchor Release Domain That Targets It for Degradation by DegP. Journal of Bacteriology. 7618–7625. Nov. 2007. </small></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T02:03:03Z<p>Dirkvandepol: /* B. To test the viability of enzymes in the lysate */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
1) Ligase strain – The gene for ligase has been cloned into the genome of lefty and righty cells. These strains have successfully been used to optimize the effectiveness of the ligation reaction.<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/ProteinPurificationTeam:UC Berkeley/ProteinPurification2008-10-30T01:13:13Z<p>Dirkvandepol: /* Devices */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Protein Purification'''</font></div><br><br />
<br />
=='''Introduction'''==<br />
Protein purification involves a series of step to isolate the protein of interest. Purifying a protein from E.coli first includes an extraction step, which brings the protein into solution. There are many physical or chemical methods from which to select for extraction. However, many times the protein of interest may be too fragile such that putting the protein through harsh extractions will permanently damage the protein, resulting in low yield. The proposed solution for this is to transform an inducible λ phage lysis device. This allows complete control over lysis rate. In addition, using a natural form of lysis is much gentler on the cells and proteins, which will lead to greater success of protein extraction and purifcation.<br />
<br />
Additional steps can be taken to lower the background that comes from genomic DNA and RNA that flow into solution from extraction. Engineering the ability to make the restriction enzymes BamHI and BgIII and ribonuclease barnase will greatly reduce background.<br />
<br />
To identify the protein in the large soup of protein, the four protein tags AP, HA, myc and flag were made. These tags can be attached at the terminus of the protein strands and their selective interactions between antibodies and themselves will make the tagged proteins easier to isolate.<br />
<br />
=='''Devices'''==<br />
'''Expression Cell'''<br />
<br />
The expression cell, containing the plasmid coding for the protein of interest, features BgIII restriction enzyme and BgIII methyltransferase parts engineered into the genome. BgIII, integrated at the HK022 site, is used to cut up the genome of the helper cell. BgIII methyltransferase, integrated at φ80 site, prevents BgIII from cutting up the cell's own genome. The expression cell also contains an inducible lysis device that lyses the cell upon induction.<br />
<br />
<br />
[[Image:ucbigemppexpression.png|300 px]]<br />
<br />
<br />
'''Helper Cell'''<br />
<br />
The helper cell contains parts the serve to reduce background during protein purification. The cell has BamHI methyltransferse engineered into its genome at the φ80 site. The plasmid in this cell contains BamHI, barnase and barstar. BamHI is used to degrade the genomic DNA from the expression cell. Barnase is used to degrade RNA of the expression cell and other helper cells when lysed. Barstar prevents barnase from destroying the cell's RNA. Like the expression cell, the helper cells contains the same inducible lysis device.<br />
<br />
<br />
[[Image:ucbigempphelper.png|300 px]]<br />
<br />
<br />
'''Protein of Interest'''<br />
<br />
The protein of interest is on a plasmid that is transformed into the expression cell. The protein will have a protein tag.<br />
<br />
<br />
[[Image:ucbproteinofinterestplasmid.png]]<br />
<br />
<br />
'''Tags'''<br />
<br />
Four tags were made: AP, HA, myc and FLAG. AP binds to streptavidin, Ha binds to hemagglutinin, myc binds to c-myc and FLAG binds to anti-DDK antibodies. To test the tags, composite parts of the following construction Pbad.rbs_pelB.phoA.tag.b1006 were made. rbs_pelB is one of the four [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/prepro prepro sequences] that sends a protein to the periplasm. Additional information on how the the tags is in the [https://2008.igem.org/Team:UC_Berkeley/ProteinPurification#Tags_and_Testing experimental section].<br />
<br />
<br />
[[Image:ucbigemtag.png]]<br />
<br />
=='''Strategy'''==<br />
<br />
The protein purification strategy involves growing up cultures of expression cells and helper cells. Combining the two cultures and lysing them will result in a solution of proteins, among which contains the protein of interest and cellular junk minus the RNA (degraded by barnase) and DNA (degraded by one of the two restriction enzymes). At this point, using the tag on the protein, the protein will be taken out of solution by taking advantage of the selective interaction between the tag and the antibody that binds to it.<br />
<br />
<br />
=='''Proof of Concept Experiment'''==<br />
To prove the protein purification concept, a plasmid coding for a protein with a His tag is transformed into E.coli with the arabinose induced self-lysis device. This culture will be induced to lyse with arabinose, releasing the His-tagged protein. The cellular debris is pelleted by centrifuging for 30 seconds. The supernatant will be added to a new tube and Ni-NTA will be added to it. The supernatant and Ni-NTA solution is incubated at 4 degree Celcius for 4 hours. The Ni-NTA protein complex is concentrated using a magnet. The protein is then eluted from Ni-NTA and the solution will be run on a gel to see whether or not protein is purified.<br />
<br />
=='''Tags and Testing'''==<br />
To test the tags, an ELISA was performed. First, the antibodies were diluted to a final concentration of 20 μg/ml in PBS. 50 ul of this antibody solution is added to a NUNC maxisorp plate and incubated for an hour at 37 degree C. After an hour, the plate was washed with [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Wash_Solution.281L.29 wash solution] using a plate washer. 200ul of [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Blocking_Solution.28500_mL.29 blocking solution] was added to the plate and incubated for an hour at 37 degree C. Meanwhile, because the phoA.tag complex is sent to the periplasm with the pelB sequence, a [https://2008.igem.org/Team:UC_Berkeley/Protocols#Periplasmic_Prep periplasmic prep] was performed to get a solution of the phoA.tag complex and was subsequently diluted down to the working concentration with PBS. After an hour of blocking, the plate was again washed with wash buffer using the plate washer. The 200ul of phoA.tag dilution was added to the plate and was incubated at 37 degree C for an hour. The plate was washed afterward and 100ul of PNP was then added to the wells, observing for a yellow color.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_anthropological_narrative" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/ProteinPurificationTeam:UC Berkeley/ProteinPurification2008-10-30T01:06:47Z<p>Dirkvandepol: /* Introduction */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Protein Purification'''</font></div><br><br />
<br />
=='''Introduction'''==<br />
Protein purification involves a series of step to isolate the protein of interest. Purifying a protein from E.coli first includes an extraction step, which brings the protein into solution. There are many physical or chemical methods from which to select for extraction. However, many times the protein of interest may be too fragile such that putting the protein through harsh extractions will permanently damage the protein, resulting in low yield. The proposed solution for this is to transform an inducible λ phage lysis device. This allows complete control over lysis rate. In addition, using a natural form of lysis is much gentler on the cells and proteins, which will lead to greater success of protein extraction and purifcation.<br />
<br />
Additional steps can be taken to lower the background that comes from genomic DNA and RNA that flow into solution from extraction. Engineering the ability to make the restriction enzymes BamHI and BgIII and ribonuclease barnase will greatly reduce background.<br />
<br />
To identify the protein in the large soup of protein, the four protein tags AP, HA, myc and flag were made. These tags can be attached at the terminus of the protein strands and their selective interactions between antibodies and themselves will make the tagged proteins easier to isolate.<br />
<br />
=='''Devices'''==<br />
'''Expression Cell'''<br />
<br />
The expression cell, containing the plasmid coding for the protein of interest, features BgIII restriction enzyme and BgIII methyltransferase parts engineered into the genome. BgIII, integrated at the HK022 site, is used to cut up the genome of the helper cell. BgIII methyltransferase, integrated at φ80 site, prevents BgIII from cutting up the cell's own genome. The expression cell also contains an inducible lysis device that lyses the cell upon induction.<br />
<br />
<br />
[[Image:ucbigemppexpression.png|300 px]]<br />
<br />
<br />
'''Helper Cell'''<br />
<br />
The helper cell contains parts the serve to reduce background during protein purification. The cell has BamHI methyltransferse engineered into its genome at the φ80 site. The plasmid in this cell contains BamHI, barnase and barstar. BamHI is used to degrade the genomic DNA from the expression cell. Barnase is used to degrade RNA of the expression cell and other helper cells when lysed. Barstar prevents barnase from destroy the cell's RNA. Like the expression cell, the helper cells contains the same inducible lysis device.<br />
<br />
<br />
[[Image:ucbigempphelper.png|300 px]]<br />
<br />
<br />
'''Protein of Interest'''<br />
<br />
The protein of interest is on a plasmid that is transformed into the expression cell. The protein will have a protein tag.<br />
<br />
<br />
[[Image:ucbproteinofinterestplasmid.png]]<br />
<br />
<br />
'''Tags'''<br />
<br />
Four tags were made: AP, HA, myc and FLAG. AP binds to streptavidin, Ha binds to hemagglutinin, myc binds to c-myc and FLAG binds to anti-DDK antibodies. To test the tags, composite parts of the following construction Pbad.rbs_pelB.phoA.tag.b1006 were made. rbs_pelB is one of the four [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/prepro prepro sequences] that sends a protein to the periplasm. Additional information on how the the tags is in the [https://2008.igem.org/Team:UC_Berkeley/ProteinPurification#Tags_and_Testing experimental section].<br />
<br />
<br />
[[Image:ucbigemtag.png]]<br />
<br />
=='''Strategy'''==<br />
<br />
The protein purification strategy involves growing up cultures of expression cells and helper cells. Combining the two cultures and lysing them will result in a solution of proteins, among which contains the protein of interest and cellular junk minus the RNA (degraded by barnase) and DNA (degraded by one of the two restriction enzymes). At this point, using the tag on the protein, the protein will be taken out of solution by taking advantage of the selective interaction between the tag and the antibody that binds to it.<br />
<br />
<br />
=='''Proof of Concept Experiment'''==<br />
To prove the protein purification concept, a plasmid coding for a protein with a His tag is transformed into E.coli with the arabinose induced self-lysis device. This culture will be induced to lyse with arabinose, releasing the His-tagged protein. The cellular debris is pelleted by centrifuging for 30 seconds. The supernatant will be added to a new tube and Ni-NTA will be added to it. The supernatant and Ni-NTA solution is incubated at 4 degree Celcius for 4 hours. The Ni-NTA protein complex is concentrated using a magnet. The protein is then eluted from Ni-NTA and the solution will be run on a gel to see whether or not protein is purified.<br />
<br />
=='''Tags and Testing'''==<br />
To test the tags, an ELISA was performed. First, the antibodies were diluted to a final concentration of 20 μg/ml in PBS. 50 ul of this antibody solution is added to a NUNC maxisorp plate and incubated for an hour at 37 degree C. After an hour, the plate was washed with [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Wash_Solution.281L.29 wash solution] using a plate washer. 200ul of [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Blocking_Solution.28500_mL.29 blocking solution] was added to the plate and incubated for an hour at 37 degree C. Meanwhile, because the phoA.tag complex is sent to the periplasm with the pelB sequence, a [https://2008.igem.org/Team:UC_Berkeley/Protocols#Periplasmic_Prep periplasmic prep] was performed to get a solution of the phoA.tag complex and was subsequently diluted down to the working concentration with PBS. After an hour of blocking, the plate was again washed with wash buffer using the plate washer. The 200ul of phoA.tag dilution was added to the plate and was incubated at 37 degree C for an hour. The plate was washed afterward and 100ul of PNP was then added to the wells, observing for a yellow color.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_anthropological_narrative" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/ProteinPurificationTeam:UC Berkeley/ProteinPurification2008-10-30T01:06:06Z<p>Dirkvandepol: /* Introduction */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Protein Purification'''</font></div><br><br />
<br />
=='''Introduction'''==<br />
Protein purification involves a series of step to isolate the protein of interest. Purifying a protein from E.coli first includes an extraction step, which brings the protein into solution. There are many physical or chemical methods from which to select for extraction. However, many times the potein of interest may be too fragile such that putting the protein through harsh extractions will permanently damage the protein, resulting in low yield. The proposed solution for this is to transform an inducible λ phage lysis device. This allows complete control over lysis rate. In addition, using a natural form of lysis is much gentler on the cells and proteins, which will lead to greater success of protein extraction and purifcation.<br />
<br />
Additional steps can be taken to lower the background that comes from genomic DNA and RNA that flow into solution from extraction. Engineering the ability to make the restriction enzymes BamHI and BgIII and ribonuclease barnase will greatly reduce background.<br />
<br />
To identify the protein in the large soup of protein, the four protein tags AP, HA, myc and flag were made. These tags can be attached at the terminus of the protein strands and their selective interactions between antibodies and themselves will make the tagged proteins easier to isolate.<br />
<br />
=='''Devices'''==<br />
'''Expression Cell'''<br />
<br />
The expression cell, containing the plasmid coding for the protein of interest, features BgIII restriction enzyme and BgIII methyltransferase parts engineered into the genome. BgIII, integrated at the HK022 site, is used to cut up the genome of the helper cell. BgIII methyltransferase, integrated at φ80 site, prevents BgIII from cutting up the cell's own genome. The expression cell also contains an inducible lysis device that lyses the cell upon induction.<br />
<br />
<br />
[[Image:ucbigemppexpression.png|300 px]]<br />
<br />
<br />
'''Helper Cell'''<br />
<br />
The helper cell contains parts the serve to reduce background during protein purification. The cell has BamHI methyltransferse engineered into its genome at the φ80 site. The plasmid in this cell contains BamHI, barnase and barstar. BamHI is used to degrade the genomic DNA from the expression cell. Barnase is used to degrade RNA of the expression cell and other helper cells when lysed. Barstar prevents barnase from destroy the cell's RNA. Like the expression cell, the helper cells contains the same inducible lysis device.<br />
<br />
<br />
[[Image:ucbigempphelper.png|300 px]]<br />
<br />
<br />
'''Protein of Interest'''<br />
<br />
The protein of interest is on a plasmid that is transformed into the expression cell. The protein will have a protein tag.<br />
<br />
<br />
[[Image:ucbproteinofinterestplasmid.png]]<br />
<br />
<br />
'''Tags'''<br />
<br />
Four tags were made: AP, HA, myc and FLAG. AP binds to streptavidin, Ha binds to hemagglutinin, myc binds to c-myc and FLAG binds to anti-DDK antibodies. To test the tags, composite parts of the following construction Pbad.rbs_pelB.phoA.tag.b1006 were made. rbs_pelB is one of the four [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/prepro prepro sequences] that sends a protein to the periplasm. Additional information on how the the tags is in the [https://2008.igem.org/Team:UC_Berkeley/ProteinPurification#Tags_and_Testing experimental section].<br />
<br />
<br />
[[Image:ucbigemtag.png]]<br />
<br />
=='''Strategy'''==<br />
<br />
The protein purification strategy involves growing up cultures of expression cells and helper cells. Combining the two cultures and lysing them will result in a solution of proteins, among which contains the protein of interest and cellular junk minus the RNA (degraded by barnase) and DNA (degraded by one of the two restriction enzymes). At this point, using the tag on the protein, the protein will be taken out of solution by taking advantage of the selective interaction between the tag and the antibody that binds to it.<br />
<br />
<br />
=='''Proof of Concept Experiment'''==<br />
To prove the protein purification concept, a plasmid coding for a protein with a His tag is transformed into E.coli with the arabinose induced self-lysis device. This culture will be induced to lyse with arabinose, releasing the His-tagged protein. The cellular debris is pelleted by centrifuging for 30 seconds. The supernatant will be added to a new tube and Ni-NTA will be added to it. The supernatant and Ni-NTA solution is incubated at 4 degree Celcius for 4 hours. The Ni-NTA protein complex is concentrated using a magnet. The protein is then eluted from Ni-NTA and the solution will be run on a gel to see whether or not protein is purified.<br />
<br />
=='''Tags and Testing'''==<br />
To test the tags, an ELISA was performed. First, the antibodies were diluted to a final concentration of 20 μg/ml in PBS. 50 ul of this antibody solution is added to a NUNC maxisorp plate and incubated for an hour at 37 degree C. After an hour, the plate was washed with [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Wash_Solution.281L.29 wash solution] using a plate washer. 200ul of [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Blocking_Solution.28500_mL.29 blocking solution] was added to the plate and incubated for an hour at 37 degree C. Meanwhile, because the phoA.tag complex is sent to the periplasm with the pelB sequence, a [https://2008.igem.org/Team:UC_Berkeley/Protocols#Periplasmic_Prep periplasmic prep] was performed to get a solution of the phoA.tag complex and was subsequently diluted down to the working concentration with PBS. After an hour of blocking, the plate was again washed with wash buffer using the plate washer. The 200ul of phoA.tag dilution was added to the plate and was incubated at 37 degree C for an hour. The plate was washed afterward and 100ul of PNP was then added to the wells, observing for a yellow color.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_anthropological_narrative" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayGenomicTeam:UC Berkeley/GatewayGenomic2008-10-30T00:47:15Z<p>Dirkvandepol: /* Introduction */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Genomic Based Gateway'''</font></div><br><br />
<br />
==Introduction==<br />
The ''in vivo'' plasmid based gateway scheme was successful and produced the desired product, but it also yielded a considerable amount of background. Closer analysis of the side products revealed that the background resulted from ''ccdB'' mutations that arose when the gene replicated and recombined ''in vivo''. In an effort to circumvent background resulting from mutations in a negative selection gene, we decided to use positive selection. This way, we would be able to select for the desired products rather than selecting against unwanted side products and unreacted starting materials.<br />
<br />
In order to implement positive selection, we used inducible origins of replication on our plasmids. These origins of replication will only be functional and allow plasmid replication if a specific protein is expressed in the cell. In our design, the assembly vector with an ''oriR6K'' origin (induced by the protein Pir) is integrated into the genome. The gene of interest alongside an ''oriV'' origin (induced by the protein TrfA) can then recombine with the genome. In this manner, the gene of interest can be moved to an assembly vector by inserting the entry vector into the genome. We could allow selective replication of the plasmids in our scheme by performing the reaction in a cell expressing TrfA and then transforming the resulting mixture of plasmids into a cell expressing Pir.<br />
<br />
We also incorporated our lysis device into our new entry vector in order to simplify the experimental protocol for this scheme by eliminating mini-preps.<br />
<br />
==Details about Plasmids and Strains==<br />
<br />
===Plasmids===<br />
The entry plasmid in this scheme contains both the part of interest and an ''oriV'' origin of replication within the attL recombination sites, thereby allowing this origin to be transferred to the desired product. Since the entry plasmid has no constitutive origin of replication, it can only replicate in the presence of the protein TrfA. With the exception of the change in type and placement of the origin of replication, the entry plasmid maintains the same features as the traditional entry plasmid, pBca1256.<br />
<br />
[[Image:OriV entry vector.jpg]]<br />
<br />
In variations on this scheme where Xis and Int are not integrated into the genome, they are placed prior to the'' attL1'' site under the control of a temperature sensitive promoter. In an effort to stgreamline this method, we also considered a variation where the lysis device was placed before Xis and Int in the entry plasmid.<br />
<br />
===Strains===<br />
This scheme utilizes strains that include the assembly vector in the genome. The traditional double-antibiotic assembly vector has been modified to include an ''oriR6K'' origin of replication (which can be induced by the Pir protein) in place of a constitutively active replication origin. Since the integrated vector includes the ''attR2'' sites that usually flank the vector region of the assembly plasmid, the ''attL1'' sites in the entry plasmid can recombine with the genome to produce the desired product.<br />
<br />
In addition to the integrated assembly vector, the strains also include TrfA in the genome to allow the replication of the entry vector containing an ''oriV'' origin. Additionally, one variation on this scheme has ''xis'' and ''int'' placed in the the genome to catalyze the recombination reaction.<br />
<br />
[[Image:Genomic Gateway Overview.jpg]]<br />
<br />
==General Procedure==<br />
In this scheme, the ''oriV'' version of the entry plasmid can simply be transformed into the integrated strain containing the desired assembly vector and TrfA. In order to catalyze the reaction, Xis and Int must be present either on the plasmid or in the genome. <br />
<br />
Once the entry plasmid has been transformed and the reaction has been catalyzed, the desired product will be able to replicate in the cytoplasm of the cell using the ''oriV'' origin that was transferred with the part from the entry vector to the assembly vector. The product can be released from the cell by inducing our self-lysis device (which can be installed in the entry vector) or by doing a mini-prep.<br />
<br />
Once the plasmids in the cell's cytoplasm have been obtained, they need to be transformed into cells that express the Pir protein. This will allow for the selective replication of the desired product, which contains an ''oriR6K'' origin obtained from the assembly vector that was originally in the genome. <br />
<br />
The potential source of background in this scheme is the unreacted entry plasmid. However, this plasmid does not have an ''oriR6K'' origin (it only contains an ''oriV'' origin), so it is unable to replicate in cells that express Pir instead of TrfA. Differential antibiotic markers would assist in screening against the bleed-through of the starting plasmid, but only positive selection can eliminate the need to screen for contransformants (which contain both the starting plasmid in addition to the desired product).<br />
<br />
==Conclusion==<br />
With the incorporation of the lysis device, the genomic Gateway scheme promises to be an improvement to the plasmid based Gateway scheme because it eliminates unwanted background by using positive selection. However, the protocol for this scheme still requires that the plasmid mixture is transformed into another cell strain to select for the desired product. We sought to further streamline this scheme by utilizing phagemids, which can lyse the cell and infect other cells without the need for either mini-preps or transformation.<br />
<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPhagemid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:03:03Z<p>Dirkvandepol: /* Selection for Correct Clones */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:00:54Z<p>Dirkvandepol: /* Selection for Correct Clones */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T23:51:25Z<p>Dirkvandepol: /* Assembly Layer */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:41:21Z<p>Dirkvandepol: /* The Natural Lambda Phage Recombination system */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene CcdB is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T23:39:11Z<p>Dirkvandepol: /* Clonebots Solutions */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to either methylate BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:36:19Z<p>Dirkvandepol: /* Invitrogen's adaptation */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ‘’E. coli’’ host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (ihf) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned “att” sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene CcdB is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:33:43Z<p>Dirkvandepol: /* The Natural Lambda Phage Recombination system */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ‘’E. coli’’ host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (ihf) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned “att” sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:33:19Z<p>Dirkvandepol: /* The Natural Lambda Phage Recombination system */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ‘’E. coli’’ host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (ihf) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned “att” sites of the viral and host genomes. <br />
[Br]<br />
Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:33:01Z<p>Dirkvandepol: /* The Natural Lambda Phage Recombination system */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ‘’E. coli’’ host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (ihf) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned “att” sites of the viral and host genomes. <br />
[br]Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:32:38Z<p>Dirkvandepol: /* The Natural Lambda Phage Recombination system */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ‘’E. coli’’ host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (ihf) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned “att” sites of the viral and host genomes. <br />
<br />
<br />
Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T23:14:45Z<p>Dirkvandepol: /* The Natural Lambda Phage Recombination system */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ‘’E. coli’’ host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (ihf) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned “att” sites of the viral and host genomes. <br />
Here is how it works: Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-29T22:28:26Z<p>Dirkvandepol: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html| Gateway Cloning] approach developed by Invitrogen offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gateway.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes. Int cooperatively binds with ihf (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, ihf greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ccdB is a lethal gene, thereby eliminating colonies containing that contain the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a [[Team:UC_Berkeley/GatewayPlasmid|plasmid based Gateway reaction]], which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a [[Team:UC_Berkeley/LysisDevice|self-lysis device]] which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the [[Team:UC_Berkeley/GatewayGenomic|Genomic Based Gateway]] scheme.<br />
<br />
===Genomic Based Gateway===<br />
The [[Team:UC_Berkeley/GatewayGenomic|Genomic Based Gateway]] scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a [[Team:UC_Berkeley/GatewayPhagemid|Phagemid Based Gateway]] scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The [[Team:UC_Berkeley/GatewayPhagemid|Phagemid Based Gateway]] utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html><br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T22:19:40Z<p>Dirkvandepol: /* Assembly Layer */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We have accomplished this by genetically encoding many of the required steps into the ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of procedure: Entry, Assembly and Destination. Both Entry and Assembly layers are standardized for ease of use, while the Destination plasmid can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. <br />
<br />
[[Image: entry plasmid]]<br />
<br />
Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the [[Team:UC_Berkeley/GatewayOverview|Gateway cloning]] scheme.<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampilicin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The assembly plasmids are transformed into cells that are engineered to either methylate BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single eppendorf tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the Xho sites in both plasmids will be cut. Ligase will join the Xho sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the [[Team:UC_Berkeley/GatewayOverview|Gateway cloning]] scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
[[Image:destplas]]<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols work well for BBa parts, but not as well for BBb. Clonebots used BBb because BBa cloning requires several complex procedures while BBb has the potential to be fully automated. By using methylated plasmids, BBb assembly can be compartmentalized to a single tube or cell.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Current protocols with no gel purification step are inefficient. Protocols involving gel purification and background subtraction steps to screen for the correct parts after assembly cannot be fully automated.<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes to perform [[Team:UC_Berkeley/GatewayOverview|''in vivo'' Gateway reactions]].<br />
# Eliminate mini-prep steps from cloning protocols by using our [[Team:UC_Berkeley/LysisDevice|lysis device]] and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre restriction enzymes and ligase so that [[Team:UC_Berkeley/Assembly|assembly reactions]] in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
[[Image:GreyNext.png|200px|right]]<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/LysisDevice" class="titleIcon"><br />
<img height="130" witdh="240" src="https://static.igem.org/mediawiki/2008/4/4d/GreyNext.png"><br />
</a><br />
</html></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T22:15:56Z<p>Dirkvandepol: /* Project Motivation */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We have accomplished this by genetically encoding many of the required steps into the ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of procedure: Entry, Assembly and Destination. Both Entry and Assembly layers are standardized for ease of use, while the Destination plasmid can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. <br />
<br />
[[Image: entry plasmid]]<br />
<br />
Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the [[Team:UC_Berkeley/GatewayOverview|Gateway cloning]] scheme.<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampilicin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The assembly plasmids are transformed into cells that are engineered to either methylate BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single eppendorf tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the Xho sites in both plasmids will be cut. Ligase will join the xho sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the [[Team:UC_Berkeley/GatewayOverview|Gateway cloning]] scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
[[Image:destplas]]<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols work well for BBa parts, but not as well for BBb. Clonebots used BBb because BBa cloning requires several complex procedures while BBb has the potential to be fully automated. By using methylated plasmids, BBb assembly can be compartmentalized to a single tube or cell.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Current protocols with no gel purification step are inefficient. Protocols involving gel purification and background subtraction steps to screen for the correct parts after assembly cannot be fully automated.<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (ihf) enzymes to perform [[Team:UC_Berkeley/GatewayOverview|''in vivo'' Gateway reactions]].<br />
# Eliminate mini-prep steps from cloning protocols by using our [[Team:UC_Berkeley/LysisDevice|lysis device]] and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre restriction enzymes and ligase so that [[Team:UC_Berkeley/Assembly|assembly reactions]] in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
[[Image:GreyNext.png|200px|right]]</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LysisDeviceTeam:UC Berkeley/LysisDevice2008-10-29T22:10:16Z<p>Dirkvandepol: /* Device */</p>
<hr />
<div>{{UCBmain}} __NOTOC__<br />
<div style="text-align: center;"><font size="6">'''Lysis Device'''</font></div><br><br />
<br />
=='''Introduction'''==<br />
The lysis device allows for the easy release of any product produced by a Clonebot device. By using an internal lysis system that can be activated by a variety of external conditions, we hope to allow for the complete automation of product purification.<br />
<br />
=='''Device'''==<br />
Our lysis devices are based on phage lysis systems. In both the lambda and T4 phage systems that we used, a holin protein causes "pores" in the inner membrane of ''E. coli'', which allows lysozyme to access and break down the peptidoglycan in the periplasm, causing lysis. An antiholin molecule inhibits the activity of holin, and is used in the natural systems to control the timing of lysis. <br />
<br />
[[Image:Holinantiholin1.jpg|center|]]<br />
<br />
In our device, the production of lysozyme and holin is activated by an inducible promoter, while antiholin is constituitively produced. Our lysis device is tunable using these two promoters - we have produced several variations, in particular, devices using pBad for arabinose-induced lysis, and a device using a promoter that turns on in response to an absence of magnesium.<br />
<br />
<html><br />
<div align="center"> <img src="https://static.igem.org/mediawiki/2008/6/6e/LysisSystem.jpeg"> </div><br />
</html><br />
<br />
=='''Characterization and Data'''==<br />
We chose to characterize two of our lysis devices - K112019, a device using lambda phage holin and lysozyme, and K112803, a device using T4 phage holin and lysozyme. After confirming that the devices did indeed work, we took the miniprepped plasmid, transformed into the MC1061 strain, and then picked 5 colonies for each device. We grew these cultures to saturation at 37 degrees Celsius in LB media, and then split into eight 1 mL aliquots. A range of concentrations of arabinose was added to these aliquots, with a starting concentration of 1.3E-3 M and the next 6 samples recieving a four-fold dilution of the previous sample, and an equal volume of water added to the last aliquot. The cultures were then incubated at 37 degrees again for 3.5 hours, and the absorbance was measured with a Tecan Xfluor4 Safire2 in a Corning Inc. Costar 3603 plate. The data plotted on a log scale is shown below.<br />
<br />
[[Image:UCB_saturationLysis.jpg|thumbnail|450px|center|Data from adding arabinose at saturation. Concentrations used at each data point from left to right are 0, 2.44E-07, 9.77E-07, 3.91E-06, 1.56E-05, 6.25E-05, 2.50E-04, and 1.00E-03 M]]<br />
<br />
A parallel experiment was performed by taking the same saturated culture before induction with arabinose, diluting 100-fold, growing to mid-log(starting OD .22), before inducing with arabinose as above. The data plotted on a log scale is shown below.<br />
<br />
[[Image:UCB_midlogLysis.jpg|thumbnail|450px|center|Data from adding arabinose at midlog. Concentrations used at each data point from left to right are 0, 2.44E-07, 9.77E-07, 3.91E-06, 1.56E-05, 6.25E-05, 2.50E-04, and 1.00E-03 M]]</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T01:49:23Z<p>Dirkvandepol: /* Layered Assembly */</p>
<hr />
<div>{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA extraction and purification could be accomplished in a single eppendorf tube. We did, and so we created CloneBots, an automated approach to synthetic biology. <br />
<br />
CloneBots seeks to simplify and automate the cloning process by creating protocols that involve only liquid handling steps that could more readily be performed by robots. We have accomplished this by genetically encoding many of the required steps into the ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to optimize synthetic biology protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of procedure: Entry, Assembly and Destination. Both Entry and Assembly layers are standardized for ease of use, while the Destination plasmid can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and EcoRI, BglII and BamHI restriction sites. The restriction sites are flanked by attR1 and attR2 recombination sites. <br />
<br />
[[Image: entry plasmdi]]<br />
<br />
Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme described here [[https://2008.igem.org/Team:UC_Berkeley/GatewayOverview]]. <br />
<br />
==='''Assembly Layer'''===<br />
<br />
The assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampilicin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The Clotho program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part. To download Clotho, click here [[https://2008.igem.org/Team:UC_Berkeley_Tools/Project/Downloads]]<br />
<br />
[[Image:Clothoscreenshot.jpg]] <br />
<br />
The assembly plasmids are transformed into cells that are engineered to either methylate BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single eppendorf tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the Xho sites in both plasmids will be cut. Ligase will join the xho sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid. <br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme [[https://2008.igem.org/Team:UC_Berkeley/GatewayOverview]]. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
[[Image:destplas]]<br />
<br />
=='''Issues with Current Methods'''==<br />
<br />
1) Current protocols work well for BBa parts, but not as well for BBb. CloneBots used BBb because BBa cloning requires several complex procedures while BBb has the potential to be fully automated. By using methylated plasmids, BBb assembly can be compartmentalized to a single tube or cell.<br />
<br />
2) Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
<br />
3) Current protocols with no gel purification step are inefficient.<br />
<br />
Protocols involving gel purification and background subtraction steps to screen for the correct parts after assembly cannot be fully automated.<br />
<br />
4) Mini-preps are time-consuming and expensive. <br />
<br />
5) People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots. <br />
<br />
=='''CloneBots Solutions'''==<br />
<br />
1) Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to reduce the cost of Gateway reactions. For more information on in-vivo gateway, click here [[https://2008.igem.org/Team:UC_Berkeley/GatewayGenomic]].<br />
<br />
2) Eliminate mini-prep steps from cloning protocols by using our lysis device and in-vivo assembly. For more information on our lysis device, click here [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]].<br />
<br />
3) Engineer cells and plasmids to express their own BamHI, BglII, Cre restriction enzymes and ligase so that assembly reactions in cell lysate and in-vivo are possible. For more information on assembly reactions in lysate or in-vivo, click here [[https://2008.igem.org/Team:UC_Berkeley/Assembly]].<br />
<br />
4) By developing protocols that involve only liquid handling steps, cloning can be automated, requiring less money and labor.</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T01:45:40Z<p>Dirkvandepol: /* Project Motivation */</p>
<hr />
<div>{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA extraction and purification could be accomplished in a single eppendorf tube. We did, and so we created CloneBots, an automated approach to synthetic biology. <br />
<br />
CloneBots seeks to simplify and automate the cloning process by creating protocols that involve only liquid handling steps that could more readily be performed by robots. We have accomplished this by genetically encoding many of the required steps into the ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to optimize synthetic biology protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. There are three layers (Entry, Assembly and Destination). Both Entry and Assembly layers are standardized for ease of use, while the Destination plasmid can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and EcoRI, BglII and BamHI restriction sites. The restriction sites are flanked by attR1 and attR2 recombination sites. <br />
<br />
[[Image: entry plasmdi]]<br />
<br />
Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme described here [[https://2008.igem.org/Team:UC_Berkeley/GatewayOverview]]. <br />
<br />
==='''Assembly Layer'''===<br />
<br />
The assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampilicin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The Clotho program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part. To download Clotho, click here [[https://2008.igem.org/Team:UC_Berkeley_Tools/Project/Downloads]]<br />
<br />
[[Image:Clothoscreenshot.jpg]] <br />
<br />
The assembly plasmids are transformed into cells that are engineered to either methylate BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single eppendorf tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the Xho sites in both plasmids will be cut. Ligase will join the xho sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid. <br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme [[https://2008.igem.org/Team:UC_Berkeley/GatewayOverview]]. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
[[Image:destplas]]<br />
<br />
=='''Issues with Current Methods'''==<br />
<br />
1) Current protocols work well for BBa parts, but not as well for BBb. CloneBots used BBb because BBa cloning requires several complex procedures while BBb has the potential to be fully automated. By using methylated plasmids, BBb assembly can be compartmentalized to a single tube or cell.<br />
<br />
2) Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
<br />
3) Current protocols with no gel purification step are inefficient.<br />
<br />
Protocols involving gel purification and background subtraction steps to screen for the correct parts after assembly cannot be fully automated.<br />
<br />
4) Mini-preps are time-consuming and expensive. <br />
<br />
5) People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots. <br />
<br />
=='''CloneBots Solutions'''==<br />
<br />
1) Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to reduce the cost of Gateway reactions. For more information on in-vivo gateway, click here [[https://2008.igem.org/Team:UC_Berkeley/GatewayGenomic]].<br />
<br />
2) Eliminate mini-prep steps from cloning protocols by using our lysis device and in-vivo assembly. For more information on our lysis device, click here [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]].<br />
<br />
3) Engineer cells and plasmids to express their own BamHI, BglII, Cre restriction enzymes and ligase so that assembly reactions in cell lysate and in-vivo are possible. For more information on assembly reactions in lysate or in-vivo, click here [[https://2008.igem.org/Team:UC_Berkeley/Assembly]].<br />
<br />
4) By developing protocols that involve only liquid handling steps, cloning can be automated, requiring less money and labor.</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-29T01:44:59Z<p>Dirkvandepol: /* Project Motivation */</p>
<hr />
<div>{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA extraction and purification could be accomplished in a single eppendorf tube. We did, and so we created CloneBots, an automated approach to synthetic biology. <br />
<br />
CloneBots seeks to simplify and automate the cloning process by creating protocols that involve only liquid handling steps that could more readily be performed by robots. We have accomplished this by genetically encoding many of the required steps into the ''E. coli'', thereby allowing the cells to perform the required protocols in-vivo.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to optimize synthetic biology protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. There are three layers (Entry, Assembly and Destination). Both Entry and Assembly layers are standardized for ease of use, while the Destination plasmid can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and EcoRI, BglII and BamHI restriction sites. The restriction sites are flanked by attR1 and attR2 recombination sites. <br />
<br />
[[Image: entry plasmdi]]<br />
<br />
Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme described here [[https://2008.igem.org/Team:UC_Berkeley/GatewayOverview]]. <br />
<br />
==='''Assembly Layer'''===<br />
<br />
The assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampilicin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The Clotho program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part. To download Clotho, click here [[https://2008.igem.org/Team:UC_Berkeley_Tools/Project/Downloads]]<br />
<br />
[[Image:Clothoscreenshot.jpg]] <br />
<br />
The assembly plasmids are transformed into cells that are engineered to either methylate BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single eppendorf tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the Xho sites in both plasmids will be cut. Ligase will join the xho sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid. <br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme [[https://2008.igem.org/Team:UC_Berkeley/GatewayOverview]]. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transfered to several different destination plasmids for further experimentation or characterization.<br />
<br />
[[Image:destplas]]<br />
<br />
=='''Issues with Current Methods'''==<br />
<br />
1) Current protocols work well for BBa parts, but not as well for BBb. CloneBots used BBb because BBa cloning requires several complex procedures while BBb has the potential to be fully automated. By using methylated plasmids, BBb assembly can be compartmentalized to a single tube or cell.<br />
<br />
2) Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
<br />
3) Current protocols with no gel purification step are inefficient.<br />
<br />
Protocols involving gel purification and background subtraction steps to screen for the correct parts after assembly cannot be fully automated.<br />
<br />
4) Mini-preps are time-consuming and expensive. <br />
<br />
5) People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots. <br />
<br />
=='''CloneBots Solutions'''==<br />
<br />
1) Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to reduce the cost of Gateway reactions. For more information on in-vivo gateway, click here [[https://2008.igem.org/Team:UC_Berkeley/GatewayGenomic]].<br />
<br />
2) Eliminate mini-prep steps from cloning protocols by using our lysis device and in-vivo assembly. For more information on our lysis device, click here [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]].<br />
<br />
3) Engineer cells and plasmids to express their own BamHI, BglII, Cre restriction enzymes and ligase so that assembly reactions in cell lysate and in-vivo are possible. For more information on assembly reactions in lysate or in-vivo, click here [[https://2008.igem.org/Team:UC_Berkeley/Assembly]].<br />
<br />
4) By developing protocols that involve only liquid handling steps, cloning can be automated, requiring less money and labor.</div>Dirkvandepolhttp://2008.igem.org/Template:Team:UC_Berkeley/Notebook/DV_BBaNotesTemplate:Team:UC Berkeley/Notebook/DV BBaNotes2008-08-01T23:08:41Z<p>Dirkvandepol: New page: ==~~~~== To do today 1. purify protein 2. put Bjh1400 series plasmids into entry vectors</p>
<hr />
<div>==[[User:Dirkvandepol|Dirkvandepol]] 23:08, 1 August 2008 (UTC)==<br />
To do today<br />
1. purify protein<br />
2. put Bjh1400 series plasmids into entry vectors</div>Dirkvandepolhttp://2008.igem.org/Template:Team:UC_Berkeley/Notebook/DV_notesTemplate:Team:UC Berkeley/Notebook/DV notes2008-08-01T23:07:10Z<p>Dirkvandepol: </p>
<hr />
<div>BBA stuff:<br />
==[[https://2008.igem.org/wiki/index.php?title=Template:Team:UC_Berkeley/Notebook/DV_BBaNotes]]==<br />
==[[User:Dirkvandepol|Dirkvandepol]] 17:08, 12 June 2008 (UTC)== <br />
Today I will explain what I have been doing for two weeks. It will not be impressive. Yesterday I completed ---I was about to say I finished fixing my mistakes, but truthfully what I did was properly document the fixes Jin made to my mistakes. I completed that work and sent it to Jin at 11:56 PM. Then I rode my bicycle to my car, loaded my bike onto my car, and drove home.<br />
<br />
==[[User:Dirkvandepol|Dirkvandepol]] 21:19, 17 June 2008 (UTC)==<br />
Yesterday- I helped our two new high school students, Sherine Cheung and Cici Chen, get used to what would be done in the lab. We watched videos of Dr. Anderson's lectures from the previous week to the rest of the students in the lab. Then we ran out my PCR products from the previous Thursday on one of those e-Gels. Most of them worked, suggesting that the primers were good. However, I may have made a couple of mistakes in the primer setups that I made-- I may have PCR'ed up the sequence I was to mix, and I may have failed to PCR up my <b1006> sample. I will do that with the next time I run PCR, which will be quite soon, because I forgot to run a PCR using a pair of Aron's Oligos that were emailed to me.<br />
After doing a gel purification using the gel, my minions Sherine and Cici set up a restriction digest. When that was done, I purified the digests using a Zymo-column off the shelf purification system.<br />
<br />
Today- So far, we have run a set of PCR's and run a mix using oligos dv009 and dv010. The PCR's were the three that were included to make the <Phns> promoter. Since the dv003 oligo used the first time still contained a restriction site, we used the replacement dv003 to remove that site. I chose to re-do all three of the PCR's involved because I had a labelling mixup that I wanted to clarify- while doing the zymo column purifications yesterday, I got a little mixed up with labelling- I thought I had labeled something that I actually had not, so I got confused about <Phns> fragments 2 and 3. I had originally planned to ligate 1 and 2 together, but my solution to my mixup was to instead to ligate 2 and 3 together, but, since 3 had to be replaced, I would therefore have to re-do the other, because I wasn't sure which vial was 2 and which was 3. So I just had my minions re-do all of them.<br />
Also, we bound oligos dv009 and dv010 (forward and reverse of the His-tag> part) together by mixing- we used a special protocol on the PCR machine which we entitled "Mix":<br />
Heat to 94C for 2 min.<br />
Cool to 37C forever, using a ramp-down rate of -1C per second<br />
When this was done, we did an Eco/Bam restriction digest of our mix.<br />
<br />
For the rest of the day: <br />
-Zymo cleanup of the His-tag> product digestion<br />
-Ligation of yesterday's cleanup products<br />
-PCR up the Aron Lau oligos using pBca1037 template<br />
-PCR up dv021 and dv022 <br />
-Transform ligations<br />
-maybe some other stuff, stand by...<br />
<br />
==[[User:Dirkvandepol|Dirkvandepol]] 02:20, 18 June 2008 (UTC)==<br />
Before we left, we PCR'ed together the product of our Phns PCR's, fragments 2 and three were PCR'ed together by SOEing PCR. We also did the Zymo cleanup, the ligations, and the transformations. I still haven't PCR'ed up the Aron Lau Fragments and the dv021/022 thing to make <b1006>. I'll have to do that tomorrow. Maybe I can get here early.<br />
Dirk<br />
==[[User:Dirkvandepol|Dirkvandepol]] 18:30, 19 June 2008 (UTC)==<br />
(that's 11:20am PST, june 19...)<br />
So the Tues, Jun 18 SOEing PCR of Phns fragment A and E had initially failed (The Aron Lau- primer reaction to amplify SpvR succeeded, though); I set up eight attempts at a repeat of this reaction, using DMSO, 45 degree annealing temp, an alternative tube of fragment A (labelled "Phns 1"), and all combinatorial permutations thereof, for a total of eight reactions. All were success, but doing the work, and consulting with Jin has raised a specter of doubt on whether I used the right primer to make fragment E. We will digest two of our tubes (2 and 4) and then, rather than do a zymo cleanup, we will do a gel puficiation to confirm that I didn't use the bad primer to make fragment E (which, if I had, would show two bands when run on the gel for it having been cut by EcoRI). If a single band is obtained in these lanes, then we will ligate and transform, hopefully today.<br />
While the digestion is digesting, we will watch day 2 of the videos, hopefully somewhere downstairs.<br />
==[[User:Dirkvandepol|Dirkvandepol]] 02:17, 21 June 2008 (UTC)==<br />
715pm PST<br />
Yesterday, those gels showed a single band, which we sampled. In the evening, after Cici and Sherine left I zymo-cleaned, ligated, and transformed SpvR and Phns. The plates today showed colonies, which have been put into a culture block. Tomorrow Madhvi will mini-prep them. I don't expect I'll come in. But maybe I will.<br />
<br />
==[[User:Dirkvandepol|Dirkvandepol]] 18:25, 23 June 2008 (UTC)==<br />
Monday, 11am.<br />
On Friday, while watching the videos of Dr. Anderson's lectures with Cici and Sherine, Bing came in an told me I needed to analyze sequences. He ended up doing it for me. The interpretations are in my sequencing log.<br />
So different colonies were picked for the bad reads and the insertion. These were used to inoculate wells in a 24-well block. The block was cultured and a miniprep was done the next day.<br />
<br />
==[[User:Dirkvandepol|Dirkvandepol]] 17:13, 24 June 2008 (UTC)==<br />
<br />
Tuesday, 10am<br />
Last night, I came in late to set up cultures for some bad reads I had gotten on previous sequencing. This morning I have heard that Jin set things up for me after I left yesterday at 630pm. I feel bad that I make Jin's life more difficult in almost every way imaginable.<br />
Anyway, today I've got to:<br />
Finish doing the entry of sequencing data into the online sequencing logs that I didn't finish yesterday<br />
Miniprep the cultures that either I or Jin set up yesterday<br />
Send those minipreps for sequencing<br />
That's all I can think of for now<br />
<br />
==[[User:Dirkvandepol|Dirkvandepol]] 00:45, 25 June 2008 (UTC)==<br />
Tuesday 545pm<br />
Most sequencing info (not all) entered into sequencing log<br />
Minipreps sent for sequencing (2/3 of Jin's cultures only- my cultures are on reserve in case Jin's flop)<br />
Left to do today:<br />
Lyophilize oligos that Jin edited and ordered on my behalf<br />
Use those oligos to run an EIPCR to pcr up K112703 (His-tag>)<br />
That's all I can think of for now<br />
==[[User:Dirkvandepol|Dirkvandepol]] 17:51, 9 July 2008 (UTC)==<br />
Wednesday 1050am<br />
Yesterday- on 2 different 96-well plates, did minipreps by the magnetic bead purification method using the buffer complement from the ordinary kind of miniprep.<br />
Today- I guess I'll have more minipreps to do? I don't know.</div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV026Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0262008-07-15T21:25:12Z<p>Dirkvandepol: /* DJV026 aka His-tag> aka K112703-3 */</p>
<hr />
<div>==DJV026 aka His-tag> aka K112703-3==<br />
<pre><br />
TTATCCTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTATGCATCATCATCATCATCATGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCGGCTCACTCAAAGGCGGTAATCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGGGGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATTATCATGCCTCCTCTAGACCAGCCAGAACAGAAATGCCTCGACGTCGCTGCTACCCAAGGTTGCCGGGTGACGCACAGCGTGAAAACGGATGAAGGCACGAACCCAGTGGACATAAACCTGTTT<br />
eso si que es-djv-7/15<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV025Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0252008-07-15T21:23:58Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV025 aka His-tag> aka K112703-2==<br />
<pre><br />
ACATCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTATGCATCATCATCATCATCATGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCCTGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACTAACCCAGTGGACATAATCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTG<br />
eso si que es- djv- 7/15<br />
<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV024Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0242008-07-15T21:18:07Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV024 aka His-tag> aka K112703 colony #1==<br />
<pre><br />
CAATCCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTATGCATCATCATCATCATCATGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATTATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGACCGCCATCC<br />
Eso si que es djv 7/15<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV024Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0242008-07-15T21:17:39Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV024 aka His-tag> aka K112703 colony #1==<br />
<pre><br />
CAATCCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTATGCATCATCATCATCATCATGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATTATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGACCGCCATCC<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV023Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0232008-07-15T21:11:01Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV023 aka DJV020rev g00101 aka K112707 aka <pspv>==<br />
<pre><br />
CCCCGGCGGCCGTACGACGAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCACGTCGAGTTAGGATCCGATAATGTTTGCAGGGGAATTATTTTGTATTGCCAGAAAATGAGTGGCTTATATTGAGTTTATTTATGTGCTATTTTTCTGCTGTGCGGAATCGCGGTTCCCGGTGTGCAAAGATGGCACAACAAATTAACTCAGGAATAAGCAACGTTCAGCGCTCCGGCGTCGGGTCAGGCCGGGAACAACCTGACCGCTGGCGTGGTCCCATTTCAGGAATTAATTCATTCGCTGCGCCGTCATAGTCACCGTTATTCAGTTTCTTCAGTAAAGTGGCGTGAGCCAGCGCGTTAATGCCCATGTTTTAGGTAATCCACCAGAGCATCAAACTGATTCTGTGTCAGATTGACGGCGACCAGCCGGTTTACTCCATGCTCCGCGGTGAACTACCGCTATGGAGGATGGGGATTGCTGACAATCTGAATCTGGCAAATGCCGTGAATACAGGTGTTGCGGCCCTTACGCTGCATAAGGTCAGAAGGTGGACTGTTTCAGTTCCTGCTGTATCAGTTTTATAGCTTTACGATAATCTGGTGTCTCCCGTTTCTTGGTCGGGTAATACAAGGAGGTACAGAGCGCTACGCCTTTGATGTGCAGTGCGTGATCTGTTGATAATCCCAGAGCCCGACAGACTCTGACGGGGATGAGTAACATCGCCAGCCCTTGTTGTAACCGGTACAGTGAACTGAACAAATCGACGTTATCAAAACTGAATGCAGGGTTGGTAATACCTAGTGTCTGTTCAAAAAAATGGTATATGGTGTCCAGATTAAAATTTTTAGCCCCCTCATGAAAAAGTACAGGTGTTCCCGGCCAGCCTGTTGATATCAGGTTTGCCGCAGAGAAAGAATTTTTTAGGAATAAATAACATGACCCCACCCTCCACTGATGTCCGGCAGACAAGCGATTCCCGATGAAAATAATTTCTGGCAGAAAATAACAATGCAGTTGTTTGTCTGACACAGTTCTTCTATTATTTGGCTGTTAACGCTCTCCCCATTATATTTTGTTTTTTTTGCCGATTGTCAGTGCTTGAATGATCAAGATTTTTGAACTCCAGATAATTCGTCAAATATATTCTAGTGTTTCGTTTACGTAGTCCGAATTCCTGCTCAGTGCATGTAAGCAACTATCGACTGTCGGCATC<br />
verified- eso si que es- 7/15<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV022Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0222008-07-15T21:08:16Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV022 aka DJV020al027 aka <Pspv> aka K112707==<br />
<pre><br />
GTGGGACATTAATAAAAAATTAAAAATTTTCATAACACTGATGGAAACAGGTTCCTTCAGTATCGCAACATCAGTACTGTATATCACCCGAACCCCGCTGAGCAGGGTTATTTCAGACCTGGAAAGAGAGCTGAAACAAAGACTCTTTATACGGAAGAATGGCACTCTTATCCCAACCGAATTTGCACAAACTATTTATCGAAAAGTAAAATCCCATTATATTTTCTTACATGCACTGGAGCAGGAAATCGGACCTACGGGTAAAACGAAACAACTAGAAATAATATTTGACGAAATTTATCCGGGAAGTTTAAAAAATCTGATCATTTCAGCACTGACCATTTCCGGCCAAAAAACAAATATAATGGGGAGAGCCGTTAACAGCCAAATAATAGAAGAACTGTGTCAGACAAACAACTGCATTGTTATTTCTGCCAGAAATTATTTTCATCGGGAATCGCTTGTCTGCCGGACATCAGTGGAGGGTGGGGTCATGTTATTTATTCCTAAAAAATTCTTTCTCTGCGGCAAACCTGATATCAACAGGCTGGCCGGAACACCTGTACTTTTTCATGAGGGGGCTAAAAATTTTAATCTGGACACCATATACCATTTTTTTGAACAGACACTAGGTATTACCAACCCTGCATTCAGTTTTGATAACGTCGATTTGTTCAGTTCACTGTACCGGTTACAACAAGGGCTGGCGATGTTACTCATCCCCGTCAGAGTCTGTCGGGCTCTGGGGATTATCAACAGATCACGCACTGCACATCAAAGGGCGTAGCGCTCTGTACCTCCTTGTATTACCCGACCAAGAAAACGGGAGACACCAGATTATTCGTAAAAGCTATAAAACTGATACAGCAGGGAATCTGAAACAGTCCACCTTTCTGACCTTATGGCAGCGTAAAGGGGCCGCACACCTGGTATTCACGGCATTTG<br />
verified-eso si que es- 7/15<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV021Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0212008-07-15T21:00:21Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV021, aka K112707, aka <pspv>==<br />
<pre><br />
CCCGCCCCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTAGATCCTGTGATGTTTGGCGATACAAAATAATTCCCCTGCAAACATTATCGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACTATCAGGCCACTTTCAGTCAAAATACAATCTGTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACTAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCATCAACTATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACTTTATGAGGGAAAGCGGTGATCGCCGAAATTCGACTTAACTATTCACAGGTATTTTGGCGTCTTCGAGCGCCATCTCGAACCCGACGATGCTGGCCGTAAATTTTGTCGGCTCCGCAGTGGATGGGCGGCCTAAGCACACAAAATGCTATTGGATTAGCTGGG<br />
verified- eso si que es 7/15<br />
</pre></div>Dirkvandepolhttp://2008.igem.org/Team:UC_Berkeley/Notebook/DV_sequencingDJV/DJV020Team:UC Berkeley/Notebook/DV sequencingDJV/DJV0202008-07-15T20:58:54Z<p>Dirkvandepol: </p>
<hr />
<div>==DJV020, aka <pspv>- forward sequencing, aka K112707==<br />
<pre><br />
CCCTAGCTTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTAGATCCTGTGATGTTTGGCGATTGATCAGATCGCACAATCCGGGCTGAGTTCCCTTTCAGTGATCTACTATTTTGCGAAGCTATTTAGTGCACACTAATCGATTTTTCAGACAACCTTTCTCGCCTGGCGTGAGTTTTCGTTCGACTGAACCTATAAAAAGGCTCTGCATTCTGTCCTGTAGTGCGCCAGGCCTAATAACGCCTCCCGTTTAATTCCGGCCCGGTCGTACATCGGTTCTGTTCATTTATGGGATCGCGACTTTTTCGTTGTAATGCTTCAAGAGCGATTTTTTGTTCTGCGGTCAACTCAACATTCATAGCCATCAGCATGATCCTGATTATTTTTGAAACCAAGCATCTTCATTGATCATGGGTATACATCGTTGTTATCCAGCTATACATCATAACAGGTCAATTAAATCCACTCAGAAATAAAGTCAGGGTATGCATAAAATCTATCGCCCATAATCCTATCCAGTAACCCCATGATTAGTAAGAACTAATCAGTCTGTGCAAAAACAGGTCACCGCCATCCTGTTTTTGCACATCAAAACATTTTTTCAGGATTATTCTGAAAAAAAAAAGGAGATATTATGGATTTCTTGATTAATAAAAAATTAAAAATTTTCATAACACTGATGGAAACAGGTTCCTTCAGTATCGCAACATCAGTACTGTATATCACCCGAACCCCGCTGAGCAGGGTTATTTCAGACCTGGAAAGAGAGCTGAAACAAAGACTCTTTATACGGAAGAATGGCACTCTTATCCCAACCGAATTTGCACAAACTATTTATCGAAAAGTAAAATCCCATTATATTTTCTTACATGCACTGGAGCAGGAAATCGGACCTACGGGTAAAACGAAACAACTAGAAATAATATTTGACGAAATTTATCCCGGGAAGTTTAAAAAATCTGATCATTTCAGCACTGACCATTTCCGGCCAAAAAACAAATATAATGGGGAGAGCCGTTACAGCAAATAATAGAAGAACTGTGTCAGACAACACTGCATTGTTATTTTCTGCAGAAAGTATTTTCATCGGCATCGCTTGTCTGCCGGACTCATTGAGGTGGGTCATGTTATTATCTTAAAAATTCTTCCTGCGCACTGAATTCACAGCTGACGACACTTGTACTTTTCAATGAA<br />
verified 7/15<br />
</pre></div>Dirkvandepol