http://2008.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Francesca+ceroni&year=&month=2008.igem.org - User contributions [en]2024-03-29T13:48:41ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/Team:BolognaTeam:Bologna2008-10-30T01:09:29Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop formed by an epigenetic memory sensitive to IPTG -for the memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop circuit by model-based analysis and computer simulation. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications.<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The leading idea behind the UniBO Team was to put in touch students of the same University with different backgrounds to favor competence and skill sharing. Students from different Faculties (Biotechnology, Pharmacy and Engineering) answered to the iGEM call and formed the TEAM. They were moved by a common desire for new experiences and they decided to participate in this exciting competition to go deep in Synthetic Biology. The Team worked hard during the summer to become fully operative, overcoming differences both in training and personality.<br />
<br><br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
Mathematical model analysis and computer simulations were used to design the Flip-Flop circuit. We resorted to this engineer’s approach to obtain a rational design of regulated promoters, that are the core element of the circuit. By the model we found the analytic relationships to quote the regulated promoter in terms of transcriptional strength and sensitivity to the repressor. By model-based computer simulation we established such a relevant circuit properties as the bistability and the dynamical response to inputs. A simple procedure to characterize the operator sequence was theoretically derived. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find two software tools developed in our lab for this competition and that we would like to share with other Teams. One tool is a bacteria fluorescence image analyzer that segments the bacteria, counts their number, computes the size and the fluorescence intensity for each segmented bacterium. The second tool searches data in the Registry automatically to find parts by entry a part name or a string with short part description or a nucleotide sequence. You can download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and hydrogen peroxide).[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-30T00:32:41Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop formed by an epigenetic memory sensitive to IPTG -for the memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop circuit by model-based analysis and computer simulation. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications.<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The leading idea behind the UniBO Team was to put in touch students of the same University with different backgrounds to favor competence and skill sharing. Students from different Faculties (Biotechnology, Pharmacy and Engineering) answered to the iGEM call and formed the TEAM. They were moved by a common desire for new experiences and they decided to participate in this exciting competition to go deep in Synthetic Biology. The Team worked hard during the summer to become fully operative, overcoming differences both in training and personality.<br />
<br><br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find two software tools developed in our lab for this competition and that we would like to share with other Teams. One tool is a bacteria fluorescence image analyzer that segments the bacteria, counts their number, computes the size and the fluorescence intensity for each segmented bacterium. The second tool searches data in the Registry automatically to find parts by entry a part name or a string with short part description or a nucleotide sequence. You can download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and hydrogen peroxide).[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-30T00:28:41Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications.<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The leading idea behind the UniBO Team was to put in touch students of the same University with different backgrounds to favor competence and skill sharing. Students from different Faculties (Biotechnology, Pharmacy and Engineering) answered to the iGEM call and formed the TEAM. They were moved by a common desire for new experiences and they decided to participate in this exciting competition to go deep in Synthetic Biology. The Team worked hard during the summer to become fully operative, overcoming differences both in training and personality.<br />
<br><br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find two software tools developed in our lab for this competition and that we would like to share with other Teams. One tool is a bacteria fluorescence image analyzer that segments the bacteria, counts their number, computes the size and the fluorescence intensity for each segmented bacterium. The second tool searches data in the Registry automatically to find parts by entry a part name or a string with short part description or a nucleotide sequence. You can download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and hydrogen peroxide).[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-30T00:26:17Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications.<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The leading idea behind the UniBO Team was to put in touch students of the same University with different backgrounds to favor competence and skill sharing. Students from different Faculties (Biotechnology, Pharmacy and Engineering) answered to the iGEM call and formed the TEAM. They were moved by a common desire for new experiences and they decided to participate in this exciting competition to go deep in Synthetic Biology. The Team worked hard during the summer to become fully operative, overcoming differences both in training and personality.<br />
<br><br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find two software tools developed in our lab for this competition and that we would like to share with other Teams. One tool is a bacteria fluorescence image analyzer that segments the bacteria, counts their number, computes the size and the fluorescence intensity for each segmented bacterium. The second tool searches data in the Registry automatically to find parts by entry a part name or a string with short part description or a nucleotide sequence. You can download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:55:27Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications.<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The leading idea behind our Ecoli.PROM team was to put in touch students with different curricula, ways to approach scientific problems and favour ideas exchange. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties.<br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find two software tools developed in our lab for this competition and that we would like to share with other Teams. One tool is a bacteria fluorescence image analyzer that segments the bacteria, counts their number, computes the size and the fluorescence intensity for each segmented bacterium. The second tool searches data in the Registry automatically to find parts by entry a part name or a string with short part description or a nucleotide sequence. You can download them from this[[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/SoftwareTeam:Bologna/Software2008-10-29T23:45:57Z<p>Francesca ceroni: /* ARQ: a Java tool to query the Registry */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Visual Fluo Bacteria: a software for the analysis of bacteria fluorescence images =<br />
__FORCETOC__<br />
Image of fluorescence bacteria is commonly used to visualize the activity of genetically engineered bacteria (see Figure 1). <br />
<br />
<br><br />
<br />
[[Image:field.jpg|200px|thumbnail|Figure 1. Fluorescence field|center]]<br />
<br />
<br><br />
Bacteria fluorescence imagines can be obtained by optical microscopy with a ccd camera. We develop a matlab tool to analyze such kind of bacterium imagine that can be acquired in different format (jpg, bpm, tiff). The software initially segments bacteria and then computed their number. For each segmented bacteria the software computes the size in pixel, the mean and standard deviation of intensity florescence. The use of the software is easy and intuitive (see user interface in Figure 2).<br />
<br />
<br><br />
<br />
[[Image:Screenshot.jpg|thumbnail|500px|Figure 2. Main frame|center]]<br />
<br />
<br><br />
<br />
The algorithm reads fluorescence images and converts it into a "black and white" one. Then the image is filtered by Top Hat filter to correct uneven illumination when the background is dark. In the next step the global threshold is computed in order to convert an intensity image to a binary image using Otsu’s method. The image is then ready to be scanned, pixel by pixel, to detect bacteria (cluster of pixels) and obtain informations about their area, fluorescence mean and standard deviation. Fluorescence is read from R channel for RFP, G for GFP and B for CFP. The software allows to filter imagine by neglecting the bacteria that have morphologic parameters out of a prefixed range. The user can set two indicators:<br><br />
* Area dimension range ( definite by a superior and an inferior limit): This range defers to selected the bacteria that have similar size.<br />
* Fluorescence intensity ( definite by the std\mean ratio referred to each bacteria): this values consent to throw away the bacteria that lie on another focal layer or that aren’t focused correctly.<br />
<br />
At this point, the filter based on these values discard the bacteria that have a std\mean higher than the threeshold and the bacteria that have a dimension out of the range. <br />
<br />
<br />
<br><br />
<br />
<div style="text-align:center"> <br />
Example of filtering with very selective parameters (low ratio std/mean and narrow range of area dimensions)<br />
</div><br />
<br />
{| align=center<br />
|[[Image:before.jpg|200px|thumbnail|Figure 3. Image before filtering]]<br />
|[[Image:freccia.jpg|200px]]<br />
|[[Image:after.jpg|200px|thumbnail|Figure 4. Image after filtering]]<br />
|}<br />
<br />
<br><br />
<br />
All the obtained data are processed with area and focus efficiency parameters to estimate the population fluorescence mean, standard deviation, median, minimal and maximal fluorescence levels.<br> <br />
<br />
<br />
'''To download the program and relative user manual, you can click on the following icons.'''<br />
<br />
[[Image:winrar.jpg|32px]][[Media:VFB1.0.zip|Visual Fluo Bacteria 1.0]]<br />
<br><br />
Note: after decompacting file, execute and run classificazione.m<br />
<br><br />
[[Image:adobe.jpg|30px]][[Media:UserManual.pdf|User Manual]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Software ''Up'']<br />
<br />
== Microscopy system for fluorescence image acquisition ==<br />
<br />
[[Image:Microscopy1.jpg|right|thumbnail|450px|Figure 5. Acquisition system]]<br />
<br />
The system’s core is a Nikon Eclipse TE2000-U inverted fluorescence microscope. For GFP image acquisition we used a B-2A filter by Nikon with an excitation band between 450 and 490 nm and the optimal emission placed at 520 nm.<br />
<br />
The illumination system is composed of a 75 Watt Xenon arc lamp connected to a Photon Technology Instruments DeltaRAM X monochromator. The home-made control of monochromator is implemented in a Labview and permits the regulation of the excitation wavelength and the calibration of the system.<br />
<br />
The camera used to acquire images is a Nikon DS-5m with a DS-U1 controller. This one receives the acquired signal form the camera through a serial connection and sends it to the PC through an USB slot. Nikon also supplied an software for image acquisition (X-Data).<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Software ''Up'']<br />
<br />
= ARQ: a Java tool to query the Registry =<br />
<br />
The Registry is an important information source. The amount of information is expected to grow in the next future, so we developed a Java tool to search data in the Registry automatically. In facts the Registry page are well structured and write in a standard way, that enable automatic query by the simple reading of the html code.<br />
The software has been developed in java language to ensure its indipendence from the machine type and from the OS.<br><br />
<br />
The main form "SEARCH FORM" (figure 1) ha an user interface friendly and very simple:<br />
[[Image:Findpart.jpg|center|thumbnail|500px|Figure 6. Search form]]<br />
<br><br><br />
By this form is possible to insert one of the following entry:<br />
<br />
*"CODE PART":standard biobrick code (BBa_XXXXX)<br />
*"PARTIAL DESCRIPTION":any keyword that would be researched<br />
*"SEQUENCE":the sequence without space in one line<br />
*"GO":start the search<br />
*"START A NEW SEARCH":stop the running query and reset the form for a new search<br />
<br><br><br />
By the drop-down menù "PART TYPE" it's possible to limit the search on:<br />
*measurement<br />
*generator<br />
*composite<br />
*rna<br />
*dna<br />
*conjugation<br />
*reporters<br />
*signalling<br />
*rbs<br />
*regulatory<br />
*terminator<br />
*all<br><br />
<br />
Three query modalities are possible in this tool:<br><br><br />
[[Image:tabellaingressorisultati.jpg|center|600px]]<br />
<br><br><br />
When we use the entry "PARTIAL DESCRIPTION" or "SEQUENCE" the result of the query could be not unique, so the result will show in the form "RESULT FORM" (figure 2):<br />
<br />
[[Image:finestra scelta.jpg|center|thumbnail|450px|Figure 7. Result form]]<br />
<br><br />
"RESULT PAGE" shows a list of the registry parts that matched the entry, with a double click is possible to select the desired one; after this will be automatically upload in the "SEARCH FORM" the data part.<br />
When the entry is "SEQUENCE" is possible to scroll the result in the "RESULT FORM" and will be visualized by a tool tip for every matched part (figure 3):<br />
<br />
[[Image:tooltip.jpg|center|thumbnail|450px|Figure 8. Tooltip]]<br />
<br />
<br><br><br />
*the name of part<br />
*the first and the last index of the alignment between the query and the answer sequence<br />
*the length of the answer sequence<br />
*the group of the registry parts (regulatory,conjugation,signalling....)<br />
<br><br />
<br />
When a part is selected, by a double mouse double click, the program automatically update the data and change to upper case the shared nucleotide (figure 4).<br />
[[Image:sequencematch.jpg|center|thumbnail|450px|Figure 9. Matched sequence]]<br />
<br><br><br><br />
<br />
'''To download the program or the relative java documentation and the source code you can click on the following icons.'''<br />
<br />
[[Image:ARQlogo.jpg|90px]][[Media:ARQ 2.0.zip| download ARQ 1.0]]<br />
<br><br />
Note: after decompacting file, to execute if you have windows there is launch.exe else the main class path is model/launch<br />
<br><br />
[[Image:winrar.jpg|30px]][[Media:ARQdocumentation.zip| download ARQdoc]]<br />
<br><br />
[[Image:winrar.jpg|30px]][[Media:ARQsource.zip| download ARQsrc]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Software ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/SoftwareTeam:Bologna/Software2008-10-29T23:38:46Z<p>Francesca ceroni: /* Visual Fluo Bacteria: a software for the analysis of fluorescence bacteria image */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Visual Fluo Bacteria: a software for the analysis of bacteria fluorescence images =<br />
__FORCETOC__<br />
Image of fluorescence bacteria is commonly used to visualize the activity of genetically engineered bacteria (see Figure 1). <br />
<br />
<br><br />
<br />
[[Image:field.jpg|200px|thumbnail|Figure 1. Fluorescence field|center]]<br />
<br />
<br><br />
Bacteria fluorescence imagines can be obtained by optical microscopy with a ccd camera. We develop a matlab tool to analyze such kind of bacterium imagine that can be acquired in different format (jpg, bpm, tiff). The software initially segments bacteria and then computed their number. For each segmented bacteria the software computes the size in pixel, the mean and standard deviation of intensity florescence. The use of the software is easy and intuitive (see user interface in Figure 2).<br />
<br />
<br><br />
<br />
[[Image:Screenshot.jpg|thumbnail|500px|Figure 2. Main frame|center]]<br />
<br />
<br><br />
<br />
The algorithm reads fluorescence images and converts it into a "black and white" one. Then the image is filtered by Top Hat filter to correct uneven illumination when the background is dark. In the next step the global threshold is computed in order to convert an intensity image to a binary image using Otsu’s method. The image is then ready to be scanned, pixel by pixel, to detect bacteria (cluster of pixels) and obtain informations about their area, fluorescence mean and standard deviation. Fluorescence is read from R channel for RFP, G for GFP and B for CFP. The software allows to filter imagine by neglecting the bacteria that have morphologic parameters out of a prefixed range. The user can set two indicators:<br><br />
* Area dimension range ( definite by a superior and an inferior limit): This range defers to selected the bacteria that have similar size.<br />
* Fluorescence intensity ( definite by the std\mean ratio referred to each bacteria): this values consent to throw away the bacteria that lie on another focal layer or that aren’t focused correctly.<br />
<br />
At this point, the filter based on these values discard the bacteria that have a std\mean higher than the threeshold and the bacteria that have a dimension out of the range. <br />
<br />
<br />
<br><br />
<br />
<div style="text-align:center"> <br />
Example of filtering with very selective parameters (low ratio std/mean and narrow range of area dimensions)<br />
</div><br />
<br />
{| align=center<br />
|[[Image:before.jpg|200px|thumbnail|Figure 3. Image before filtering]]<br />
|[[Image:freccia.jpg|200px]]<br />
|[[Image:after.jpg|200px|thumbnail|Figure 4. Image after filtering]]<br />
|}<br />
<br />
<br><br />
<br />
All the obtained data are processed with area and focus efficiency parameters to estimate the population fluorescence mean, standard deviation, median, minimal and maximal fluorescence levels.<br> <br />
<br />
<br />
'''To download the program and relative user manual, you can click on the following icons.'''<br />
<br />
[[Image:winrar.jpg|32px]][[Media:VFB1.0.zip|Visual Fluo Bacteria 1.0]]<br />
<br><br />
Note: after decompacting file, execute and run classificazione.m<br />
<br><br />
[[Image:adobe.jpg|30px]][[Media:UserManual.pdf|User Manual]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Software ''Up'']<br />
<br />
== Microscopy system for fluorescence image acquisition ==<br />
<br />
[[Image:Microscopy1.jpg|right|thumbnail|450px|Figure 5. Acquisition system]]<br />
<br />
The system’s core is a Nikon Eclipse TE2000-U inverted fluorescence microscope. For GFP image acquisition we used a B-2A filter by Nikon with an excitation band between 450 and 490 nm and the optimal emission placed at 520 nm.<br />
<br />
The illumination system is composed of a 75 Watt Xenon arc lamp connected to a Photon Technology Instruments DeltaRAM X monochromator. The home-made control of monochromator is implemented in a Labview and permits the regulation of the excitation wavelength and the calibration of the system.<br />
<br />
The camera used to acquire images is a Nikon DS-5m with a DS-U1 controller. This one receives the acquired signal form the camera through a serial connection and sends it to the PC through an USB slot. Nikon also supplied an software for image acquisition (X-Data).<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Software ''Up'']<br />
<br />
= ARQ: a Java tool to query the Registry =<br />
<br />
The Registry is an important information source. It is aspected thet the amount of information will growth in the future, so we develop a java tool to search data in the Registry automatically. In facts the Registry page are well structured and write in a standard way, that enable automatic query by the simple reading of the html code.<br />
The software has been developed in java language to ensure its indipendence from the machine type and from the OS.<br><br />
<br />
The main form "SEARCH FORM" (figure 1) ha an user interface friendly and very simple:<br />
[[Image:Findpart.jpg|center|thumbnail|500px|Figure 6. Search form]]<br />
<br><br><br />
By this form is possible to insert one of the following entry:<br />
<br />
*"CODE PART":standard biobrick code (BBa_XXXXX)<br />
*"PARTIAL DESCRIPTION":any keyword that would be researched<br />
*"SEQUENCE":the sequence without space in one line<br />
*"GO":start the search<br />
*"START A NEW SEARCH":stop the running query and reset the form for a new search<br />
<br><br><br />
By the drop-down menù "PART TYPE" it's possible to limit the search on:<br />
*measurement<br />
*generator<br />
*composite<br />
*rna<br />
*dna<br />
*conjugation<br />
*reporters<br />
*signalling<br />
*rbs<br />
*regulatory<br />
*terminator<br />
*all<br><br />
<br />
Three query modalities are possible in this tool:<br><br><br />
[[Image:tabellaingressorisultati.jpg|center|600px]]<br />
<br><br><br />
When we use the entry "PARTIAL DESCRIPTION" or "SEQUENCE" the result of the query could be not unique, so the result will show in the form "RESULT FORM" (figure 2):<br />
<br />
[[Image:finestra scelta.jpg|center|thumbnail|450px|Figure 7. Result form]]<br />
<br><br />
"RESULT PAGE" shows a list of the registry parts that matched the entry, with a double click is possible to select the desired one; after this will be automatically upload in the "SEARCH FORM" the data part.<br />
When the entry is "SEQUENCE" is possible to scroll the result in the "RESULT FORM" and will be visualized by a tool tip for every matched part (figure 3):<br />
<br />
[[Image:tooltip.jpg|center|thumbnail|450px|Figure 8. Tooltip]]<br />
<br />
<br><br><br />
*the name of part<br />
*the first and the last index of the alignment between the query and the answer sequence<br />
*the length of the answer sequence<br />
*the group of the registry parts (regulatory,conjugation,signalling....)<br />
<br><br />
<br />
When a part is selected, by a double mouse double click, the program automatically update the data and change to upper case the shared nucleotide (figure 4).<br />
[[Image:sequencematch.jpg|center|thumbnail|450px|Figure 9. Matched sequence]]<br />
<br><br><br><br />
<br />
'''To download the program or the relative java documentation and the source code you can click on the following icons.'''<br />
<br />
[[Image:ARQlogo.jpg|90px]][[Media:ARQ 2.0.zip| download ARQ 1.0]]<br />
<br><br />
Note: after decompacting file, to execute if you have windows there is launch.exe else the main class path is model/launch<br />
<br><br />
[[Image:winrar.jpg|30px]][[Media:ARQdocumentation.zip| download ARQdoc]]<br />
<br><br />
[[Image:winrar.jpg|30px]][[Media:ARQsource.zip| download ARQsrc]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Software ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:21:45Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:21:06Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory (EPROM) with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:19:57Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect them to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:18:28Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the Flip-Flop by model-based analysis. The core elements of the genetic Flip-Flop are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect these parts to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:14:47Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the circuit by model-based analysis. The core elements of the genetic Flip-Flop are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since operator sites are still lacking in the Registry as standard parts, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect these parts to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:13:57Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the circuit by model-based analysis. The core elements of the genetic Flip-Flop are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since standard operator sites are still lacking in the Registry, we cloned operator sequences for LacI, TetR, Lambda and LexA repressors and established an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect these parts to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:12:53Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG - for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the circuit by model-based analysis. The core elements of the genetic Flip-Flop are two mutually regulated promoters. Each of them is composed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since standard operator sites are still lacking in the Registry, we clone operator sequences for LacI, TetR, Lambda and LexA repressors and establish an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect these parts to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T23:11:46Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by an epigenetic memory sensitive to IPTG- for memory reset- and an UV-sensitive trigger to set the memory ON. We designed the circuit by model-based analysis. The core elements of the genetic Flip-Flop are two mutually regulated promoters. Each of them is formed of a constitutive promoter and an independent operator sequence. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Since standard operator sites are still lacking in the Registry, we clone operator sequences for LacI, TetR, Lambda and LexA repressors and establish an experimental procedure to characterize them. These parts allow the rational design of regulated promoters and we expect these parts to be a benefit in many Synthetic Biology applications. <br />
<br />
<br />
<br />
<br />
<br />
[[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T22:45:45Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
{| align="center"<br />
|[[Image:main.jpg|Logo Bologna|900px|center]] <br />
|}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
Our project aims to design a bacterial reprogrammable binary memory with genetically engineered E.coli. To engineer bacteria we designed a genetic Flip-Flop (SR Latch) formed by a epigenetic memory and an UV-sensitive trigger. We chose UV to set the memory ON and IPTG to reset it. We designed the circuit by model-based analysis. Core elements of the genetic Flip-Flop are two mutually regulated promoters. Each of them has as an operator sequence downstream a constitutive promoter. Thus, transcriptional strength and repressor binding affinity can be independently fixed. Operators for LacI, TetR, Lambda and LexA repressors were cloned to allow the rational design of regulated promoters that is still lacking in the Registry. A simple experimental procedure was established to characterize the regulated promoter. We expect these parts to be a benefit in many Synthetic Biology applications. [[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the foundation of the Ecoli.PROM team consisted in the synergistically collaboration of various young students with different curricula. These students, pushed by their common desire for new experiences, decided to participate in this exciting competition to discover a new research field and to expand their interest for synthetic biology. Responding to the call of Professor Silvio Cavalcanti, they constituted the Bologna iGEM team, finally composed of students from Biotechnology, Electronics Engineering and Biomedical Engineering faculties. <br />
<br><br />
[[Team:Bologna/Team|Go to the page!]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Wetlab|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br> <br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is how we designed the operator libraries, how we isolated single operators and try to clone them in the standard format and how we used operators to tune promoter activation in response to UV induction.[[Team:Bologna/Wetlab|So wet!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2008-10-29T22:27:02Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Model-based analysis of the genetic Flip-Flop =<br />
<br />
== The genetic Flip-Flop ==<br />
<br />
[[Image:Circuito2.jpg|300px|thumb|right|Figure 1. Scheme of the genetic Flip-Flop]] <br />
<div style="text-align:justify"><br />
The molecular circuit in Figure 1 can switch between two different stable states (LacI-ON and TetR-ON), driven by two external stimuli (UVc and IPTG). LacI-ON represents the stable state in witch LacI gene is active and LacI protein represses the TetR gene expression, with a positive feedback. Therefore, the LacI-ON state coincides with the TetR-OFF condition. On the contrary, the TetR-ON represents the state with the TetR gene active and the LacI gene silenced (LacI-OFF). Owing to the coexistence of two stable states (bistability), this circuit is capable of serving as a binary memory. We denominated it a Flip-Flop since it works as a [[Team:Bologna/Modeling#SR_Latch|SR Latch]]: LacI state is the [[Image:q.jpg]] output and TetR state is the [[Image:qneg.jpg]] output. Uvc is the set signal and IPTG is the reset signal. Indeed, IPTG stimulation inhibits LacI repressor, thus can cause the transition from the LacI-ON state to the TetR-ON. UVc radiation, inactivating LexA repressor through the [[Team:Bologna/Modeling#UV_Radiation:_SOS_system|SOS response]] (Friedberg et al., 1995) can cause the opposite transition from LacI-ON to TetR-ON.<br><br />
The core elements of the genetic program are two mutually regulated promoters. The promoter transcriptional strength and the repressor binding affinity to the promoter determinate such relevant circuit properties as the bistability and the response to inputs. To quote the promoters in terms of strength and sensitivity to repressor we resorted to the following model-based analysis and [[Team:Bologna/Modeling#Numerical_simulations|numerical simulations]].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Mathematical Model ==<br />
<br />
<br />
'''<font size="3">Model equations</font>'''<br />
<br />
<br><br />
The Flip-Flop circuit in Figure 1 can be modeled by the following equations:<br />
<br />
<br><br />
<br />
[[Image:Equazioni.jpg|center]]<br />
<br />
<br><br />
<br />
Symbol definition is listed in Table 1.<br />
<br />
<br><br />
<br />
[[Image:Tabella simboli.jpg|center]]<br />
<br />
<br><br />
<br />
A common motif in repressor proteins is the presence of a dimeric nucleotide-binding site with dimeric structure. In accordance to this general structure the cooperativity coefficients ([[Image:mu.jpg]]) were assumed equal to 2. The maximum velocity of repressor synthesis ([[Image:alfa.jpg]]) accounts for the strength of the unregulated promoter and RBS. The value of the affinity constant for the binding of repressor to the promoter strictly depends on the sequence of operator site (OS block).<br />
<br />
<br><br />
<br />
'''<font size="3">Adimensional equations</font>'''<br />
<br />
<br><br />
The equations (1.1) and (1.2) can be written dimensionless:<br />
<br />
<br />
[[Image:sistemaequazioni.jpg|center]]<br />
<br />
Where:<br />
<br />
<br><br />
<br />
[[Image:accozz.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Equibrium conditions ==<br />
<br />
In the absence of stimuli, the adimensional concentrations of LacI ([[Image:i.jpg]]) and TetR ([[Image:r.jpg]]) at equilibrium are related by the equations: <br />
<br />
[[Image:equa3new.jpg|center]]<br />
<br><br />
To obtain these relations the UVc-dependent term in equation (1.4) was ignored ([[Image:appr.jpg]] ). This is justified by the high binding constant of LexA for its operator, and the consequent negligible contribution to the LacI synthesis.<br />
Equations (1.6) and (1.7) can have one or three solutions that represent the equilibrium conditions of the circuit. The solutions, i.e. the equilibrium conditions, can be graphically identified as the intersections between [[Image:r.jpg]] and [[Image:i.jpg]] nullclines (see Figure 2). The case of multiple equilibrium conditions (bistability case) is shown in Figure 2 panel b. TetR-ON and LacI-ON are stable equilibriums separated by the unstable one (saddle point). Due to the bistability the circuit can operate as a binary memory. <br />
The existence of a bistability condition depends on the value of [[Image:kr.jpg]] and [[Image:ki.jpg]] parameters. If [[Image:kr.jpg]] decrease (see Figure 2 panel a) a saddle-node bifurcation can occur, TetR-ON equilibrium vanishes and remain only the stable equilibrium LacI-ON. The contrary occurs when [[Image:ki.jpg]] is decreased (Figure 2 panel c). Thus bistability is guaranteed only for a limited range of [[Image:ki.jpg]] and [[Image:kr.jpg]] values. <br />
<br />
<br><br />
<br />
[[Image:equicondition.jpg|900px|center|thumbnail|Figure 2. Equilibrium conditions]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Bifurcation analysis ==<br />
<br><br />
<br />
Assuming that LacI-ON exists the corresponding equilibrium value of [[Image:i.jpg]] is higher than 1 (see Figure 2), then it can be assumed that [[Image:iquadro.jpg]] and the equation (1.7) simplies to:<br />
<br />
[[Image:equa1_8b.jpg|center]]<br />
<br />
<br><br />
Substituting this expression in equation (1.6) one obtain:<br />
[[Image:equa1_9b.jpg|center]]<br><br />
Then:<br />
<br><br />
<br />
[[Image:equa1_10b.jpg|center]]<br />
<br />
<br><br />
To be real the solutions of equation (1.10) it is necessary that [[Image:krdis.jpg]] (see Figure 3). Under this condition the existence of the LacI-ON state is assured. When [[Image:kreq.jpg]] the system undergoes a saddle-node bifurcation (LacI-ON and saddle point go in collision) and the two equilibrium points vanish.<br />
<br><br />
[[Image:SaddleNodebifurcation1.jpg|thumbnail|center|500 px|Figure 3. Saddle-Node bifurcation]]<br />
<br><br />
An analogous result can be obtained for the existence of the TetR-ON state. Thus, a sufficient condition for bistability is:<br />
<br />
<br><br />
<br />
[[Image:Equa1_11_12.jpg|center]]<br />
<br />
<br><br />
<br />
Figure 4 shows the log-log plot of (1.11) and (1.12) <br />
<br />
<br><br />
<br />
[[Image:Rangeofbistability2.jpg|500 px|center|thumbnail|Figure 4. Range of bistability for the genetic Flip-Flop]]<br />
<br><br />
<br />
As shown in Figure 4, the coexistence of two stable equilibria (LacI-ON and TerR-ON) is guaranteed for[[image:ki.jpg]]and [[image:kr.jpg]]greater than 3 in a large range of values (bistability range). Imposing a value for [[image:ki.jpg]] greater than 3 it is possible to establish a range for [[image:kr.jpg]] to have a bistable behaviour. More the ([[image:ki.jpg]],[[image:kr.jpg]]) point is near the bifurcation lines more the transition from bistability to monostability is probably. To have a good robustness we fixed [[image:ki.jpg]] and [[image:kr.jpg]] equal to 10. For this value the circuit is sufficently distant from the bifurcation lines to evoid random memory switching but it is possible to set (or to reset) the memory with proper stimulation. <br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Procedure for Ki-index identification ==<br />
<br><br />
The procedure will be described for LacI, analogous procedure can be applied to the TetR case. The value of [[Image:ki.jpg]]-index can be identified comparing the experimental responses of the open loop and closed loop circuits: <br />
<br><br />
{| align="center"<br />
|<br />
<br><br><br />
* Open loop circuit<br />
<br><br><br><br />
* Closed loop circuit<br />
<br><br><br><br><br><br><br><br />
|[[Image:Molecularcircuitini.jpg|thumbnail|500px|Figure 5. Molecular circuits for the Ki-index experimental determination|right]]<br />
|}<br />
<br />
<br />
<br />
The LacI concentration in the open loop circuit is given by:<br />
<br><br />
[[Image:Equa1_13.jpg|center]]<br />
<br><br />
Thus the equilibrium condition is:<br />
<br><br />
[[Image:Equa1_14.jpg|center]]<br />
<br><br />
The time derivative of LacI concentration in the close loop circuit follows:<br />
<br><br />
[[Image:Equa1_15.jpg|center]]<br />
<br><br />
Which gives the equilibrium condition:<br />
<br><br />
[[Image:Equa1_16.jpg|center]]<br />
<br><br />
That can be rewritten <br />
<br><br />
[[Image:Equa1_17.jpg|center]]<br />
<br><br />
The affinity constant can consequently be derived from this expression<br />
<br><br />
[[Image:Equa1_18.jpg|center]]<br />
<br><br />
Inserting the (1.14) and (1.18) in the [[Image:ki.jpg]]-index definition one obtain:<br />
<br><br />
[[Image:Equa1_19b.jpg|center]]<br />
<br><br />
We assume that GFP is proportion to [[Image:imai.jpg]], then<br />
<br><br />
[[Image:Equa1_20.jpg|center]]<br />
<br><br />
We introduce the ratio [[Image:h.jpg]] between the fluorescence in open loop and in closed loop:<br />
<br><br />
[[Image:Equa1_21.jpg|center]]<br />
<br><br />
After measuring the ratio [[Image:h.jpg]] it is possible to calculate [[Image:ki.jpg]] by the curve in Figure 6 and then it is possible to establish by Figure 4 the [[Image:kr.jpg]] range that guarantees bistability. In the presence of an experimentally characterized library of regulated promoter, the procedure can be adopted to design genetic Flip-Flop with desired behaviors.<br><br />
[[Image:indexforlaci1.jpg|center|thumbnail|500 px|Figure 6. Ki-index for LacI]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Numerical simulations==<br />
<br />
Model equations (1.4) and (1.5) have been used to simulate: i) the sensitivity of the circuit to initial state and ii) the response to [[Image:iptgn.jpg]] and [[Team:Bologna/Wetlab#UV_Induction|UVc stimulations]]. Numerical simulations were performed in Simulink (MathWorks). Simulator scheme is shown in Figure 7. To ensure circuit bistability parameters [[Image:ki.jpg]] and [[Image:kr.jpg]] were both fixed to 10.<br />
<br />
<br><br />
<br />
[[Image:blocchi1.jpg|center|500 px|thumbnail|Figure 7. Simulink simulator scheme]]<br />
<br />
<br><br />
<br />
The trajectories in the plane of the states (see Figure 8) clearly show the separatrix line (red line) and two attraction basins (one for the LacI-ON and the other for TetR-ON equilibrium). Depending on the initial state the memory can reach one of two stable equilibria (blu curve). The memory switches from a stable equilibrium to the other one when an external perturbation move the state over the separatrix entering it in the other attraction basin.<br />
<br />
<br><br />
<br />
[[Image:sim2.jpg|center|500 px|thumbnail|Figure 8. State-Plane Trajectories]]<br />
<br />
<br><br />
<br />
To simulate the [[Image:iptgn.jpg]] reset, we fixed the initial state to the LacI-ON ([[Image:i.jpg]] = 10 and [[Image:r.jpg]] = 0.2) and we simulate the application of different levels of [[Image:iptgn.jpg]]. In the simulations we referred the [[Image:iptgn.jpg]] to the [[Image:iptg50.jpg]] concentration. An induction of maximum 5 hours was considered (see Figure 9). Until [[Image:iptgn.jpg]] level is lower than 1.2 times the [[Image:iptg50.jpg]], the memory does not reset to TetR-ON and when the induction finish, the state returns in about 5 hours to LacI-ON. To observe the memory switching is necessary to overcome the separatrix. This occurs for [[Image:iptgn.jpg]] > 1.2 times [[Image:iptg50.jpg]]. With a minimal [[Image:iptgn.jpg]] dose the switching is very slow (about 5 hour). To accelerate the transition it is sufficient to expose the circuit for 1 hour to [[Image:iptgn.jpg]] = 3 times [[Image:iptg50.jpg]]. <br />
<br />
<br><br />
<br />
[[Image:iptg4.jpg|center|500 px|thumbnail|Figure 9. Circuit response to IPTG pulse]]<br />
<br />
<br><br />
<br />
To simulate the UVc set to LacI-ON of the memory, we assumed the TetR-ON as initial condition ([[Image:i.jpg]] = 0.2 and [[Image:r.jpg]] = 10), [[Image:ka.jpg]] parameter was fixed equal to 10, the rate [[Image:aa50.jpg]] was equal to 30 and [[Image:1beta.jpg]] was equal to 2. We supposed to radiate the memory for few minutes with different UVc energies. The cell radiation starts the SOS response that we simple modeled as a temporary RecA-mediated inhibition of LexA repressor. The memory set to LacI-ON does not take place until the UVc energy is lower than a threshold of 16 [[Image:udm.jpg]] (see Figure 10). When the UVc exceeds this threshold, the memory switches from TetR-ON to LacI-ON. <br />
<br />
<br><br />
<br />
[[Image:UVc1.jpg|center|500 px|thumbnail|Figure 10. Circuit response to UVc radiation]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= SR Latch =<br />
<br />
In digital circuits, a flip-flop is a term referring to an electronic circuit (a bistable multivibrator) that has two stable states and thereby is capable of serving as one bit of memory. Today, the term flip-flop has come to mostly denote non-transparent (clocked or edge-triggered) devices, while the simpler transparent ones are often referred to as '''latches'''; however, as this distinction is quite new, the two words are sometimes used interchangeably.<br />
<br />
A flip-flop is usually controlled by one or two control signals and/or a gate or clock signal. The output often includes the complement as well as the normal output. As flip-flops are implemented electronically, they require power and ground connections.<br />
<br />
Flip-flops can be either simple (transparent) or clocked. Simple flip-flops can be built around a pair of cross-coupled inverting elements: vacuum tubes, bipolar transistors, field effect transistors, inverters, and inverting logic gates have all been used in practical circuits — perhaps augmented by some gating mechanism (an enable/disable input). The more advanced clocked (or non-transparent) devices are specially designed for synchronous (time-discrete) systems; such devices therefore ignores its inputs except at the transition of a dedicated clock signal (known as clocking, pulsing, or strobing). This causes the flip-flop to either change or retain its output signal based upon the values of the input signals at the transition. Some flip-flops change output on the rising edge of the clock, others on the falling edge.<br />
<br />
Our project simulates a SR Latch (Figure 11), the most fundamental latch, where S and R stand for set and reset. It can be constructed from a pair of cross-coupled NOR logic gates. The stored bit is present on the output marked Q (or the complement <span style="text-decoration:overline">Q</span>).<br />
<br />
<br />
[[Image:latchSR.jpg|thumb|350px|Figure 11. SR latch|center]]<br />
<br />
<br />
Normally, in storage mode, the S and R inputs are both low, and feedback maintains the Q and <span style="text-decoration:overline">Q</span> outputs in a constant state. If S (Set) is pulsed high while R is held low, then the Q output is forced high, and stays high when S returns low; similarly, if R (Reset) is pulsed high while S is held low, then the Q output is forced low, and stays low when R returns low (Figure 12).<br />
<br />
<br />
[[Image:tablatchSR.jpg|thumb|300px|Figure 12. SR latch truth table|center]]<br />
<br />
<br />
The R = S = 1 combination is called a restricted combination because, as both NOR gates then output zeros, it breaks the logical equation Q = not <span style="text-decoration:overline">Q</span>. The combination is also inappropriate in circuits where both inputs may go low simultaneously (i.e. a transition from restricted to keep). The output would lock at either 1 or 0 depending on the propagation time relations between the gates (a race condition). In certain implementations, it could also lead to longer ringings (damped oscillations) before the output settles, and thereby result in undetermined values (errors) in high-frequency digital circuits. This condition is therefore sometimes avoided.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
=UV Radiation: SOS system =<br />
<br />
Ultraviolet is that part of electromagnetic radiation bounded by the lower wavelength extreme of the visible spectrum and the upper end of the X-ray radiation band. The spectral range of ultraviolet radiation is, by definition, between 100 and 400 nm and is invisible to human eyes. The UV spectrum is subdivided into three bands: UV-A (long-wave) from 315 to 400 nm, UV-B (medium-wave) from 280 to 315 nm, UV-C (short-wave) from 100 to 280 nm. A strong germicidal effect is provided by the radiation in the short-wave UV-C band. <br />
<br><br />
[[Image:spettro.jpg|center]]<br />
<br><br><br />
[[Image:sopravvivenza.jpg|300px|thumbnail|Figure 13. E.Coli Survival curve|right]]<br />
[[Image:fosfoliasi.jpg|300px|thumbnail|Figure 14. After dimerization of two adjacent thymines blue light gives energy to photolyase to repair the damage |right]]<br />
The maximum UV germicidal effect coincides with the peak absorbance of DNA (near 260nm) due to the dimerization of two adjacent thymines. That can be seen in the Figure 13 where is showed the living population of bacteria after irradiation. <br />
E.Coli cells have a system that recovery DNA damage when it occurs. The best studied transcriptional response to DNA damage is the SOS response [Friedberg et al., 1995; Walker, 1996]. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
This systems can be divided into two class: the SOS Photoreactivation repair and the SOS respond triggered by RecA protein. The first uses the photolyase, a poorly expressed enzyme(encoded by genes phrA and phrB) which binds the pyrimidine dimers and uses the blue light to split them apart as showed in Figure 14.<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
Otherwise single stranded DNA produced by several DNA-damaging agents can be bound by RecA protein, resulting in conversion of this protein to its activated form. The RecA repair system doesn’t need light and Lexa protein controls the expression of 43 genes [Courcelle et al. (2001)] that cooperate together to repair the extensive genetic damage. RecA and LexA proteins play an important rule for the regulatory of SOS Recombination System. A LexA binding site is present in all the SOS promoters genes' and it works as a repressor of SOS system. In presence of DNA damage (DNA Single Strains) RecA becomes active and interacts with LexA protein , the repressor of the SOS genes [Wagner et al., 1999]. This interaction triggers the autocatalytic cleavage of LexA and consequent destruction of its ability to function as a repressor, which results in the derepression of SOS genes (Mustard and Little, 2000; Fernandez De Henestrosa et al., 2000). When the damage is repaired, DNA single strains are not present in the cell and the RecA protein no longer promotes the auto-cleavage of the LexA which is restored to its initial repression level.<br><br><br><br><br><br><br />
<br />
{| align=center<br />
|[[Image:soslexa.jpg]]<br />
|width=70|<br />
|[[Image:lexa.jpg]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= Bibliography =<br />
<br />
*Mads Kaern, William J.Blake, and J.J.Collins. The Engineering of Gene Regulatory Networks, Annu.Rev.Biomed.Eng.2003 5:179-206.<br />
*Timothy S.Gardner, Charles R.Cantor & James J.Collins. Construction of a genetic toggle switch in Escherichia coli, Nature Vol.403 339-342.<br />
*Nitzan Rosenfeld, Jonathan W.Young, Uri Alon, Peter S.Swain, Michael B.Elowitz. Gene Regulation at the Single-Cell Level. Science Vol 307 1962-1965.<br />
*Sergej V.Aksenov. Dynamics of the inducing signal for the SOS regulatory system in Escherichia coli after ultraviolet irradiation. Mathematical Bioscienses 157 (1999) 269-286.<br />
*Sandeep Krishna, Sergei Maslov, Kim Sneppen. UV-induced mutagenesis in Escherichia coli SOS response: A quantitative model. PLoS Comput Biol 3(3): e41. doi:10.1371/journal.pcbi.0030041.<br />
*S.V.Aksenov et al. Mathematical model of SOS response regulation of an excision repair deficient mutant of Escherichia coli after ultraviolet light irradiation. J.theor.Biol (1997)186, 251-260.<br />
*M.Sassanfar, J.W.Roberts. Nature of the SOS inducing signal in Escherichia coli: the involvement of DNA replication. J.Molec.Biol. 212 (1990) 79.<br />
*Mechanism of action of the lexA gene production. Prot.Nat.Acad.Sci.USA Vol.78, No 7, 4204-4208, 1981.<br />
*Fundamentals of Digital Logic by Brown and Vranesic<br />
*S.P.Vingron: `Switching Theory. Insight through Predicate Logic.' Springer Verlag, 2003. ISBN 3-540-40343-4 extensively covers the theory of latches<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2008-10-29T22:26:30Z<p>Francesca ceroni: /* Collaboration with other iGEM Teams 2008 */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Ecoli.PROM: an Erasable and Programmable Genetic Memory in ''E. coli''=<br />
<br />
[[Image:Circuito2.jpg|510px|right|thumbnail|Figure 1: Genetic circuit]]<br />
<br />
The specific goal of our project was to design a bacterial reprogrammable memory, i.e. colonies of genetically engineered ''E. coli'' immobilized in solid medium where they work as an array of binary memory cells.<br />
<br />
To engineer the bacteria we designed a modular genetic [[Team:Bologna/Modeling#SR_Latch|'''Flip-Flop''']] composed of two parts (Figure 1): a binary memory block and an induction block, sensitive to [[Team:Bologna/Modeling#Procedure_for__Ki-index_identification|'''UV radiation''']], to set LacI ON. UV has been chosen to have a fine spatial selectivity in programming the memory cells, whereas IPTG should be used to reset the entire memory (TetR ON). <br />
<br />
The core elements of the genetic memory are two mutually regulated promoters, each designed as indipendent operator sites flanking a constitutive promoter. In this way, the promoter transcriptional strength and the repressor binding affinity can be independently fixed. To this aim we designed operator libraries for LacI, TetR, Lambda and LexA repressors, cloning them in the BioBrick format for their standard assembly. This allowed us to design and assemble three different circuits, where the BBa_J23118 constitutive promoter was cloned with the Lac operator 1, the Lac operator 2 and the symmetric one from the Lac operator library. Moreover, LacI was cloned downstream of the promoter- operator sequence and the GFP was chosen as the reporter. Thus, promoter activation was under the control of the LacI repressor, and each of the circuits was expected to yield a specific promoter repression/activation profile depending on the characteristic operator- repressor binding affinity. The [[Team:Bologna/Modeling#Model-based_analysis_of_the_genetic_Flip-Flop|'''model-based analysis''']] of the circuit response was used for the [[Team:Bologna/Modeling#Procedure_for_Ki-index_identification|'''Ki transcription index''']] determination and the design of the desired promoter/ operator couple needed to achieve bistability. <br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
= Results =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
= Conclusions =<br />
<br />
This will allow the rational design of regulated promoter elements that are still lacking in the Registry.<br />
<br />
This approach has been applied in the building of our UV-programmable memory, and we expect it to be a general benefit in a larger number of applications in Synthetic Biology.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
=Collaboration with other iGEM2008 Teams =<br />
<br />
* After the last year competition, at the beginning of the 2008, we decided to get a new team started for iGEM2008 competition. In April, we got in contact with Prof. Paolo Magni, who wanted to start a new team in [[Team:UNIPV-Pavia|Pavia]] for iGEM2008. So, in order to share experiences and ideas about iGEM, and to show him what kind of wet lab resources are necessary to develop a Synthetic Biology project, we met at the Cellular and Molecular Engineering Laboratory of the University of Bologna- Cesena Campus. After this first meeting, there have been other chances to meet during the summer. In particular, several conference calls were organized and two meetings were scheduled in Pisa and Bressanone (Italy). It was fundamental to compare lab protocols and techniques to help each other avoiding mistakes and speeding up project progress. The main topics of our discussion were the optimization of plasmid resuspension and ligation reaction steps as well as how to measure fluorescence. Finally, before DNA Repository quality control publication on the Registry web site, we cross-checked some parts that showed problems after DNA transformation. Problems had been confirmed by quality control results (parts' sequences classified as "inconsistent"). <br />
* We want even to mention the courtesy of the [[Team:Valencia|Valencia]] iGEM Team, that have advised us about the critical use of GFP and RFP at the same time.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
= Concluding the iGEM 2007 Project =<br />
<br />
In the iGEM 2007 we used the LacY gene (BBa_J2210) to design a genetic Schmitt trigger. Since this part was not working well, we sent it to be sequenced and found that it contained a 35 bp insertion upstream the endogenous LacY gene sequence. This insertion probably caused a frameshift in protein translation, making the gene ineffective. So, we amplified the right gene sequence and put it in the BioBrick format. Successive sequencing confirmed the right assembling of this part. We also measured IPTG-induced fluorescence in the genetic Schmitt trigger (see Figure) and we assessed the correct function of the new LacY part. To contribute to Registry’s improvement we decided to send this new part to the Registry ([http://partsregistry.org/Part:BBa_K079015 K0790015]).<br />
<br />
[[Image:Progetto.jpg|center|thumbnail|500 px|Schematic representation of the genetic Schmitt Trigger. The LacI generator module was included to have a constitutive synthesis of LacI repressor protein witch makes up for endogenous LacI. LacY permease introduces a positive feedback. GFP is the reporter for pLac activation. This circuit express high level of fluorescence with very low concentration of inducer (IPTG=1uM). After switching, the fluorescence level f is insensitive to an increase in inducer dosage.]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T22:23:31Z<p>Francesca ceroni: /* At last... Operator sites as BioBricks! */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
<br />
=Introduction=<br />
[[Image:Collage2.jpg|700px|right]]<br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and peroxidase).<br />
<br />
<br><br><br><br />
<br />
=At last... Operator sites as BioBricks!=<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 LacI], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079046 TetR], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079047 cI] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079048 LexA] repressor proteins ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 see details]). In each library, there are three sequences (see Table below) each with a different repressor binding affinity to the repressor protein. Since the libraries were synthetized on pGA18 and pMA Geneart vectors, we isolated each operator with the intention to clone them into BioBrick standard assembly plasmids. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
<br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">LacI</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079017 Lac SymL] <br />
| aattgtgagcgctcacaatt<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079018 Lac O1] <br />
| aattgtgagcggataacaatt<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079019 Lac O2] <br />
| aaatgtgagcgagtaacaacc<br />
| Weak<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Tet</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079036 TeT O] <br />
| cctatcagtgataga<br />
| Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079037 TetO-4C] <br />
| cctgtcagtgacaga<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079038 TetO-wt/4C5G] <br />
| cctatcagtgacgga<br />
| Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lambda</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=80| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079041 Lambda OR1] <br />
| tatcaccgccagaggta<br />
| Strong/Intermediate cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079042 Lambda OR2] <br />
| taacaccgtgcgtgttg<br />
| Intermediate/Weak cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079043 Lambda OR3] <br />
| tatcaccgcaagggata<br />
| Intermediate/Intermediate cI/Cro<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lex</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079039 LexA 1] <br />
| atatatatatattcgcgctcgata<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079040 LexA 2] <br />
| ctgtatgagcatacag<br />
| Quite Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br />
<br />
<br />
<br />
<br><br><br><br />
Single operators or a combination of them, can be also assembled upstream or downstream with respect to a constitutive promoter. In fact, it is known (Cox et al, 2007) that the position of an operator site plays a crucial role in determining repression effects (i. e. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041 lambda operators]). In particular, the same operator located upstream of the promoter -35 sequence functions as a weaker repressor than one located downstream of the -10 consensus sequence.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Operator site cloning in standard plasmids =<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing custom vector into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. In this vector, a RFP gene was cloned, as a reporter, between the SpeI and PstI restriction sites. Thus, this is the only part in the Registry that can be separated from a plasmid with a S/P digestion. <br />
<br />
Therefore, once the RFP is isolated with S/P, it could be assembled with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set ON the memory is induced by an [https://2008.igem.org/Team:Bologna/Modeling#The_genetic_Flip-Flop UV-sensitive trigger ]. Production of LacI molecules by UV induction can be tested by replacing the LacI gene with GFP in the UV trigger, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br> We realized two new constructs( K079049 and K079050) to test the UV induction. We used two different promoters(J23118 with 1429 strength and J23100 with 2547 strength). These UV test circuits are presented schematically in Figure 1-2.<br />
<br />
[[Image:fig050.jpg|center|thumbnail|388 px| Figure 1: K079050 Molecular circuit]]<br />
[[Image:fig049.jpg|center|thumbnail|388 px| Figure 2: K079049 Molecular circuit]]<br />
<br><br />
To test the UV induction we used the [https://2008.igem.org/Team:Bologna/Wetlab#Homemade_UV_Illuminator UV illuminator].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the K079049 and K079050 constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube).<br><br />
The 1ml volume was used ti have a layer of medium enough ehin to perform an uniform irradiation.<br><br />
<br />
Tests with difference distances from the lamp (3 and 4 cm) with different exposition times (1, 10 and 15 s) were done. Minimum distance and maximum time were fixed to avoid lethal UV dose and mutagenesis.<br><br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes, the supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition that were elaborated with the [https://2008.igem.org/Team:Bologna/Software#Visual_Fluo_Bacteria:_a_software_for_the_analysis_of_fluorescence_bacteria_image Visual Fluo Bacteria Software]. <br><br />
OD was not altered by UV irradiation but we didn't observe GFP. Probably we were not able to find the right time/distance setting. MOreover we are not sure that an uniform irradiation takes place.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|352 px|Figure 1. BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|352 px|Figure 2. BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br><br />
BBa_K079020 and BBa_K079026 were transformed in HL1Blue bacterial cells according to the standard protocol. One colony from each plate was picked up and let grow overnight in LB medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 6000-8000 rpm for three minutes. The supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition. For each slide five different view were a acquired. Finally, images were elaborated with the Visual Fluo Bacteria Software. Examples of fluorescence bacteria image are shown in fig. The fluorescence images reveal the repression due to the presence of the Lac operator. <br />
<br />
{|align="center"<br />
|[[Image:bact1.jpg|thumbnail|350 px|Figure 3a. Closed Loop Genetic Circuit Fluorescence view]]<br />
|[[Image:bact2.jpg|thumbnail|350 px|Figure 3b. Open Loop Genetic Circuit Fluorescence view]]<br />
|}<br />
<br><br />
Analysis about the fluorescence distribution is shown in Fig.4 : a matlab boxplot was performed to compare Gaussian distribution between closed and open loop. <br />
[[Image:Box.jpg|thumbnail|center|500 px|Figure 4. Box Plot data distribution]]<br />
<br><br />
Results of fluorescence bacteria analysis by software are reported in tab .The open loop and closed loop circuit fluorescence mean ratio (h factor) can be estimated using the results coming from the Visual Fluo Bacteria Software elaboration for the two circuit views (Fig.3a – Fig.3b).<br />
[[Image:H1.jpg|center]]<br />
[[Image:tab1.jpg|center]]<br />
Finally, a T-Test was performed on data distributions. The probability that open loop and closed loop distribution could be equal is less than 0.001%.<br><br />
So, it is possible to compute<br><br />
[[Image:h2.jpg|center]]<br />
<br />
and h can be used to obtain the value of Ki-index with model equations.<br><br />
With this parameter , from the Figure 6 (see modeling section 1.5), is possible to estimate Ki-index and it results equal to 4.43. From Figure 4 (see modeling section 1.4) can be chosen the proper value for Kr in order to obtain the bi-stable system.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|safely]] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to part of the light, absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix( Figure 6 ) the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part( Figure 7 )<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T22:21:07Z<p>Francesca ceroni: /* At last... Operator sites as BioBricks! */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
<br />
=Introduction=<br />
[[Image:Collage2.jpg|700px|right]]<br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and peroxidase).<br />
<br />
<br><br><br><br />
<br />
=At last... Operator sites as BioBricks!=<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 LacI], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079046 TetR], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079047 cI] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079048 LexA] repressor proteins ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 see details]). In each library, there are three sequences (see Table below) each with a different repressor binding affinity to the repressor protein. Since the libraries were synthetized on pGA18 and pMA Geneart vectors, we isolated each operator with the intention to clone them into BioBrick standard assembly plasmids. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
<br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">LacI</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079017 Lac SymL] <br />
| aattgtgagcgctcacaatt<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079018 Lac O1] <br />
| aattgtgagcggataacaatt<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079019 Lac O2] <br />
| aaatgtgagcgagtaacaacc<br />
| Weak<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Tet</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079036 TeT O] <br />
| cctatcagtgataga<br />
| Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079037 TetO-4C] <br />
| cctgtcagtgacaga<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079038 TetO-wt/4C5G] <br />
| cctatcagtgacgga<br />
| Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lambda</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=80| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079041 Lambda OR1] <br />
| tatcaccgccagaggta<br />
| Strong/Intermediate cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079042 Lambda OR2] <br />
| taacaccgtgcgtgttg<br />
| Intermediate/Weak cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079043 Lambda OR3] <br />
| tatcaccgcaagggata<br />
| Intermediate/Intermediate cI/Cro<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lex</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079039 LexA 1] <br />
| atatatatatattcgcgctcgata<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079040 LexA 2] <br />
| ctgtatgagcatacag<br />
| Quite Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br />
<br />
<br />
<br />
<br><br><br><br />
Single operators or a combination of them, can be also assembled upstream or downstream with respect to a constitutive promoter. In fact, it is known (Cox et al, 2007) that the position of an operator site plays a crucial role in determining repression effects (i. e. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041 lambda operators]). In particular, an operator located upstream of the promoter -35 sequence functions as a weaker repressor than one located downstream of the -10 consensus sequence.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Operator site cloning in standard plasmids =<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing custom vector into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. In this vector, a RFP gene was cloned, as a reporter, between the SpeI and PstI restriction sites. Thus, this is the only part in the Registry that can be separated from a plasmid with a S/P digestion. <br />
<br />
Therefore, once the RFP is isolated with S/P, it could be assembled with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set ON the memory is induced by an [https://2008.igem.org/Team:Bologna/Modeling#The_genetic_Flip-Flop UV-sensitive trigger ]. Production of LacI molecules by UV induction can be tested by replacing the LacI gene with GFP in the UV trigger, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br> We realized two new constructs( K079049 and K079050) to test the UV induction. We used two different promoters(J23118 with 1429 strength and J23100 with 2547 strength). These UV test circuits are presented schematically in Figure 1-2.<br />
<br />
[[Image:fig050.jpg|center|thumbnail|388 px| Figure 1: K079050 Molecular circuit]]<br />
[[Image:fig049.jpg|center|thumbnail|388 px| Figure 2: K079049 Molecular circuit]]<br />
<br><br />
To test the UV induction we used the [https://2008.igem.org/Team:Bologna/Wetlab#Homemade_UV_Illuminator UV illuminator].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the K079049 and K079050 constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube).<br><br />
The 1ml volume was used ti have a layer of medium enough ehin to perform an uniform irradiation.<br><br />
<br />
Tests with difference distances from the lamp (3 and 4 cm) with different exposition times (1, 10 and 15 s) were done. Minimum distance and maximum time were fixed to avoid lethal UV dose and mutagenesis.<br><br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes, the supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition that were elaborated with the [https://2008.igem.org/Team:Bologna/Software#Visual_Fluo_Bacteria:_a_software_for_the_analysis_of_fluorescence_bacteria_image Visual Fluo Bacteria Software]. <br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|352 px|Figure 1. BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|352 px|Figure 2. BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br><br />
BBa_K079020 and BBa_K079026 were transformed in HL1Blue bacterial cells according to the standard protocol. One colony from each plate was picked up and let grow overnight in LB medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 6000-8000 rpm for three minutes. The supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition. For each slide five different view were a acquired. Finally, images were elaborated with the Visual Fluo Bacteria Software. Examples of fluorescence bacteria image are shown in fig. The fluorescence images reveal the repression due to the presence of the Lac operator. <br />
<br />
{|align="center"<br />
|[[Image:bact1.jpg|thumbnail|350 px|Figure 3a. Closed Loop Genetic Circuit Fluorescence view]]<br />
|[[Image:bact2.jpg|thumbnail|350 px|Figure 3b. Open Loop Genetic Circuit Fluorescence view]]<br />
|}<br />
<br><br />
Analysis about the fluorescence distribution is shown in Fig.4 : a matlab boxplot was performed to compare Gaussian distribution between closed and open loop. <br />
[[Image:Box.jpg|thumbnail|center|500 px|Figure 4. Box Plot data distribution]]<br />
<br><br />
Results of fluorescence bacteria analysis by software are reported in tab .The open loop and closed loop circuit fluorescence mean ratio (h factor) can be estimated using the results coming from the Visual Fluo Bacteria Software elaboration for the two circuit views (Fig.3a – Fig.3b).<br />
[[Image:H1.jpg|center]]<br />
[[Image:tab1.jpg|center]]<br />
Finally, a T-Test was performed on data distributions. The probability that open loop and closed loop distribution could be equal is less than 0.001%.<br><br />
So, it is possible to compute<br><br />
[[Image:h2.jpg|center]]<br />
<br />
and h can be used to obtain the value of Ki-index with model equations.<br><br />
With this parameter , from the Figure 6 (see modeling section 1.5), is possible to estimate Ki-index and it results equal to 4.43. From Figure 4 (see modeling section 1.4) can be chosen the proper value for Kr in order to obtain the bi-stable system.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|safely]] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to part of the light, absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix( Figure 6 ) the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part( Figure 7 )<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T22:19:05Z<p>Francesca ceroni: /* At last... Operator sites as BioBricks! */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
<br />
=Introduction=<br />
[[Image:Collage2.jpg|700px|right]]<br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and peroxidase).<br />
<br />
<br><br><br><br />
<br />
=At last... Operator sites as BioBricks!=<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 LacI], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079046 TetR], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079047 cI] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079048 LexA] repressor proteins ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 see details]). In each library, there are three sequences (see Table below) each with a different repressor binding affinity to the repressor protein. Since the libraries were synthetized on pGA18 and pMA Geneart vectors, we isolated each operator with the intention to clone them into BioBrick standard assembly plasmids. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
<br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">LacI</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079017 Lac SymL] <br />
| aattgtgagcgctcacaatt<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079018 Lac O1] <br />
| aattgtgagcggataacaatt<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079019 Lac O2] <br />
| aaatgtgagcgagtaacaacc<br />
| Weak<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Tet</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079036 TeT O] <br />
| cctatcagtgataga<br />
| Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079037 TetO-4C] <br />
| cctgtcagtgacaga<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079038 TetO-wt/4C5G] <br />
| cctatcagtgacgga<br />
| Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lambda</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=80| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079041 Lambda OR1] <br />
| tatcaccgccagaggta<br />
| Strong/Intermediate cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079042 Lambda OR2] <br />
| taacaccgtgcgtgttg<br />
| Intermediate/Weak cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079043 Lambda OR3] <br />
| tatcaccgcaagggata<br />
| Intermediate/Intermediate cI/Cro<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lex</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079039 LexA 1] <br />
| atatatatatattcgcgctcgata<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079040 LexA 2] <br />
| ctgtatgagcatacag<br />
| Quite Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br />
<br />
<br />
<br />
<br><br><br><br />
Single operators or a combination of them, can be also assembled upstream or downstream with respect to a constitutive promoter. Since, it is known (Cox et al, 2007) that the position of an operator site plays a crucial role in determining repression effects (i. e. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041 lambda operators]).<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Operator site cloning in standard plasmids =<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing custom vector into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. In this vector, a RFP gene was cloned, as a reporter, between the SpeI and PstI restriction sites. Thus, this is the only part in the Registry that can be separated from a plasmid with a S/P digestion. <br />
<br />
Therefore, once the RFP is isolated with S/P, it could be assembled with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set ON the memory is induced by an [https://2008.igem.org/Team:Bologna/Modeling#The_genetic_Flip-Flop UV-sensitive trigger ]. Production of LacI molecules by UV induction can be tested by replacing the LacI gene with GFP in the UV trigger, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br> We realized two new constructs( K079049 and K079050) to test the UV induction. We used two different promoters(J23118 with 1429 strength and J23100 with 2547 strength). These UV test circuits are presented schematically in Figure 1-2.<br />
<br />
[[Image:fig050.jpg|center|thumbnail|388 px| Figure 1: K079050 Molecular circuit]]<br />
[[Image:fig049.jpg|center|thumbnail|388 px| Figure 2: K079049 Molecular circuit]]<br />
<br><br />
To test the UV induction we used the [https://2008.igem.org/Team:Bologna/Wetlab#Homemade_UV_Illuminator UV illuminator].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the K079049 and K079050 constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube).<br><br />
The 1ml volume was used ti have a layer of medium enough ehin to perform an uniform irradiation.<br><br />
<br />
Tests with difference distances from the lamp (3 and 4 cm) with different exposition times (1, 10 and 15 s) were done. Minimum distance and maximum time were fixed to avoid lethal UV dose and mutagenesis.<br><br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes, the supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition that were elaborated with the Visual Fluo Bacteria Software . <br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|352 px|Figure 1. BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|352 px|Figure 2. BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br><br />
BBa_K079020 and BBa_K079026 were transformed in HL1Blue bacterial cells according to the standard protocol. One colony from each plate was picked up and let grow overnight in LB medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 6000-8000 rpm for three minutes. The supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition. For each slide five different view were a acquired. Finally, images were elaborated with the Visual Fluo Bacteria Software. Examples of fluorescence bacteria image are shown in fig. The fluorescence images reveal the repression due to the presence of the Lac operator. <br />
<br />
{|align="center"<br />
|[[Image:bact1.jpg|thumbnail|350 px|Figure 3a. Closed Loop Genetic Circuit Fluorescence view]]<br />
|[[Image:bact2.jpg|thumbnail|350 px|Figure 3b. Open Loop Genetic Circuit Fluorescence view]]<br />
|}<br />
<br><br />
Analysis about the fluorescence distribution is shown in Fig.4 : a matlab boxplot was performed to compare Gaussian distribution between closed and open loop. <br />
[[Image:Box.jpg|thumbnail|center|500 px|Figure 4. Box Plot data distribution]]<br />
<br><br />
Results of fluorescence bacteria analysis by software are reported in tab .The open loop and closed loop circuit fluorescence mean ratio (h factor) can be estimated using the results coming from the Visual Fluo Bacteria Software elaboration for the two circuit views (Fig.3a – Fig.3b).<br />
[[Image:H1.jpg|center]]<br />
[[Image:tab1.jpg|center]]<br />
Finally, a T-Test was performed on data distributions. The probability that open loop and closed loop distribution could be equal is less than 0.001%.<br><br />
So, it is possible to compute<br><br />
[[Image:h2.jpg|center]]<br />
<br />
and h can be used to obtain the value of Ki-index with model equations.<br><br />
With this parameter , from the Figure 6 (see modeling section 1.5), is possible to estimate Ki-index and it results equal to 4.43. From Figure 4 (see modeling section 1.4) can be chosen the proper value for Kr in order to obtain the bi-stable system.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|safely]] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to part of the light, absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix( Figure 6 ) the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part( Figure 7 )<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T22:17:21Z<p>Francesca ceroni: /* Introduction */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
<br />
=Introduction=<br />
[[Image:Collage2.jpg|700px|right]]<br />
To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and peroxidase).<br />
<br />
<br><br><br><br />
<br />
=At last... Operator sites as BioBricks!=<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 LacI], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079046 TetR], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079047 cI] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079048 LexA] repressor proteins ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K079045 see details]). In each library, there are three sequences (see Table below) each with a different repressor binding affinity to the repressor protein. Since the libraries were synthetized on pGA18 and pMA Geneart vectors, we isolated each operator with the intention to clone them into BioBrick standard assembly plasmids. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
<br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">LacI</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079017 Lac SymL] <br />
| aattgtgagcgctcacaatt<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079018 Lac O1] <br />
| aattgtgagcggataacaatt<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079019 Lac O2] <br />
| aaatgtgagcgagtaacaacc<br />
| Weak<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Tet</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079036 TeT O] <br />
| cctatcagtgataga<br />
| Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079037 TetO-4C] <br />
| cctgtcagtgacaga<br />
| Intermediate<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079038 TetO-wt/4C5G] <br />
| cctatcagtgacgga<br />
| Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
{| align="left"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lambda</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=80| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079041 Lambda OR1] <br />
| tatcaccgccagaggta<br />
| Strong/Intermediate cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079042 Lambda OR2] <br />
| taacaccgtgcgtgttg<br />
| Intermediate/Weak cI/Cro<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079043 Lambda OR3] <br />
| tatcaccgcaagggata<br />
| Intermediate/Intermediate cI/Cro<br />
|}<br />
<br />
{| align="right"<br />
|- style="background: #c09a6d; text-align: center;"<br />
|colspan=3| <font size="+1">Lex</font><br />
|- style="background: #c09a6d; text-align: center;"<br />
|width=120| '''Name'''<br />
|width=220| '''Sequence'''<br />
|width=90| '''Affinity'''<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079039 LexA 1] <br />
| atatatatatattcgcgctcgata<br />
| Very Strong<br />
|- style="background:#f6efcd; color:black"<br />
| [http://partsregistry.org/Part:BBa_K079040 LexA 2] <br />
| ctgtatgagcatacag<br />
| Quite Weak<br />
|}<br />
<br />
<br><br><br><br><br><br><br><br />
<br />
<br />
<br />
<br><br><br><br />
Single operators or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al, 2007) that the position of an operator site plays a crucial role in determining repression effects (i. e. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041 lambda operators]).<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Operator site cloning in standard plasmids =<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing custom vector into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. In this vector, a RFP gene was cloned, as a reporter, between the SpeI and PstI restriction sites. Thus, this is the only part in the Registry that can be separated from a plasmid with a S/P digestion. <br />
<br />
Therefore, once the RFP is isolated with S/P, it could be assembled with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set ON the memory is induced by an [https://2008.igem.org/Team:Bologna/Modeling#The_genetic_Flip-Flop UV-sensitive trigger ]. Production of LacI molecules by UV induction can be tested by replacing the LacI gene with GFP in the UV trigger, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br> We realized two new constructs( K079049 and K079050) to test the UV induction. We used two different promoters(J23118 with 1429 strength and J23100 with 2547 strength). These UV test circuits are presented schematically in Figure 1-2.<br />
<br />
[[Image:fig050.jpg|center|thumbnail|388 px| Figure 1: K079050 Molecular circuit]]<br />
[[Image:fig049.jpg|center|thumbnail|388 px| Figure 2: K079049 Molecular circuit]]<br />
<br><br />
To test the UV induction we used the [https://2008.igem.org/Team:Bologna/Wetlab#Homemade_UV_Illuminator UV illuminator].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|352 px|Figure 1. BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|352 px|Figure 2. BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br><br />
BBa_K079020 and BBa_K079026 were transformed in HL1Blue bacterial cells according to the standard protocol. One colony from each plate was picked up and let grow overnight in LB medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 6000-8000 rpm for three minutes. The supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition. For each slide five different view were a acquired. Finally, images were elaborated with the Visual Fluo Bacteria Software. Examples of fluorescence bacteria image are shown in fig. The fluorescence images reveal the repression due to the presence of the Lac operator. <br />
<br />
{|align="center"<br />
|[[Image:bact1.jpg|thumbnail|350 px|Figure 3a. Closed Loop Genetic Circuit Fluorescence view]]<br />
|[[Image:bact2.jpg|thumbnail|350 px|Figure 3b. Open Loop Genetic Circuit Fluorescence view]]<br />
|}<br />
<br><br />
Analysis about the fluorescence distribution is shown in Fig.4 : a matlab boxplot was performed to compare Gaussian distribution between closed and open loop. <br />
[[Image:Box.jpg|thumbnail|center|500 px|Figure 4. Box Plot data distribution]]<br />
<br><br />
Results of fluorescence bacteria analysis by software are reported in tab .The open loop and closed loop circuit fluorescence mean ratio (h factor) can be estimated using the results coming from the Visual Fluo Bacteria Software elaboration for the two circuit views (Fig.3a – Fig.3b).<br />
[[Image:H1.jpg|center]]<br />
[[Image:tab1.jpg|center]]<br />
Finally, a T-Test was performed on data distributions. The probability that open loop and closed loop distribution could be equal is less than 0.001%.<br><br />
So, it is possible to compute<br><br />
[[Image:h2.jpg|center]]<br />
<br />
and h can be used to obtain the value of Ki-index with model equations.<br><br />
With this parameter , from the Figure 6 (see modeling section 1.5), is possible to estimate Ki-index and it results equal to 4.43. From Figure 4 (see modeling section 1.4) can be chosen the proper value for Kr in order to obtain the bi-stable system.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|safely]] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to part of the light, absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix( Figure 6 ) the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part( Figure 7 )<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:19:39Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library, there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects (i. e. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041 lambda operators]).<br />
<br />
<br />
'''Operator site cloning in standard plasmids'''<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|500 px|Figure 1. BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|500 px|Figure 2. BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:16:07Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library, there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects (i. e. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041 lambda operators].<br />
<br />
<br />
'''Operator site cloning in standard plasmids'''<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|500 px|Figure 1:BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|520 px|Figure 2BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:14:07Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library, there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects.<br />
<br />
<br />
'''Operator site cloning in standard plasmids'''<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|500 px|Figure 1:BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba026.jpg|center|thumbnail|500 px|Figure 2BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:12:52Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library, there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects.<br />
<br />
<br />
Operator site cloning in standard plasmids<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Experimental Evaluation of Lac Operator Site effect on promoter activation =<br />
According with the theoretical protocol (procedure for K_index identification) to test operator parts, four circuits were assembled (Fig.1). <br><br />
BBa_K079020 is a closed loop where GFP expression is auto regulated by the LacI repressor which binds to the Lac operator site. BBa_K079026 (Fig.2) is open-loop circuit lacking the operator site to determinate the maximum fluorescence. In this construct, GFP was spaced from the promoter inserting a LacI gene sequence, to consider abortive transcriptions.<br />
[[Image:bba020.jpg|center|thumbnail|500 px|Figure 1:BBa_K079020: LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 2 operator]]<br />
[[Image:bba020.jpg|center|thumbnail|500 px|Figure 2BBa_K079026: LacI repressor under the control of the J23118 constitutive promoter and Lac2 operator]]<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:12:09Z<p>Francesca ceroni: /* Gel matrix */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library, there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:11:36Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library, there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be also assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T17:02:14Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design has been done in the iGEM 2007 with the inclusion in the Registry of a family of constitutive promoters. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequence, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center|thumbnail|500 px| Figure 1: BBa_K079050]]<br />
<br><br />
[[Image:fig049.jpg|center|thumbnail|500 px| Figure 1: BBa_K079049]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T16:40:42Z<p>Francesca ceroni: /* LAB Experiment */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
=Operator site library standardization =<br />
<br />
<br><br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option for the “BioBricklayers” is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of such modular parts as unregulated promoter and operator could permit the rapid design of promoter with prefixed regulation characteristic. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen. <br />
<br />
A first step in the rationalization of promoter design has been done in the iGEM 2007 with the inclusion in the Registry of a family of constitutive promoters. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequence, respectively for LacI, TetR, cI and LexA repressor proteins (link figura). In each library there are three sequences (see Table 1) (link) each with a different repressor binding affinity (link Registry) to the repressor protein. Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength. <br />
<br />
Single operator or a combination of them, can be assembled upstream or downstream with respect to constitutive promoter. It is known (Cox et al) that the position of an operator site plays a crucial role in determining repression effects.<br />
<br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center]]<br />
<br><br />
[[Image:fig049.jpg|center]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T16:35:51Z<p>Francesca ceroni: /* Gel matrix */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
=LAB Experiment =<br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
<br><br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center]]<br />
<br><br />
[[Image:fig049.jpg|center]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center|thumbnail| 500 px| Figure 1 BBa_K079029]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 Registry]. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/File:PromotoriBerkley.jpgFile:PromotoriBerkley.jpg2008-10-29T16:34:04Z<p>Francesca ceroni: </p>
<hr />
<div></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T16:32:38Z<p>Francesca ceroni: /* Gel matrix */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
=LAB Experiment =<br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
<br><br />
= Uv Sensitive Trigger =<br />
<br />
In the genetic flip-flop, the amount of LacI to set on the memory is induced by an UV sensitive trigger. Production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new constructs submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequences with different promoter (J23118 with 1429 strength and J23100 with 2547 strength).<br />
<br />
[[Image:fig050.jpg|center]]<br />
<br><br />
[[Image:fig049.jpg|center]]<br />
<br><br />
To test the UV induction we used the UV illuminator.<br />
<br />
= UV Induction =<br />
<br />
Plasmids with the constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube), in order to be induced. <br />
Using 1ml of culture is a choice done in order to have a thickness as thick as possible to perform an irradiation as uniform as possible .<br />
<br />
Tests with difference distances from the lamp with different exposition times were done to respect the maximum lethal UV dose of bacteria and avoid mutagenesis factors in the E. coli bacteria cells.<br />
The following table illustrates the test setup used and OD after one hour:<br />
<br />
[[Image:tabuv.jpg|center]]<br />
<br />
After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD samples was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes and the supernatant was discard and the pellet resuspended for the slide preparation in order to acquire and elaborate the bacterial fluorescence view by microscope and Bacteria Visual Fluo Software.<br />
<br />
Unfortunately, using 15ml tube and maybe the not the correct time/distance induction, the experimental tests didn’t shown GFP expression. It could be depended because of not uniform irradiation of the sample. In the Fig. is possible to see a picture of leak answer by bacteria stimulated by UV at the distance of 4cm using less than one second time as exposure.<br />
<br />
[[Image:colonia1.jpg|400px|thumbnail|Fig.3|center]]<br />
<br />
= Hydrogen Peroxide Induction =<br />
<br />
[[Image:schema.jpg|right]]<br />
The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA. Escherichia Coli cells are able to deal with these adverse events via DNA repair mechanisms or OxyR and SosRS anti-oxidant inducible pathways which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide.<br />
Among the systems the OxyR gene interacts with, there is the SOS response.<br><br><br />
Since we have not success with UV induction, to test the correct functionality of K079049 and K079050 constructs, they were induced by peroxide hydrogen. Low concentration of (1-3mM) results in SOS gene induction in wild-type cells [Imlay and Linn, 1987; Goerlich et alt. 1989].<br />
<br />
The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB broth and ampicillin. Cultured colony was diluted in 5ml LB broth with ampicillin and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.<br />
Testing BBa_K079050 construct, two negative controls were used to prove that H202 induction works correctly and that can be used in flip-flop without interferences between Lac Operon and SOS System:<br><br />
<br />
* BBa_K079050 grown in LB medium without H202 <br><br />
* BBa_K079029 grown in LB medium with H202 (Fig. )<br />
<br />
[[Image:immag2.jpg|center]]<br />
<br />
Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was thrown away and the pellet resuspended for the slide preparation. <br />
<br />
[[Image:immag3.jpg|center]]<br />
<br />
In addition to prove that K079050 construct can be used in the flip-flop circuit without interference between Lac Operon and SOS System a test IPTG and H202 of two previously constructs were done. Fig. shows the results.<br />
[[Image:immag4.jpg|center]]<br />
<br />
As expected the construct with Lex A operator induced by IPTG and Lac-Operon-based-circuit induced by H2O2 didn’t produced GFP synthesis, instead the other two sample correctly induced presented good level of fluorescence.<br />
<br />
We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set on the memory.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 4 )<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean( Figure 5 ).<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. <br />
Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform<br />
So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the Registry. As it can be seen in figure below, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
[[Image:PromotoriBerkley.jpg |center|thumbnail|300px]]<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/NotebookTeam:Bologna/Notebook2008-10-29T15:20:40Z<p>Francesca ceroni: /* Week 15: from 10/27/08 to 10/29/08 */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=Notes=<br />
[[Image:agenda.jpg|right]]<br />
<br><br><br />
Here's all our lab work: week by week you can find all the procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 1: from 07/21/08 to 07/27/08 =<br />
'''General Preparations'''<br />
<br />
#Preparation of chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1 <br />
# Preparation of antibiotic stocks for Ampicillin and Kanamicin <br />
# Preparation of LB medium and LB plates for cloning.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 2: from 07/28/08 to 08/03/08 =<br />
<br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_R0082 R0082], [http://partsregistry.org/Part:BBa_R0083 R0083], [http://partsregistry.org/wiki/index.php/Part:BBa_M30109 M30109] in TOP10 strain to build and characterize the Light response system to be our spatial selective trigger. <br><br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_E0240 E0240], [http://partsregistry.org/Part:BBa_P1010 pSB3K3_P1010]in DB3.1 and the Practice Promoter Set ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J23103/ J23150, J23151, J23102]) to test and set up the new [http://partsregistry.org/Measurement Biobrick Standard Measurement Protocol]<br />
<br />
* Transformation and Amplification from our Lab Stock of [http://partsregistry.org/Part:BBa_S0100 S0100], BBa_I763020, [http://partsregistry.org/wiki/index.php?title=Part:BBa_I763005 I763005] and [http://partsregistry.org/Part:BBa_C0051 C0051]<br />
<br />
* '''Growth Curves of Dh5 Alpha, Top10 and XL1 Blue with Low Medium and High Copy Numbers to assay and define the different kinetics (Further Detail)'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 3: from 08/04/08 to 08/10/08 =<br />
<br />
'''08/04/08'''<br />
<br />
* Digestion and Control Gel Run of the previous amplified constructs :<br />
<br />
1.'''[http://partsregistry.org/Part:BBa_S0100 S0100] E/S''' <br><br />
Consistent Part Length <br><br />
2. '''PLAC-CI X/P''' <br><br />
Consistent Part Length <br><br />
3. '''R0083 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
4. '''R0082 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
5. '''C0051 X/P''' <br><br />
Consistent Part Length.<br><br />
7. '''M30105 E/S''' <br><br />
'''The Part appears not consistent'''. The Gel has unexpected multiple bands.<br><br />
8. '''RBS GFP TAG X/P''' <br> <br />
Consistent Part Length <br><br />
9.'''Pλ GFP X/P''' <br><br />
Consistent Part Length. <br><br />
<br />
* Ligation of R0082 and R0083 with E0240 to obtain a Reporter for the Light Driven Trigger.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 4: from 08/11/08 to 08/17/08 =<br />
'''HOLIDAY'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 5: from 08/18/08 to 08/24/08 =<br />
Starts the protein construct cloning<br />
<br />
#Ligations: [http://partsregistry.org/Part:BBa_I763020 I763020] + [http://partsregistry.org/Part:BBa_B0015 B0015], [http://partsregistry.org/Part:BBa_S0100 S0100] + [http://partsregistry.org/Part:BBa_B0015 B0015], TETR + [http://partsregistry.org/Part:BBa_B0015 B0015] <br />
# Trasformation of the ligations in E.coli<br />
#Inoculation and miniprep preparation <br />
#Enzymatic digestion and construct gel run: GFP T x\p, S0100 T x\p, TETR T x\p<br />
#Gel extraction of the parts<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 6: from 08/25/08 to 08/31/08 =<br />
<br />
#Ligations: B0034 + TetR T , B0034 + GFP T<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of the constructs: RBS TETR T x\p, RBS GFP T x\p<br />
#Gel extraction of the parts<br />
#Ligations: RBS GFP T + S0100, RBS GFP T + RBS TetR <br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of: RBS TETR RBS GFP T x\p, S0100 RBS GFP T x\p<br />
#Gel extraction<br />
<br />
* Final cloning step:<br />
<br />
#Ligations: promotor J23118 + RBS GFP T, promotor J23105 + RBS GFP T, promotor J23100 + RBS GFP T<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run of: [http://partsregistry.org/Part:BBa_K079031 J23118 RBS GFP T], [http://partsregistry.org/Part:BBa_K079030 J23105 RBS GFP T], [http://partsregistry.org/Part:BBa_K079032 J23100 RBS GFP T]<br />
#Gel extraction<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 7: from 09/01/08 to 09/07/08 =<br />
Arrival of the operator library ([http://partsregistry.org/Part:BBa_K079045 Lac], [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 LexA], [http://partsregistry.org/Part:BBa_K079047 Lambda]) from GeneArt<br />
<br />
* Protocol design for isolation of single operators from the library.<br />
#Single digestion with PstI and gel run. In this way we open the plasmid in 3 points,loosing the Lac Operator1 and 2, and keeping the lac Operator 3 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079017 Lac Operator3].<br />
#Single digestion with XbaI and gel run<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1].<br />
#Single digestion with EcoRI and gel run. In this way we open the plasmid in 2 points,loosing the Lac Operator3, remaining the lac Operator1 and 2 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1] e [http://partsregistry.org/Part:BBa_K079018 Lac Operator2].<br />
#Further single digestion with PstI and gel run.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079018 Lac Operator2]<br />
<br />
This protocol was executed for all of the operator library members, [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 Lex] and [http://partsregistry.org/Part:BBa_K079047 Lambda].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 8: from 09/08/08 to 09/14/08 =<br />
<br />
*Assembly of the constructs <br />
<br />
#Ligations: Lac2 operator + S0100 RBS GFP T, Lac2 operator + S0100, Lac1 operator + S0100<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run<br />
#Gel extraction of: Lac2 S0100 T x\p, Lac2 S0100 RBS GFP T x\p, Lac1 S0100 T x\p<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 9: from 09/15/08 to 09/21/08 =<br />
<br />
#Ligation of the previous purified constructs and the promoters J23118, J23100<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run<br />
#Gel extraction of: [http://partsregistry.org/Part:BBa_K079026 J23118 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079020 J23118 Lac2 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac2 S0100 T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac1 S0100 T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 10: from 09/22/08 to 09/28/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 11: from 09/29/08 to 10/05/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 12: from 10/06/08 to 10/12/08 =<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 13: from 10/13/08 to 10/19/08 =<br />
*Start preparing to [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator reporter construct: <br />
<br />
# X/P digestion of B0034-J04031-B0010-B0012<br />
# S/P digestion of [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator<br />
# gel run of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# gel extraction of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# ligation: B0034-J04031-B0010-B0012 X/P digested + LEXA_2 operator S/P digested<br />
# trasformation in E.coli<br />
# inoculation of LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of LEXA_2-B0034-J04031-B0010-B0012<br />
# X/P digestion of LEXA_2-B0034-J04031-B0010-B0012<br />
# S/P digestion of J23118<br />
# gel run of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# gel extraction of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# ligation: LEXA_2-B0034-J04031-B0010-B0012 X/P digested + J23118 S/P digested <br />
# trasformation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# inoculation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of [http://partsregistry.org/Part:BBa_K079049 J23118-LEXA_2-B0034-J04031-B0010-B0012]<br />
# UV testing of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
<br />
* since test construct was successfully working, we planned to clone the same construct for the other two LEXA operators to test the repressor- operator binding affinity, in order to choose the one that better suites the implementation of the bistable toggle switch.<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 14: from 10/20/08 to 10/26/08 =<br />
# Ligation: J23100 + LexA2 RBS GFP T<br />
# Trasformation in E.coli<br />
# Inoculation and miniprep preparation<br />
# Digestion and gel run<br />
# Gel extraction of: [http://partsregistry.org/Part:BBa_K079050 J23100 LexA2 RBS GFP T]<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 15: from 10/27/08 to 10/29/08 =<br />
Working on our wiki!!!<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<!---<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Bologna | Team Example 2]]<br />
|}<br />
<br />
---><br />
<!--- The Mission, Experiments ---><br />
<!---<br />
==Notebook==<br />
<br />
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well. <br />
<br />
Find more information on how to use the calendar feature by going to the [[Help:Calendar | general calendar page]].<br />
<br />
---></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/NotebookTeam:Bologna/Notebook2008-10-29T15:17:23Z<p>Francesca ceroni: /* Week 14: from 10/20/08 to 10/26/08 */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=Notes=<br />
[[Image:agenda.jpg|right]]<br />
<br><br><br />
Here's all our lab work: week by week you can find all the procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 1: from 07/21/08 to 07/27/08 =<br />
'''General Preparations'''<br />
<br />
#Preparation of chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1 <br />
# Preparation of antibiotic stocks for Ampicillin and Kanamicin <br />
# Preparation of LB medium and LB plates for cloning.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 2: from 07/28/08 to 08/03/08 =<br />
<br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_R0082 R0082], [http://partsregistry.org/Part:BBa_R0083 R0083], [http://partsregistry.org/wiki/index.php/Part:BBa_M30109 M30109] in TOP10 strain to build and characterize the Light response system to be our spatial selective trigger. <br><br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_E0240 E0240], [http://partsregistry.org/Part:BBa_P1010 pSB3K3_P1010]in DB3.1 and the Practice Promoter Set ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J23103/ J23150, J23151, J23102]) to test and set up the new [http://partsregistry.org/Measurement Biobrick Standard Measurement Protocol]<br />
<br />
* Transformation and Amplification from our Lab Stock of [http://partsregistry.org/Part:BBa_S0100 S0100], BBa_I763020, [http://partsregistry.org/wiki/index.php?title=Part:BBa_I763005 I763005] and [http://partsregistry.org/Part:BBa_C0051 C0051]<br />
<br />
* '''Growth Curves of Dh5 Alpha, Top10 and XL1 Blue with Low Medium and High Copy Numbers to assay and define the different kinetics (Further Detail)'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 3: from 08/04/08 to 08/10/08 =<br />
<br />
'''08/04/08'''<br />
<br />
* Digestion and Control Gel Run of the previous amplified constructs :<br />
<br />
1.'''[http://partsregistry.org/Part:BBa_S0100 S0100] E/S''' <br><br />
Consistent Part Length <br><br />
2. '''PLAC-CI X/P''' <br><br />
Consistent Part Length <br><br />
3. '''R0083 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
4. '''R0082 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
5. '''C0051 X/P''' <br><br />
Consistent Part Length.<br><br />
7. '''M30105 E/S''' <br><br />
'''The Part appears not consistent'''. The Gel has unexpected multiple bands.<br><br />
8. '''RBS GFP TAG X/P''' <br> <br />
Consistent Part Length <br><br />
9.'''Pλ GFP X/P''' <br><br />
Consistent Part Length. <br><br />
<br />
* Ligation of R0082 and R0083 with E0240 to obtain a Reporter for the Light Driven Trigger.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 4: from 08/11/08 to 08/17/08 =<br />
'''HOLIDAY'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 5: from 08/18/08 to 08/24/08 =<br />
Starts the protein construct cloning<br />
<br />
#Ligations: [http://partsregistry.org/Part:BBa_I763020 I763020] + [http://partsregistry.org/Part:BBa_B0015 B0015], [http://partsregistry.org/Part:BBa_S0100 S0100] + [http://partsregistry.org/Part:BBa_B0015 B0015], TETR + [http://partsregistry.org/Part:BBa_B0015 B0015] <br />
# Trasformation of the ligations in E.coli<br />
#Inoculation and miniprep preparation <br />
#Enzymatic digestion and construct gel run: GFP T x\p, S0100 T x\p, TETR T x\p<br />
#Gel extraction of the parts<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 6: from 08/25/08 to 08/31/08 =<br />
<br />
#Ligations: B0034 + TetR T , B0034 + GFP T<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of the constructs: RBS TETR T x\p, RBS GFP T x\p<br />
#Gel extraction of the parts<br />
#Ligations: RBS GFP T + S0100, RBS GFP T + RBS TetR <br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of: RBS TETR RBS GFP T x\p, S0100 RBS GFP T x\p<br />
#Gel extraction<br />
<br />
* Final cloning step:<br />
<br />
#Ligations: promotor J23118 + RBS GFP T, promotor J23105 + RBS GFP T, promotor J23100 + RBS GFP T<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run of: [http://partsregistry.org/Part:BBa_K079031 J23118 RBS GFP T], [http://partsregistry.org/Part:BBa_K079030 J23105 RBS GFP T], [http://partsregistry.org/Part:BBa_K079032 J23100 RBS GFP T]<br />
#Gel extraction<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 7: from 09/01/08 to 09/07/08 =<br />
Arrival of the operator library ([http://partsregistry.org/Part:BBa_K079045 Lac], [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 LexA], [http://partsregistry.org/Part:BBa_K079047 Lambda]) from GeneArt<br />
<br />
* Protocol design for isolation of single operators from the library.<br />
#Single digestion with PstI and gel run. In this way we open the plasmid in 3 points,loosing the Lac Operator1 and 2, and keeping the lac Operator 3 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079017 Lac Operator3].<br />
#Single digestion with XbaI and gel run<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1].<br />
#Single digestion with EcoRI and gel run. In this way we open the plasmid in 2 points,loosing the Lac Operator3, remaining the lac Operator1 and 2 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1] e [http://partsregistry.org/Part:BBa_K079018 Lac Operator2].<br />
#Further single digestion with PstI and gel run.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079018 Lac Operator2]<br />
<br />
This protocol was executed for all of the operator library members, [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 Lex] and [http://partsregistry.org/Part:BBa_K079047 Lambda].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 8: from 09/08/08 to 09/14/08 =<br />
<br />
*Assembly of the constructs <br />
<br />
#Ligations: Lac2 operator + S0100 RBS GFP T, Lac2 operator + S0100, Lac1 operator + S0100<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run<br />
#Gel extraction of: Lac2 S0100 T x\p, Lac2 S0100 RBS GFP T x\p, Lac1 S0100 T x\p<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 9: from 09/15/08 to 09/21/08 =<br />
<br />
#Ligation of the previous purified constructs and the promoters J23118, J23100<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run<br />
#Gel extraction of: [http://partsregistry.org/Part:BBa_K079026 J23118 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079020 J23118 Lac2 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac2 S0100 T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac1 S0100 T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 10: from 09/22/08 to 09/28/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 11: from 09/29/08 to 10/05/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 12: from 10/06/08 to 10/12/08 =<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 13: from 10/13/08 to 10/19/08 =<br />
*Start preparing to [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator reporter construct: <br />
<br />
# X/P digestion of B0034-J04031-B0010-B0012<br />
# S/P digestion of [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator<br />
# gel run of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# gel extraction of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# ligation: B0034-J04031-B0010-B0012 X/P digested + LEXA_2 operator S/P digested<br />
# trasformation in E.coli<br />
# inoculation of LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of LEXA_2-B0034-J04031-B0010-B0012<br />
# X/P digestion of LEXA_2-B0034-J04031-B0010-B0012<br />
# S/P digestion of J23118<br />
# gel run of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# gel extraction of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# ligation: LEXA_2-B0034-J04031-B0010-B0012 X/P digested + J23118 S/P digested <br />
# trasformation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# inoculation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of [http://partsregistry.org/Part:BBa_K079049 J23118-LEXA_2-B0034-J04031-B0010-B0012]<br />
# UV testing of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
<br />
* since test construct was successfully working, we planned to clone the same construct for the other two LEXA operators to test the repressor- operator binding affinity, in order to choose the one that better suites the implementation of the bistable toggle switch.<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 14: from 10/20/08 to 10/26/08 =<br />
# Ligation: J23100 + LexA2 RBS GFP T<br />
# Trasformation in E.coli<br />
# Inoculation and miniprep preparation<br />
# Digestion and gel run<br />
# Gel extraction of: [http://partsregistry.org/Part:BBa_K079050 J23100 LexA2 RBS GFP T]<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 15: from 10/27/08 to 10/29/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<!---<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Bologna | Team Example 2]]<br />
|}<br />
<br />
---><br />
<!--- The Mission, Experiments ---><br />
<!---<br />
==Notebook==<br />
<br />
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well. <br />
<br />
Find more information on how to use the calendar feature by going to the [[Help:Calendar | general calendar page]].<br />
<br />
---></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/NotebookTeam:Bologna/Notebook2008-10-29T15:17:12Z<p>Francesca ceroni: /* Week 12: from 10/06/08 to 10/12/08 */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=Notes=<br />
[[Image:agenda.jpg|right]]<br />
<br><br><br />
Here's all our lab work: week by week you can find all the procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 1: from 07/21/08 to 07/27/08 =<br />
'''General Preparations'''<br />
<br />
#Preparation of chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1 <br />
# Preparation of antibiotic stocks for Ampicillin and Kanamicin <br />
# Preparation of LB medium and LB plates for cloning.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 2: from 07/28/08 to 08/03/08 =<br />
<br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_R0082 R0082], [http://partsregistry.org/Part:BBa_R0083 R0083], [http://partsregistry.org/wiki/index.php/Part:BBa_M30109 M30109] in TOP10 strain to build and characterize the Light response system to be our spatial selective trigger. <br><br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_E0240 E0240], [http://partsregistry.org/Part:BBa_P1010 pSB3K3_P1010]in DB3.1 and the Practice Promoter Set ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J23103/ J23150, J23151, J23102]) to test and set up the new [http://partsregistry.org/Measurement Biobrick Standard Measurement Protocol]<br />
<br />
* Transformation and Amplification from our Lab Stock of [http://partsregistry.org/Part:BBa_S0100 S0100], BBa_I763020, [http://partsregistry.org/wiki/index.php?title=Part:BBa_I763005 I763005] and [http://partsregistry.org/Part:BBa_C0051 C0051]<br />
<br />
* '''Growth Curves of Dh5 Alpha, Top10 and XL1 Blue with Low Medium and High Copy Numbers to assay and define the different kinetics (Further Detail)'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 3: from 08/04/08 to 08/10/08 =<br />
<br />
'''08/04/08'''<br />
<br />
* Digestion and Control Gel Run of the previous amplified constructs :<br />
<br />
1.'''[http://partsregistry.org/Part:BBa_S0100 S0100] E/S''' <br><br />
Consistent Part Length <br><br />
2. '''PLAC-CI X/P''' <br><br />
Consistent Part Length <br><br />
3. '''R0083 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
4. '''R0082 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
5. '''C0051 X/P''' <br><br />
Consistent Part Length.<br><br />
7. '''M30105 E/S''' <br><br />
'''The Part appears not consistent'''. The Gel has unexpected multiple bands.<br><br />
8. '''RBS GFP TAG X/P''' <br> <br />
Consistent Part Length <br><br />
9.'''Pλ GFP X/P''' <br><br />
Consistent Part Length. <br><br />
<br />
* Ligation of R0082 and R0083 with E0240 to obtain a Reporter for the Light Driven Trigger.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 4: from 08/11/08 to 08/17/08 =<br />
'''HOLIDAY'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 5: from 08/18/08 to 08/24/08 =<br />
Starts the protein construct cloning<br />
<br />
#Ligations: [http://partsregistry.org/Part:BBa_I763020 I763020] + [http://partsregistry.org/Part:BBa_B0015 B0015], [http://partsregistry.org/Part:BBa_S0100 S0100] + [http://partsregistry.org/Part:BBa_B0015 B0015], TETR + [http://partsregistry.org/Part:BBa_B0015 B0015] <br />
# Trasformation of the ligations in E.coli<br />
#Inoculation and miniprep preparation <br />
#Enzymatic digestion and construct gel run: GFP T x\p, S0100 T x\p, TETR T x\p<br />
#Gel extraction of the parts<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 6: from 08/25/08 to 08/31/08 =<br />
<br />
#Ligations: B0034 + TetR T , B0034 + GFP T<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of the constructs: RBS TETR T x\p, RBS GFP T x\p<br />
#Gel extraction of the parts<br />
#Ligations: RBS GFP T + S0100, RBS GFP T + RBS TetR <br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of: RBS TETR RBS GFP T x\p, S0100 RBS GFP T x\p<br />
#Gel extraction<br />
<br />
* Final cloning step:<br />
<br />
#Ligations: promotor J23118 + RBS GFP T, promotor J23105 + RBS GFP T, promotor J23100 + RBS GFP T<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run of: [http://partsregistry.org/Part:BBa_K079031 J23118 RBS GFP T], [http://partsregistry.org/Part:BBa_K079030 J23105 RBS GFP T], [http://partsregistry.org/Part:BBa_K079032 J23100 RBS GFP T]<br />
#Gel extraction<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 7: from 09/01/08 to 09/07/08 =<br />
Arrival of the operator library ([http://partsregistry.org/Part:BBa_K079045 Lac], [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 LexA], [http://partsregistry.org/Part:BBa_K079047 Lambda]) from GeneArt<br />
<br />
* Protocol design for isolation of single operators from the library.<br />
#Single digestion with PstI and gel run. In this way we open the plasmid in 3 points,loosing the Lac Operator1 and 2, and keeping the lac Operator 3 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079017 Lac Operator3].<br />
#Single digestion with XbaI and gel run<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1].<br />
#Single digestion with EcoRI and gel run. In this way we open the plasmid in 2 points,loosing the Lac Operator3, remaining the lac Operator1 and 2 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1] e [http://partsregistry.org/Part:BBa_K079018 Lac Operator2].<br />
#Further single digestion with PstI and gel run.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079018 Lac Operator2]<br />
<br />
This protocol was executed for all of the operator library members, [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 Lex] and [http://partsregistry.org/Part:BBa_K079047 Lambda].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 8: from 09/08/08 to 09/14/08 =<br />
<br />
*Assembly of the constructs <br />
<br />
#Ligations: Lac2 operator + S0100 RBS GFP T, Lac2 operator + S0100, Lac1 operator + S0100<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run<br />
#Gel extraction of: Lac2 S0100 T x\p, Lac2 S0100 RBS GFP T x\p, Lac1 S0100 T x\p<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 9: from 09/15/08 to 09/21/08 =<br />
<br />
#Ligation of the previous purified constructs and the promoters J23118, J23100<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run<br />
#Gel extraction of: [http://partsregistry.org/Part:BBa_K079026 J23118 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079020 J23118 Lac2 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac2 S0100 T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac1 S0100 T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 10: from 09/22/08 to 09/28/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 11: from 09/29/08 to 10/05/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 12: from 10/06/08 to 10/12/08 =<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 13: from 10/13/08 to 10/19/08 =<br />
*Start preparing to [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator reporter construct: <br />
<br />
# X/P digestion of B0034-J04031-B0010-B0012<br />
# S/P digestion of [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator<br />
# gel run of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# gel extraction of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# ligation: B0034-J04031-B0010-B0012 X/P digested + LEXA_2 operator S/P digested<br />
# trasformation in E.coli<br />
# inoculation of LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of LEXA_2-B0034-J04031-B0010-B0012<br />
# X/P digestion of LEXA_2-B0034-J04031-B0010-B0012<br />
# S/P digestion of J23118<br />
# gel run of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# gel extraction of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# ligation: LEXA_2-B0034-J04031-B0010-B0012 X/P digested + J23118 S/P digested <br />
# trasformation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# inoculation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of [http://partsregistry.org/Part:BBa_K079049 J23118-LEXA_2-B0034-J04031-B0010-B0012]<br />
# UV testing of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
<br />
* since test construct was successfully working, we planned to clone the same construct for the other two LEXA operators to test the repressor- operator binding affinity, in order to choose the one that better suites the implementation of the bistable toggle switch.<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 14: from 10/20/08 to 10/26/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 15: from 10/27/08 to 10/29/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<!---<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Bologna | Team Example 2]]<br />
|}<br />
<br />
---><br />
<!--- The Mission, Experiments ---><br />
<!---<br />
==Notebook==<br />
<br />
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well. <br />
<br />
Find more information on how to use the calendar feature by going to the [[Help:Calendar | general calendar page]].<br />
<br />
---></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/NotebookTeam:Bologna/Notebook2008-10-29T15:16:37Z<p>Francesca ceroni: /* Week 13: from 10/13/08 to 10/19/08 */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=Notes=<br />
[[Image:agenda.jpg|right]]<br />
<br><br><br />
Here's all our lab work: week by week you can find all the procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 1: from 07/21/08 to 07/27/08 =<br />
'''General Preparations'''<br />
<br />
#Preparation of chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1 <br />
# Preparation of antibiotic stocks for Ampicillin and Kanamicin <br />
# Preparation of LB medium and LB plates for cloning.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 2: from 07/28/08 to 08/03/08 =<br />
<br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_R0082 R0082], [http://partsregistry.org/Part:BBa_R0083 R0083], [http://partsregistry.org/wiki/index.php/Part:BBa_M30109 M30109] in TOP10 strain to build and characterize the Light response system to be our spatial selective trigger. <br><br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_E0240 E0240], [http://partsregistry.org/Part:BBa_P1010 pSB3K3_P1010]in DB3.1 and the Practice Promoter Set ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J23103/ J23150, J23151, J23102]) to test and set up the new [http://partsregistry.org/Measurement Biobrick Standard Measurement Protocol]<br />
<br />
* Transformation and Amplification from our Lab Stock of [http://partsregistry.org/Part:BBa_S0100 S0100], BBa_I763020, [http://partsregistry.org/wiki/index.php?title=Part:BBa_I763005 I763005] and [http://partsregistry.org/Part:BBa_C0051 C0051]<br />
<br />
* '''Growth Curves of Dh5 Alpha, Top10 and XL1 Blue with Low Medium and High Copy Numbers to assay and define the different kinetics (Further Detail)'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 3: from 08/04/08 to 08/10/08 =<br />
<br />
'''08/04/08'''<br />
<br />
* Digestion and Control Gel Run of the previous amplified constructs :<br />
<br />
1.'''[http://partsregistry.org/Part:BBa_S0100 S0100] E/S''' <br><br />
Consistent Part Length <br><br />
2. '''PLAC-CI X/P''' <br><br />
Consistent Part Length <br><br />
3. '''R0083 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
4. '''R0082 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
5. '''C0051 X/P''' <br><br />
Consistent Part Length.<br><br />
7. '''M30105 E/S''' <br><br />
'''The Part appears not consistent'''. The Gel has unexpected multiple bands.<br><br />
8. '''RBS GFP TAG X/P''' <br> <br />
Consistent Part Length <br><br />
9.'''Pλ GFP X/P''' <br><br />
Consistent Part Length. <br><br />
<br />
* Ligation of R0082 and R0083 with E0240 to obtain a Reporter for the Light Driven Trigger.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 4: from 08/11/08 to 08/17/08 =<br />
'''HOLIDAY'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 5: from 08/18/08 to 08/24/08 =<br />
Starts the protein construct cloning<br />
<br />
#Ligations: [http://partsregistry.org/Part:BBa_I763020 I763020] + [http://partsregistry.org/Part:BBa_B0015 B0015], [http://partsregistry.org/Part:BBa_S0100 S0100] + [http://partsregistry.org/Part:BBa_B0015 B0015], TETR + [http://partsregistry.org/Part:BBa_B0015 B0015] <br />
# Trasformation of the ligations in E.coli<br />
#Inoculation and miniprep preparation <br />
#Enzymatic digestion and construct gel run: GFP T x\p, S0100 T x\p, TETR T x\p<br />
#Gel extraction of the parts<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 6: from 08/25/08 to 08/31/08 =<br />
<br />
#Ligations: B0034 + TetR T , B0034 + GFP T<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of the constructs: RBS TETR T x\p, RBS GFP T x\p<br />
#Gel extraction of the parts<br />
#Ligations: RBS GFP T + S0100, RBS GFP T + RBS TetR <br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of: RBS TETR RBS GFP T x\p, S0100 RBS GFP T x\p<br />
#Gel extraction<br />
<br />
* Final cloning step:<br />
<br />
#Ligations: promotor J23118 + RBS GFP T, promotor J23105 + RBS GFP T, promotor J23100 + RBS GFP T<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run of: [http://partsregistry.org/Part:BBa_K079031 J23118 RBS GFP T], [http://partsregistry.org/Part:BBa_K079030 J23105 RBS GFP T], [http://partsregistry.org/Part:BBa_K079032 J23100 RBS GFP T]<br />
#Gel extraction<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 7: from 09/01/08 to 09/07/08 =<br />
Arrival of the operator library ([http://partsregistry.org/Part:BBa_K079045 Lac], [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 LexA], [http://partsregistry.org/Part:BBa_K079047 Lambda]) from GeneArt<br />
<br />
* Protocol design for isolation of single operators from the library.<br />
#Single digestion with PstI and gel run. In this way we open the plasmid in 3 points,loosing the Lac Operator1 and 2, and keeping the lac Operator 3 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079017 Lac Operator3].<br />
#Single digestion with XbaI and gel run<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1].<br />
#Single digestion with EcoRI and gel run. In this way we open the plasmid in 2 points,loosing the Lac Operator3, remaining the lac Operator1 and 2 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1] e [http://partsregistry.org/Part:BBa_K079018 Lac Operator2].<br />
#Further single digestion with PstI and gel run.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079018 Lac Operator2]<br />
<br />
This protocol was executed for all of the operator library members, [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 Lex] and [http://partsregistry.org/Part:BBa_K079047 Lambda].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 8: from 09/08/08 to 09/14/08 =<br />
<br />
*Assembly of the constructs <br />
<br />
#Ligations: Lac2 operator + S0100 RBS GFP T, Lac2 operator + S0100, Lac1 operator + S0100<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run<br />
#Gel extraction of: Lac2 S0100 T x\p, Lac2 S0100 RBS GFP T x\p, Lac1 S0100 T x\p<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 9: from 09/15/08 to 09/21/08 =<br />
<br />
#Ligation of the previous purified constructs and the promoters J23118, J23100<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run<br />
#Gel extraction of: [http://partsregistry.org/Part:BBa_K079026 J23118 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079020 J23118 Lac2 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac2 S0100 T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac1 S0100 T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 10: from 09/22/08 to 09/28/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 11: from 09/29/08 to 10/05/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 12: from 10/06/08 to 10/12/08 =<br />
# Ligation: J23100 + LexA2 RBS GFP T<br />
# Trasformation in E.coli<br />
# Inoculation and miniprep preparation<br />
# Digestion and gel run<br />
# Gel extraction of: [http://partsregistry.org/Part:BBa_K079050 J23100 LexA2 RBS GFP T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 13: from 10/13/08 to 10/19/08 =<br />
*Start preparing to [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator reporter construct: <br />
<br />
# X/P digestion of B0034-J04031-B0010-B0012<br />
# S/P digestion of [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator<br />
# gel run of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# gel extraction of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# ligation: B0034-J04031-B0010-B0012 X/P digested + LEXA_2 operator S/P digested<br />
# trasformation in E.coli<br />
# inoculation of LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of LEXA_2-B0034-J04031-B0010-B0012<br />
# X/P digestion of LEXA_2-B0034-J04031-B0010-B0012<br />
# S/P digestion of J23118<br />
# gel run of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# gel extraction of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# ligation: LEXA_2-B0034-J04031-B0010-B0012 X/P digested + J23118 S/P digested <br />
# trasformation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# inoculation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of [http://partsregistry.org/Part:BBa_K079049 J23118-LEXA_2-B0034-J04031-B0010-B0012]<br />
# UV testing of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
<br />
* since test construct was successfully working, we planned to clone the same construct for the other two LEXA operators to test the repressor- operator binding affinity, in order to choose the one that better suites the implementation of the bistable toggle switch.<br />
<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 14: from 10/20/08 to 10/26/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 15: from 10/27/08 to 10/29/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<!---<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Bologna | Team Example 2]]<br />
|}<br />
<br />
---><br />
<!--- The Mission, Experiments ---><br />
<!---<br />
==Notebook==<br />
<br />
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well. <br />
<br />
Find more information on how to use the calendar feature by going to the [[Help:Calendar | general calendar page]].<br />
<br />
---></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/NotebookTeam:Bologna/Notebook2008-10-29T15:16:27Z<p>Francesca ceroni: /* Week 11: from 09/29/08 to 10/05/08 */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=Notes=<br />
[[Image:agenda.jpg|right]]<br />
<br><br><br />
Here's all our lab work: week by week you can find all the procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 1: from 07/21/08 to 07/27/08 =<br />
'''General Preparations'''<br />
<br />
#Preparation of chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1 <br />
# Preparation of antibiotic stocks for Ampicillin and Kanamicin <br />
# Preparation of LB medium and LB plates for cloning.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 2: from 07/28/08 to 08/03/08 =<br />
<br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_R0082 R0082], [http://partsregistry.org/Part:BBa_R0083 R0083], [http://partsregistry.org/wiki/index.php/Part:BBa_M30109 M30109] in TOP10 strain to build and characterize the Light response system to be our spatial selective trigger. <br><br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_E0240 E0240], [http://partsregistry.org/Part:BBa_P1010 pSB3K3_P1010]in DB3.1 and the Practice Promoter Set ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J23103/ J23150, J23151, J23102]) to test and set up the new [http://partsregistry.org/Measurement Biobrick Standard Measurement Protocol]<br />
<br />
* Transformation and Amplification from our Lab Stock of [http://partsregistry.org/Part:BBa_S0100 S0100], BBa_I763020, [http://partsregistry.org/wiki/index.php?title=Part:BBa_I763005 I763005] and [http://partsregistry.org/Part:BBa_C0051 C0051]<br />
<br />
* '''Growth Curves of Dh5 Alpha, Top10 and XL1 Blue with Low Medium and High Copy Numbers to assay and define the different kinetics (Further Detail)'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 3: from 08/04/08 to 08/10/08 =<br />
<br />
'''08/04/08'''<br />
<br />
* Digestion and Control Gel Run of the previous amplified constructs :<br />
<br />
1.'''[http://partsregistry.org/Part:BBa_S0100 S0100] E/S''' <br><br />
Consistent Part Length <br><br />
2. '''PLAC-CI X/P''' <br><br />
Consistent Part Length <br><br />
3. '''R0083 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
4. '''R0082 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
5. '''C0051 X/P''' <br><br />
Consistent Part Length.<br><br />
7. '''M30105 E/S''' <br><br />
'''The Part appears not consistent'''. The Gel has unexpected multiple bands.<br><br />
8. '''RBS GFP TAG X/P''' <br> <br />
Consistent Part Length <br><br />
9.'''Pλ GFP X/P''' <br><br />
Consistent Part Length. <br><br />
<br />
* Ligation of R0082 and R0083 with E0240 to obtain a Reporter for the Light Driven Trigger.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 4: from 08/11/08 to 08/17/08 =<br />
'''HOLIDAY'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 5: from 08/18/08 to 08/24/08 =<br />
Starts the protein construct cloning<br />
<br />
#Ligations: [http://partsregistry.org/Part:BBa_I763020 I763020] + [http://partsregistry.org/Part:BBa_B0015 B0015], [http://partsregistry.org/Part:BBa_S0100 S0100] + [http://partsregistry.org/Part:BBa_B0015 B0015], TETR + [http://partsregistry.org/Part:BBa_B0015 B0015] <br />
# Trasformation of the ligations in E.coli<br />
#Inoculation and miniprep preparation <br />
#Enzymatic digestion and construct gel run: GFP T x\p, S0100 T x\p, TETR T x\p<br />
#Gel extraction of the parts<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 6: from 08/25/08 to 08/31/08 =<br />
<br />
#Ligations: B0034 + TetR T , B0034 + GFP T<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of the constructs: RBS TETR T x\p, RBS GFP T x\p<br />
#Gel extraction of the parts<br />
#Ligations: RBS GFP T + S0100, RBS GFP T + RBS TetR <br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of: RBS TETR RBS GFP T x\p, S0100 RBS GFP T x\p<br />
#Gel extraction<br />
<br />
* Final cloning step:<br />
<br />
#Ligations: promotor J23118 + RBS GFP T, promotor J23105 + RBS GFP T, promotor J23100 + RBS GFP T<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run of: [http://partsregistry.org/Part:BBa_K079031 J23118 RBS GFP T], [http://partsregistry.org/Part:BBa_K079030 J23105 RBS GFP T], [http://partsregistry.org/Part:BBa_K079032 J23100 RBS GFP T]<br />
#Gel extraction<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 7: from 09/01/08 to 09/07/08 =<br />
Arrival of the operator library ([http://partsregistry.org/Part:BBa_K079045 Lac], [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 LexA], [http://partsregistry.org/Part:BBa_K079047 Lambda]) from GeneArt<br />
<br />
* Protocol design for isolation of single operators from the library.<br />
#Single digestion with PstI and gel run. In this way we open the plasmid in 3 points,loosing the Lac Operator1 and 2, and keeping the lac Operator 3 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079017 Lac Operator3].<br />
#Single digestion with XbaI and gel run<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1].<br />
#Single digestion with EcoRI and gel run. In this way we open the plasmid in 2 points,loosing the Lac Operator3, remaining the lac Operator1 and 2 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1] e [http://partsregistry.org/Part:BBa_K079018 Lac Operator2].<br />
#Further single digestion with PstI and gel run.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079018 Lac Operator2]<br />
<br />
This protocol was executed for all of the operator library members, [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 Lex] and [http://partsregistry.org/Part:BBa_K079047 Lambda].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 8: from 09/08/08 to 09/14/08 =<br />
<br />
*Assembly of the constructs <br />
<br />
#Ligations: Lac2 operator + S0100 RBS GFP T, Lac2 operator + S0100, Lac1 operator + S0100<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run<br />
#Gel extraction of: Lac2 S0100 T x\p, Lac2 S0100 RBS GFP T x\p, Lac1 S0100 T x\p<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 9: from 09/15/08 to 09/21/08 =<br />
<br />
#Ligation of the previous purified constructs and the promoters J23118, J23100<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run<br />
#Gel extraction of: [http://partsregistry.org/Part:BBa_K079026 J23118 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079020 J23118 Lac2 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac2 S0100 T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac1 S0100 T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 10: from 09/22/08 to 09/28/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 11: from 09/29/08 to 10/05/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 12: from 10/06/08 to 10/12/08 =<br />
# Ligation: J23100 + LexA2 RBS GFP T<br />
# Trasformation in E.coli<br />
# Inoculation and miniprep preparation<br />
# Digestion and gel run<br />
# Gel extraction of: [http://partsregistry.org/Part:BBa_K079050 J23100 LexA2 RBS GFP T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 13: from 10/13/08 to 10/19/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 14: from 10/20/08 to 10/26/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 15: from 10/27/08 to 10/29/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<!---<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Bologna | Team Example 2]]<br />
|}<br />
<br />
---><br />
<!--- The Mission, Experiments ---><br />
<!---<br />
==Notebook==<br />
<br />
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well. <br />
<br />
Find more information on how to use the calendar feature by going to the [[Help:Calendar | general calendar page]].<br />
<br />
---></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/NotebookTeam:Bologna/Notebook2008-10-29T15:15:22Z<p>Francesca ceroni: /* Notes */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=Notes=<br />
[[Image:agenda.jpg|right]]<br />
<br><br><br />
Here's all our lab work: week by week you can find all the procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style. <br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 1: from 07/21/08 to 07/27/08 =<br />
'''General Preparations'''<br />
<br />
#Preparation of chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1 <br />
# Preparation of antibiotic stocks for Ampicillin and Kanamicin <br />
# Preparation of LB medium and LB plates for cloning.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 2: from 07/28/08 to 08/03/08 =<br />
<br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_R0082 R0082], [http://partsregistry.org/Part:BBa_R0083 R0083], [http://partsregistry.org/wiki/index.php/Part:BBa_M30109 M30109] in TOP10 strain to build and characterize the Light response system to be our spatial selective trigger. <br><br />
<br />
* Eluition and Amplification from 2008 Registry Collection: [http://partsregistry.org/Part:BBa_E0240 E0240], [http://partsregistry.org/Part:BBa_P1010 pSB3K3_P1010]in DB3.1 and the Practice Promoter Set ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J23103/ J23150, J23151, J23102]) to test and set up the new [http://partsregistry.org/Measurement Biobrick Standard Measurement Protocol]<br />
<br />
* Transformation and Amplification from our Lab Stock of [http://partsregistry.org/Part:BBa_S0100 S0100], BBa_I763020, [http://partsregistry.org/wiki/index.php?title=Part:BBa_I763005 I763005] and [http://partsregistry.org/Part:BBa_C0051 C0051]<br />
<br />
* '''Growth Curves of Dh5 Alpha, Top10 and XL1 Blue with Low Medium and High Copy Numbers to assay and define the different kinetics (Further Detail)'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 3: from 08/04/08 to 08/10/08 =<br />
<br />
'''08/04/08'''<br />
<br />
* Digestion and Control Gel Run of the previous amplified constructs :<br />
<br />
1.'''[http://partsregistry.org/Part:BBa_S0100 S0100] E/S''' <br><br />
Consistent Part Length <br><br />
2. '''PLAC-CI X/P''' <br><br />
Consistent Part Length <br><br />
3. '''R0083 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
4. '''R0082 S/P''' <br><br />
Single Vector Band as Expexted. Is Hard to verify the Part length correctness given the small size <br><br />
5. '''C0051 X/P''' <br><br />
Consistent Part Length.<br><br />
7. '''M30105 E/S''' <br><br />
'''The Part appears not consistent'''. The Gel has unexpected multiple bands.<br><br />
8. '''RBS GFP TAG X/P''' <br> <br />
Consistent Part Length <br><br />
9.'''Pλ GFP X/P''' <br><br />
Consistent Part Length. <br><br />
<br />
* Ligation of R0082 and R0083 with E0240 to obtain a Reporter for the Light Driven Trigger.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 4: from 08/11/08 to 08/17/08 =<br />
'''HOLIDAY'''<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 5: from 08/18/08 to 08/24/08 =<br />
Starts the protein construct cloning<br />
<br />
#Ligations: [http://partsregistry.org/Part:BBa_I763020 I763020] + [http://partsregistry.org/Part:BBa_B0015 B0015], [http://partsregistry.org/Part:BBa_S0100 S0100] + [http://partsregistry.org/Part:BBa_B0015 B0015], TETR + [http://partsregistry.org/Part:BBa_B0015 B0015] <br />
# Trasformation of the ligations in E.coli<br />
#Inoculation and miniprep preparation <br />
#Enzymatic digestion and construct gel run: GFP T x\p, S0100 T x\p, TETR T x\p<br />
#Gel extraction of the parts<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 6: from 08/25/08 to 08/31/08 =<br />
<br />
#Ligations: B0034 + TetR T , B0034 + GFP T<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of the constructs: RBS TETR T x\p, RBS GFP T x\p<br />
#Gel extraction of the parts<br />
#Ligations: RBS GFP T + S0100, RBS GFP T + RBS TetR <br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run of: RBS TETR RBS GFP T x\p, S0100 RBS GFP T x\p<br />
#Gel extraction<br />
<br />
* Final cloning step:<br />
<br />
#Ligations: promotor J23118 + RBS GFP T, promotor J23105 + RBS GFP T, promotor J23100 + RBS GFP T<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run of: [http://partsregistry.org/Part:BBa_K079031 J23118 RBS GFP T], [http://partsregistry.org/Part:BBa_K079030 J23105 RBS GFP T], [http://partsregistry.org/Part:BBa_K079032 J23100 RBS GFP T]<br />
#Gel extraction<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 7: from 09/01/08 to 09/07/08 =<br />
Arrival of the operator library ([http://partsregistry.org/Part:BBa_K079045 Lac], [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 LexA], [http://partsregistry.org/Part:BBa_K079047 Lambda]) from GeneArt<br />
<br />
* Protocol design for isolation of single operators from the library.<br />
#Single digestion with PstI and gel run. In this way we open the plasmid in 3 points,loosing the Lac Operator1 and 2, and keeping the lac Operator 3 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079017 Lac Operator3].<br />
#Single digestion with XbaI and gel run<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1].<br />
#Single digestion with EcoRI and gel run. In this way we open the plasmid in 2 points,loosing the Lac Operator3, remaining the lac Operator1 and 2 into the plasmid.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079019 Lac Operator1] e [http://partsregistry.org/Part:BBa_K079018 Lac Operator2].<br />
#Further single digestion with PstI and gel run.<br />
#Gel extraction of the upper band containing [http://partsregistry.org/Part:BBa_K079018 Lac Operator2]<br />
<br />
This protocol was executed for all of the operator library members, [http://partsregistry.org/Part:BBa_K079046 Tet], [http://partsregistry.org/Part:BBa_K079048 Lex] and [http://partsregistry.org/Part:BBa_K079047 Lambda].<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 8: from 09/08/08 to 09/14/08 =<br />
<br />
*Assembly of the constructs <br />
<br />
#Ligations: Lac2 operator + S0100 RBS GFP T, Lac2 operator + S0100, Lac1 operator + S0100<br />
#Trasformation in E.coli <br />
#Inoculation and miniprep preparation <br />
#Digestion and gel run<br />
#Gel extraction of: Lac2 S0100 T x\p, Lac2 S0100 RBS GFP T x\p, Lac1 S0100 T x\p<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 9: from 09/15/08 to 09/21/08 =<br />
<br />
#Ligation of the previous purified constructs and the promoters J23118, J23100<br />
#Trasformation in E.coli<br />
#Inoculation and miniprep preparation<br />
#Digestion and gel run<br />
#Gel extraction of: [http://partsregistry.org/Part:BBa_K079026 J23118 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079020 J23118 Lac2 S0100 RBS GFP T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac2 S0100 T], [http://partsregistry.org/Part:BBa_K079023 J23118 Lac1 S0100 T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 10: from 09/22/08 to 09/28/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 11: from 09/29/08 to 10/05/08 =<br />
<br />
*Start preparing to [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator reporter construct: <br />
<br />
# X/P digestion of B0034-J04031-B0010-B0012<br />
# S/P digestion of [http://partsregistry.org/Part:BBa_K079040 LEXA_2] operator<br />
# gel run of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# gel extraction of B0034-J04031-B0010-B0012 X/P digested and LEXA_2 operator S/P digested<br />
# ligation: B0034-J04031-B0010-B0012 X/P digested + LEXA_2 operator S/P digested<br />
# trasformation in E.coli<br />
# inoculation of LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of LEXA_2-B0034-J04031-B0010-B0012<br />
# X/P digestion of LEXA_2-B0034-J04031-B0010-B0012<br />
# S/P digestion of J23118<br />
# gel run of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# gel extraction of LEXA_2-B0034-J04031-B0010-B0012 X/P digested and J23118 S/P digested<br />
# ligation: LEXA_2-B0034-J04031-B0010-B0012 X/P digested + J23118 S/P digested <br />
# trasformation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# inoculation of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
# miniprep of [http://partsregistry.org/Part:BBa_K079049 J23118-LEXA_2-B0034-J04031-B0010-B0012]<br />
# UV testing of J23118-LEXA_2-B0034-J04031-B0010-B0012<br />
<br />
* since test construct was successfully working, we planned to clone the same construct for the other two LEXA operators to test the repressor- operator binding affinity, in order to choose the one that better suites the implementation of the bistable toggle switch.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 12: from 10/06/08 to 10/12/08 =<br />
# Ligation: J23100 + LexA2 RBS GFP T<br />
# Trasformation in E.coli<br />
# Inoculation and miniprep preparation<br />
# Digestion and gel run<br />
# Gel extraction of: [http://partsregistry.org/Part:BBa_K079050 J23100 LexA2 RBS GFP T]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 13: from 10/13/08 to 10/19/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 14: from 10/20/08 to 10/26/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
= Week 15: from 10/27/08 to 10/29/08 =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Notebook ''Up'']<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<!---<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Bologna | Team Example 2]]<br />
|}<br />
<br />
---><br />
<!--- The Mission, Experiments ---><br />
<!---<br />
==Notebook==<br />
<br />
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well. <br />
<br />
Find more information on how to use the calendar feature by going to the [[Help:Calendar | general calendar page]].<br />
<br />
---></div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T14:41:33Z<p>Francesca ceroni: /* Gel matrix */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=LAB Experiment =<br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
<br><br />
<br />
In our genetic bi-stable, the amount of molecules produced to switch the system from the two possible steady state is ruled by LacI and TetR protein. The production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of its fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new construct submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequence:<br />
[[Image:minicirc2.jpg|center]]<br />
* Promoter Constitutive Family: BBa_J23118 (1429 strength ) or BBa_23100 (2547 strength);<br />
* LexA Operator Site Binding (K079040 ) ;<br />
* Rbs with Green fluorescence Protein LVA and Terminator (BBa_I763020)<br />
<br><br />
In order to generate the induction by Uv, a box with UV lamp was realized.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria.<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean.<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be purified with the standard kits available. So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the Registry (link). As it can be seen in figure, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
FOTO!!!!<br />
<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T14:41:04Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
=LAB Experiment =<br />
__FORCETOC__<br />
[[Image:Collage2.jpg|700px]]<br />
<br />
<br><br />
<br />
In our genetic bi-stable, the amount of molecules produced to switch the system from the two possible steady state is ruled by LacI and TetR protein. The production of LacI molecules by UV induction can be tested replacing the LacI gene by GFP, so it is possible to have a relation of the strength of LacI synthesis measuring the value of its fluorescence.<br />
BBa_K079049 and BBa_K079050 are two new construct submitted to the registry by Bologna’s Igem Team 2008. These UV test circuits can be presented schematically by the following sequence:<br />
[[Image:minicirc2.jpg|center]]<br />
* Promoter Constitutive Family: BBa_J23118 (1429 strength ) or BBa_23100 (2547 strength);<br />
* LexA Operator Site Binding (K079040 ) ;<br />
* Rbs with Green fluorescence Protein LVA and Terminator (BBa_I763020)<br />
<br><br />
In order to generate the induction by Uv, a box with UV lamp was realized.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Homemade UV Illuminator =<br />
<br />
The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it [[Team:Bologna/Biosafety#Ethidium_Bromide_and_UV_Rays|'''safely''']] we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to the light absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time.<br />
Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 2-3).<br />
<br />
{|align="center"<br />
|[[Image:scatola1.jpg|center|thumbnail|300 px|Figure 2]] <br />
|width=70| <br />
|[[Image:scatola2.jpg|center|thumbnail|300 px| Figure 3]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
= Gel matrix =<br />
<br />
Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone<br />
without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this<br />
give us a square of 25mm side's with 16 cells inside where we can locate bacteria.<br />
[[Image:matrice.jpg|center|thumbnail|300 px| Figure 4]]<br />
<br />
Once do that is easy with an optical mask, like those used in photolithography for electronics<br />
circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is<br />
very easy to shape and clean.<br />
The mold is made of two parts that will form a sandwich with the slide: one will create the shape <br />
of the gel matrix the other is a cover that that will give the picture into gel .<br><br />
{|align="center"<br />
|[[Image:imm1.jpg|center|thumbnail|300 px|Figure 5]]<br />
|width=70| <br />
|[[Image:imm2.jpg|center|thumbnail|300 px|Figure 6]]<br />
|}<br />
<br />
<br />
The matrix is obtained through the pressure of the cover part over the mold part<br />
[[Image:pinze.jpg|center|thumbnail|300 px|Figure 7]]<br />
and that is the result:<br />
[[Image:imm3.jpg|center|thumbnail|300 px|Figure 8]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Wetlab ''Up'']<br />
<br />
<br />
Operator sites are dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be purified with the standard kits available. So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids. <br />
<br />
We started from the analysis of an existing promoter library into the Registry (link). As it can be seen in figure, these plasmids were meant for the construction of promoter basic parts and their derivatives. They can be used two ways: <br />
1. Insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter while retaining the ability to do BioBrick assembly. Part J61002 is the tet promoter variant of the plasmid. <br />
2. Insertion of a protein generating device or RNA gene (cutting the part with XbaI/PstI, inserting into SpeI/PstI of J61002) results in a standard pSB1A2 plasmid containing an r0040.yourpart composite. <br />
<br />
<br />
<br />
Thus, we decided to isolate the RFP protein from one of the promoter family member with a SpeI- PstI enzymatic digestion. Then, this part could be assemble with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2008-10-29T12:49:31Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Model-based analysis of the genetic Flip-Flop =<br />
<br />
== The genetic Flip-Flop ==<br />
<br />
[[Image:Circuito2.jpg|300px|thumb|right|Figure 1: Scheme of the genetic Flip-Flop]] <br />
<div style="text-align:justify"><br />
The molecular circuit in Figure 1 can switch between two different stable states (LacI-ON and TetR-ON), driven by two external stimuli (UVc and IPTG). LacI-ON represents the stable state where the LacI gene is active and LacI protein represses TetR gene expression, in a positive feedback. Therefore, the LacI-ON state coincides with the TetR-OFF condition. On the contrary, the TetR-ON represents the state with the TetR gene active and the LacI gene silenced (LacI-OFF). Owing to the coexistence of two stable states (bistability), this circuit is capable of serving as a binary of memory. We denominated it a Flip-Flop since it works as a SR Latch: LacI state is the [[Image:q.jpg]] output and TetR state is the [[Image:qneg.jpg]] output. Uvc is the set signal and IPTG is the reset signal. Indeed, IPTG stimulation inhibits LacI repressor, thus can cause the transition from the LacI-ON state to the TetR-ON. UVc radiation, inactivating LexA repressor through the SOS response (Friedberg et al., 1995) can cause the opposite transition from LacI-ON to TetR-ON.<br />
<br />
<br><br><br><br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Mathematical Model ==<br />
<br />
<br />
'''<font size="3">Model equations</font>'''<br />
<br />
<br><br />
The Flip-Flop circuit in Figure 1 can be modeled by the following equations:<br />
<br />
<br><br />
<br />
[[Image:Equazioni.jpg|center]]<br />
<br />
<br><br />
<br />
Symbol definition is listed in Table 1.<br />
<br />
<br><br />
<br />
[[Image:Tabella simboli.jpg|center]]<br />
<br />
<br><br />
<br />
A common motif in repressor proteins is the presence of a dimeric nucleotide-binding site with dimeric structure. In accordance to this general structure the cooperativity coefficients ([[Image:mu.jpg]]) were assumed equal to 2. The maximum velocity of repressor synthesis ([[Image:alfa.jpg]]) accounts for the strength of the unregulated promoter and RBS. The value of the affinity constant for the binding of repressor to the promoter strictly depends on the sequence of operator site (OS block).<br />
<br />
<br><br />
<br />
'''<font size="3">Adimensional equations</font>'''<br />
<br />
<br><br />
The equations (1.1) and (1.2) can be written dimensionless:<br />
<br />
<br />
[[Image:sistemaequazioni.jpg|center]]<br />
<br />
Where:<br />
<br />
<br><br />
<br />
[[Image:accozz.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Equibrium conditions ==<br />
<br />
In the absence of stimuli, the adimensional concentrations of LacI ([[Image:i.jpg]]) and TetR ([[Image:r.jpg]]) at equilibrium are related by the equations: <br />
<br />
[[Image:equa3new.jpg|center]]<br />
<br><br />
To obtain these relations the UVc-dependent term in equation (1.4) was ignored ([[Image:appr.jpg]] ). This is justified by the high binding constant of LexA for its operator, and the consequent negligible contribution to the LacI synthesis.<br />
Equations (1.6) and (1.7) can have one or three solutions that represent the equilibrium conditions of the circuit. The solutions, i.e. the equilibrium conditions, can be graphically identified as the intersections between [[Image:r.jpg]] and [[Image:i.jpg]] nullclines (see Figure 2). The case of multiple equilibrium conditions (bistability case) is shown in Figure 2 panel b. TetR-ON and LacI-ON are stable equilibriums separated by the unstable one (saddle point). Due to the bistability the circuit can operate as a binary memory. <br />
The existence of a bistability condition depends on the value of [[Image:kr.jpg]] and [[Image:ki.jpg]] parameters. If [[Image:kr.jpg]] decrease (see Figure 2 panel a) a saddle-node bifurcation can occur, TetR-ON equilibrium vanishes and remain only the stable equilibrium LacI-ON. The contrary occurs when [[Image:ki.jpg]] is decreased (Figure 2 panel c). Thus bistability is guaranteed only for a limited range of [[Image:ki.jpg]] and [[Image:kr.jpg]] values. <br />
<br />
<br><br />
<br />
[[Image:equicondition.jpg|900px|center|thumbnail|Figure 2: Equilibrium conditions]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Bifurcation analysis ==<br />
<br><br />
<br />
Assuming that LacI-ON exists the corresponding equilibrium value of [[Image:i.jpg]] is higher than 1 (see Figure 2), then it can be assumed that [[Image:iquadro.jpg]] and the equation (1.7) simplies to:<br />
<br />
[[Image:equa1_8b.jpg|center]]<br />
<br />
<br><br />
Substituting this expression in equation (1.6) one obtain:<br />
[[Image:equa1_9b.jpg|center]]<br><br />
Then:<br />
<br><br />
<br />
[[Image:equa1_10b.jpg|center]]<br />
<br />
<br><br />
To be real the solutions of equation (1.10) it is necessary that [[Image:krdis.jpg]] (see Figure 3). Under this condition the existence of the LacI-ON state is assured. When [[Image:kreq.jpg]] the system undergoes a saddle-node bifurcation (LacI-ON and saddle point go in collision) and the two equilibrium points vanish.<br />
<br><br />
[[Image:SaddleNodebifurcation1.jpg|thumbnail|center|500 px|Figure 3: Saddle-Node bifurcation]]<br />
<br><br />
An analogous result can be obtained for the existence of the TetR-ON state. Thus, a sufficient condition for bistability is:<br />
<br />
<br><br />
<br />
[[Image:Equa1_11_12.jpg|center]]<br />
<br />
<br><br />
<br />
Figure 4 shows the log-log plot of (1.11) and (1.12) <br />
<br />
<br><br />
<br />
[[Image:Rangeofbistability2.jpg|500 px|center|thumbnail|Figure 4: Range of bistability for the genetic Flip-Flop]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Procedure for Ki-index identification ==<br />
<br><br />
The procedure will be described for LacI, analogous procedure can be applied to the TetR case. The value of [[Image:ki.jpg]]-index can be identified comparing the experimental responses of the open loop and closed loop circuits: <br />
<br><br />
{| align="center"<br />
|<br />
<br><br><br />
* Open loop circuit<br />
<br><br><br><br />
* Closed loop circuit<br />
<br><br><br><br><br><br><br><br />
|[[Image:Molecularcircuitini.jpg|thumbnail|500px|Figure 5: Molecular circuits for the Ki-index experimental determination|right]]<br />
|}<br />
<br />
<br />
<br />
The LacI concentration in the open loop circuit is given by:<br />
<br><br />
[[Image:Equa1_13.jpg|center]]<br />
<br><br />
Thus the equilibrium condition is:<br />
<br><br />
[[Image:Equa1_14.jpg|center]]<br />
<br><br />
The time derivative of LacI concentration in the close loop circuit follows:<br />
<br><br />
[[Image:Equa1_15.jpg|center]]<br />
<br><br />
Which gives the equilibrium condition:<br />
<br><br />
[[Image:Equa1_16.jpg|center]]<br />
<br><br />
That can be rewritten <br />
<br><br />
[[Image:Equa1_17.jpg|center]]<br />
<br><br />
The affinity constant can consequently be derived from this expression<br />
<br><br />
[[Image:Equa1_18.jpg|center]]<br />
<br><br />
Inserting the (1.14) and (1.18) in the [[Image:ki.jpg]]-index definition one obtain:<br />
<br><br />
[[Image:Equa1_19b.jpg|center]]<br />
<br><br />
We assume that GFP is proportion to [[Image:imai.jpg]], then<br />
<br><br />
[[Image:Equa1_20.jpg|center]]<br />
<br><br />
We introduce the ratio [[Image:h.jpg]] between the fluorescence in open loop and in closed loop:<br />
<br><br />
[[Image:Equa1_21.jpg|center]]<br />
<br><br />
After measuring the ratio [[Image:h.jpg]] it is possible to calculate [[Image:ki.jpg]] by the curve in Figure 6 and then it is possible to establish by Figure 4 the [[Image:kr.jpg]] range that guarantees bistability. In the presence of an experimentally characterized library of regulated promoter, the procedure can be adopted to design genetic Flip-Flop with desired behaviors.<br><br />
[[Image:indexforlaci1.jpg|center|thumbnail|500 px|Figure 6: Ki-index for LacI]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Numerical simulation==<br />
<br />
[[Image:sim.jpg|center|500 px|thumbnail|Figure 7: State-Plane Trajectories]]<br />
[[Image:iptg4.jpg|center|500 px|thumbnail|Figure 8: Circuit response to IPTG pulse]]<br />
[[Image:UVc1.jpg|center|500 px|thumbnail|Figure 9: Circuit response to UVc radiation]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= SR Latch =<br />
<br />
In digital circuits, a flip-flop is a term referring to an electronic circuit (a bistable multivibrator) that has two stable states and thereby is capable of serving as one bit of memory. Today, the term flip-flop has come to mostly denote non-transparent (clocked or edge-triggered) devices, while the simpler transparent ones are often referred to as '''latches'''; however, as this distinction is quite new, the two words are sometimes used interchangeably.<br />
<br />
A flip-flop is usually controlled by one or two control signals and/or a gate or clock signal. The output often includes the complement as well as the normal output. As flip-flops are implemented electronically, they require power and ground connections.<br />
<br />
Flip-flops can be either simple (transparent) or clocked. Simple flip-flops can be built around a pair of cross-coupled inverting elements: vacuum tubes, bipolar transistors, field effect transistors, inverters, and inverting logic gates have all been used in practical circuits — perhaps augmented by some gating mechanism (an enable/disable input). The more advanced clocked (or non-transparent) devices are specially designed for synchronous (time-discrete) systems; such devices therefore ignores its inputs except at the transition of a dedicated clock signal (known as clocking, pulsing, or strobing). This causes the flip-flop to either change or retain its output signal based upon the values of the input signals at the transition. Some flip-flops change output on the rising edge of the clock, others on the falling edge.<br />
<br />
Our project simulates a SR Latch (Figure 10), the most fundamental latch, where S and R stand for set and reset. It can be constructed from a pair of cross-coupled NOR logic gates. The stored bit is present on the output marked Q (or the complement <span style="text-decoration:overline">Q</span>).<br />
<br />
<br />
[[Image:latchSR.jpg|thumb|350px|Figure 10. SR latch|center]]<br />
<br />
<br />
Normally, in storage mode, the S and R inputs are both low, and feedback maintains the Q and <span style="text-decoration:overline">Q</span> outputs in a constant state. If S (Set) is pulsed high while R is held low, then the Q output is forced high, and stays high when S returns low; similarly, if R (Reset) is pulsed high while S is held low, then the Q output is forced low, and stays low when R returns low (Figure 11).<br />
<br />
<br />
[[Image:tablatchSR.jpg|thumb|300px|Figure 11. SR latch truth table|center]]<br />
<br />
<br />
The R = S = 1 combination is called a restricted combination because, as both NOR gates then output zeros, it breaks the logical equation Q = not <span style="text-decoration:overline">Q</span>. The combination is also inappropriate in circuits where both inputs may go low simultaneously (i.e. a transition from restricted to keep). The output would lock at either 1 or 0 depending on the propagation time relations between the gates (a race condition). In certain implementations, it could also lead to longer ringings (damped oscillations) before the output settles, and thereby result in undetermined values (errors) in high-frequency digital circuits. This condition is therefore sometimes avoided.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
= Operator site library standardization =<br />
<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 '''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
Thus, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor (see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
<br />
- the core region - between the -35 and the -10<br />
<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study its effect on the design of specific promoter with a derired behaviour.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
=UV Spectrum=<br />
Ultraviolet is that part of electromagnetic radiation bounded by the lower wavelength extreme of the visible spectrum and the upper end of the X-ray radiation band. The spectral range of ultraviolet radiation is, by definition, between 100 and 400 nm and is invisible to human eyes. The UV spectrum is subdivided into three bands: UV-A (long-wave) from 315 to 400 nm, UV-B (medium-wave) from 280 to 315 nm, UV-C (short-wave) from 100 to 280 nm. A strong germicidal effect is provided by the radiation in the short-wave UV-C band. <br />
<br><br />
[[Image:spettro.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= E.coli SOS System =<br />
[[Image:sopravvivenza.jpg|300px|thumbnail|Fig.1 E.Coli Survival curve|right]]<br />
<br />
<br><br><br />
The maximum UV germicidal effect coincides with the peak absorbance of DNA (near 260nm) due to the dimerization of two adjacent thymines. That can be seen in the Fig.1 where is showed the living population of bacteria after irradiation. <br />
E.Coli cells have a system that recovery DNA damage when it occurs and it is the best studied transcriptional response ''[1]''. <br />
<br><br><br><br />
This systems can be divided into two class: the SOS Photoreactivation repair and the SOS respond triggered by RecA protein. The first uses the photolyase, a poorly expressed enzyme(encoded by genes phrA and phrB) which binds the pyrimidine dimers and uses the blue light to split them apart as showed in Fig.2.<br />
<br><br><br><br><br><br><br />
[[Image:fosfoliasi.jpg|300px|thumbnail|Fig.2 After dimerization of two adjacent thymines blue light gives energy to photolyase to repair the damage |left]]<br />
<br />
<br />
<br />
<br><br />
Instead single stranded DNA produced by several DNA-damaging agents can be bound by RecA protein, resulting in conversion of this protein to its activated form. The RecA repair system doesn’t need light and Lexa protein controls the expression of 43 genes ''[2]'' that cooperate together to repair the extensive genetic damage. RecA and LexA proteins play an important rule on the regulatory of SOS Recombination System. <br />
A LexA binding site is present in all the SOS promoters genes' and it works as a repressor of SOS system. In presence of DNA damage (DNA Single Strains) RecA becomes active and interacts with LexA protein , the repressor of the SOS genes ''[3]''. This interaction triggers the autocatalytic cleavage of LexA and consequent destruction of its ability to function as a repressor, which results in the derepression of SOS genes ''[4] [5]''<br />
<br><br><br><br><br><br><br />
When the damage is repaired, DNA single strains are not present in the cell and the RecA protein no longer promotes the auto-cleavage of the LexA which is restored to its initial repression level.<br><br><br><br />
{| align=center<br />
|[[Image:soslexa.jpg]]<br />
|width=70|<br />
|[[Image:lexa.jpg]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= Bibliography =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2008-10-29T12:47:36Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Model-based analysis of the genetic Flip-Flop =<br />
<br />
== The genetic Flip-Flop ==<br />
<br />
[[Image:Circuito2.jpg|300px|thumb|right|Figure 1: Scheme of the genetic Flip-Flop]] <br />
<div style="text-align:justify"><br />
The molecular circuit in Figure 1 can switch between two different stable states (LacI-ON and TetR-ON), driven by two external stimuli (UVc and IPTG). LacI-ON represents the stable state where the LacI gene is active and LacI protein represses TetR gene expression, in a positive feedback. Therefore, the LacI-ON state coincides with the TetR-OFF condition. On the contrary, the TetR-ON represents the state with the TetR gene active and the LacI gene silenced (LacI-OFF). Owing to the coexistence of two stable states (bistability), this circuit is capable of serving as a binary of memory. We denominated it a Flip-Flop since it works as a SR Latch: LacI state is the [[Image:q.jpg]] output and TetR state is the [[Image:qneg.jpg]] output. Uvc is the set signal and IPTG is the reset signal. Indeed, IPTG stimulation inhibits LacI repressor, thus can cause the transition from the LacI-ON state to the TetR-ON. UVc radiation, inactivating LexA repressor through the SOS response (Friedberg et al., 1995) can cause the opposite transition from LacI-ON to TetR-ON.<br />
<br />
<br><br><br><br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Mathematical Model ==<br />
<br />
<br />
'''<font size="3">Model equations</font>'''<br />
<br />
<br><br />
The Flip-Flop circuit in Figure 1 can be modeled by the following equations:<br />
<br />
<br><br />
<br />
[[Image:Equazioni.jpg|center]]<br />
<br />
<br><br />
<br />
Symbol definition is listed in Table 1.<br />
<br />
<br><br />
<br />
[[Image:Tabella simboli.jpg|center]]<br />
<br />
<br><br />
<br />
A common motif in repressor proteins is the presence of a dimeric nucleotide-binding site with dimeric structure. In accordance to this general structure the cooperativity coefficients ([[Image:mu.jpg]]) were assumed equal to 2. The maximum velocity of repressor synthesis ([[Image:alfa.jpg]]) accounts for the strength of the unregulated promoter and RBS. The value of the affinity constant for the binding of repressor to the promoter strictly depends on the sequence of operator site (OS block).<br />
<br />
<br><br />
<br />
'''<font size="3">Adimensional equations</font>'''<br />
<br />
<br><br />
The equations (1.1) and (1.2) can be written dimensionless:<br />
<br />
<br />
[[Image:sistemaequazioni.jpg|center]]<br />
<br />
Where:<br />
<br />
<br><br />
<br />
[[Image:accozz.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Equibrium conditions ==<br />
<br />
In the absence of stimuli, the adimensional concentrations of LacI ([[Image:i.jpg]]) and TetR ([[Image:r.jpg]]) at equilibrium are related by the equations: <br />
<br />
[[Image:equa3new.jpg|center]]<br />
<br><br />
To obtain these relations the UVc-dependent term in equation (1.4) was ignored ([[Image:appr.jpg]] ). This is justified by the high binding constant of LexA for its operator, and the consequent negligible contribution to the LacI synthesis.<br />
Equations (1.6) and (1.7) can have one or three solutions that represent the equilibrium conditions of the circuit. The solutions, i.e. the equilibrium conditions, can be graphically identified as the intersections between [[Image:r.jpg]] and [[Image:i.jpg]] nullclines (see Figure 2). The case of multiple equilibrium conditions (bistability case) is shown in Figure 2 panel b. TetR-ON and LacI-ON are stable equilibriums separated by the unstable one (saddle point). Due to the bistability the circuit can operate as a binary memory. <br />
The existence of a bistability condition depends on the value of [[Image:kr.jpg]] and [[Image:ki.jpg]] parameters. If [[Image:kr.jpg]] decrease (see Figure 2 panel a) a saddle-node bifurcation can occur, TetR-ON equilibrium vanishes and remain only the stable equilibrium LacI-ON. The contrary occurs when [[Image:ki.jpg]] is decreased (Figure 2 panel c). Thus bistability is guaranteed only for a limited range of [[Image:ki.jpg]] and [[Image:kr.jpg]] values. <br />
<br />
<br><br />
<br />
[[Image:equicondition.jpg|900px|center|thumbnail|Figure 2: Equilibrium conditions]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Bifurcation analysis ==<br />
<br><br />
<br />
Assuming that LacI-ON exists the corresponding equilibrium value of [[Image:i.jpg]] is higher than 1 (see Figure 2), then it can be assumed that [[Image:iquadro.jpg]] and the equation (1.7) simplies to:<br />
<br />
[[Image:equa1_8b.jpg|center]]<br />
<br />
<br><br />
Substituting this expression in equation (1.6) one obtain:<br />
[[Image:equa1_9b.jpg|center]]<br><br />
Then:<br />
<br><br />
<br />
[[Image:equa1_10b.jpg|center]]<br />
<br />
<br><br />
To be real the solutions of equation (1.10) it is necessary that [[Image:krdis.jpg]] (see Figure 3). Under this condition the existence of the LacI-ON state is assured. When [[Image:kreq.jpg]] the system undergoes a saddle-node bifurcation (LacI-ON and saddle point go in collision) and the two equilibrium points vanish.<br />
<br><br />
[[Image:SaddleNodebifurcation1.jpg|thumbnail|center|500 px|Figure 3: Saddle-Node bifurcation]]<br />
<br><br />
An analogous result can be obtained for the existence of the TetR-ON state. Thus, a sufficient condition for bistability is:<br />
<br />
<br><br />
<br />
[[Image:Equa1_11_12.jpg|center]]<br />
<br />
<br><br />
<br />
Figure 4 shows the log-log plot of (1.11) and (1.12) <br />
<br />
<br><br />
<br />
[[Image:Rangeofbistability2.jpg|500 px|center|thumbnail|Figure 4: Range of bistability for the genetic Flip-Flop]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Procedure for Ki-index identification ==<br />
<br><br />
The procedure will be described for LacI, analogous procedure can be applied to the TetR case. The value of [[Image:ki.jpg]]-index can be identified comparing the experimental responses of the open loop and closed loop circuits: <br />
<br><br />
{| align="center"<br />
|<br />
<br><br><br />
* Open loop circuit<br />
<br><br><br><br />
* Closed loop circuit<br />
<br><br><br><br><br><br><br><br />
|[[Image:Molecularcircuitini.jpg|thumbnail|500px|Figure 5: Molecular circuits for the Ki-index experimental determination|right]]<br />
|}<br />
<br />
<br />
<br />
The LacI concentration in the open loop circuit is given by:<br />
<br><br />
[[Image:Equa1_13.jpg|center]]<br />
<br><br />
Thus the equilibrium condition is:<br />
<br><br />
[[Image:Equa1_14.jpg|center]]<br />
<br><br />
The time derivative of LacI concentration in the close loop circuit follows:<br />
<br><br />
[[Image:Equa1_15.jpg|center]]<br />
<br><br />
Which gives the equilibrium condition:<br />
<br><br />
[[Image:Equa1_16.jpg|center]]<br />
<br><br />
That can be rewritten <br />
<br><br />
[[Image:Equa1_17.jpg|center]]<br />
<br><br />
The affinity constant can consequently be derived from this expression<br />
<br><br />
[[Image:Equa1_18.jpg|center]]<br />
<br><br />
Inserting the (1.14) and (1.18) in the [[Image:ki.jpg]]-index definition one obtain:<br />
<br><br />
[[Image:Equa1_19b.jpg|center]]<br />
<br><br />
We assume that GFP is proportion to [[Image:imai.jpg]], then<br />
<br><br />
[[Image:Equa1_20.jpg|center]]<br />
<br><br />
We introduce the ratio [[Image:h.jpg]] between the fluorescence in open loop and in closed loop:<br />
<br><br />
[[Image:Equa1_21.jpg|center]]<br />
<br><br />
After measuring the ratio [[Image:h.jpg]] it is possible to calculate [[Image:ki.jpg]] by the curve in Figure 6 and then it is possible to establish by Figure 4 the [[Image:kr.jpg]] range that guarantees bistability. In the presence of an experimentally characterized library of regulated promoter, the procedure can be adopted to design genetic Flip-Flop with desired behaviors.<br><br />
[[Image:indexforlaci1.jpg|center|thumbnail|500 px|Figure 6: Ki-index for LacI]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Numerical simulation==<br />
<br />
[[Image:sim.jpg|center|500 px|thumbnail|Figure 7: State-Plane Trajectories]]<br />
[[Image:iptg4.jpg|center|500 px|thumbnail|Figure 8: Circuit response to IPTG pulse]]<br />
[[Image:UVc1.jpg|center|500 px|thumbnail|Figure 9: Circuit response to UVc radiation]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= SR Latch =<br />
<br />
In digital circuits, a flip-flop is a term referring to an electronic circuit (a bistable multivibrator) that has two stable states and thereby is capable of serving as one bit of memory. Today, the term flip-flop has come to mostly denote non-transparent (clocked or edge-triggered) devices, while the simpler transparent ones are often referred to as '''latches'''; however, as this distinction is quite new, the two words are sometimes used interchangeably.<br />
<br />
A flip-flop is usually controlled by one or two control signals and/or a gate or clock signal. The output often includes the complement as well as the normal output. As flip-flops are implemented electronically, they require power and ground connections.<br />
<br />
Flip-flops can be either simple (transparent) or clocked. Simple flip-flops can be built around a pair of cross-coupled inverting elements: vacuum tubes, bipolar transistors, field effect transistors, inverters, and inverting logic gates have all been used in practical circuits — perhaps augmented by some gating mechanism (an enable/disable input). The more advanced clocked (or non-transparent) devices are specially designed for synchronous (time-discrete) systems; such devices therefore ignores its inputs except at the transition of a dedicated clock signal (known as clocking, pulsing, or strobing). This causes the flip-flop to either change or retain its output signal based upon the values of the input signals at the transition. Some flip-flops change output on the rising edge of the clock, others on the falling edge.<br />
<br />
Our project simulates a SR Latch (Figure 10), the most fundamental latch, where S and R stand for set and reset. It can be constructed from a pair of cross-coupled NOR logic gates. The stored bit is present on the output marked Q (or the complement <span style="text-decoration:overline">Q</span>).<br />
<br />
<br />
[[Image:latchSR.jpg|thumb|350px|Figure 10. SR latch|center]]<br />
<br />
<br />
Normally, in storage mode, the S and R inputs are both low, and feedback maintains the Q and <span style="text-decoration:overline">Q</span> outputs in a constant state. If S (Set) is pulsed high while R is held low, then the Q output is forced high, and stays high when S returns low; similarly, if R (Reset) is pulsed high while S is held low, then the Q output is forced low, and stays low when R returns low (Figure 11).<br />
<br />
<br />
[[Image:tablatchSR.jpg|thumb|300px|Figure 11. SR latch truth table|center]]<br />
<br />
<br />
The R = S = 1 combination is called a restricted combination because, as both NOR gates then output zeros, it breaks the logical equation Q = not <span style="text-decoration:overline">Q</span>. The combination is also inappropriate in circuits where both inputs may go low simultaneously (i.e. a transition from restricted to keep). The output would lock at either 1 or 0 depending on the propagation time relations between the gates (a race condition). In certain implementations, it could also lead to longer ringings (damped oscillations) before the output settles, and thereby result in undetermined values (errors) in high-frequency digital circuits. This condition is therefore sometimes avoided.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
= Operator site library standardization =<br />
<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 '''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
Thus, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor (see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
<br />
- the core region - between the -35 and the -10<br />
<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
=UV Spectrum=<br />
Ultraviolet is that part of electromagnetic radiation bounded by the lower wavelength extreme of the visible spectrum and the upper end of the X-ray radiation band. The spectral range of ultraviolet radiation is, by definition, between 100 and 400 nm and is invisible to human eyes. The UV spectrum is subdivided into three bands: UV-A (long-wave) from 315 to 400 nm, UV-B (medium-wave) from 280 to 315 nm, UV-C (short-wave) from 100 to 280 nm. A strong germicidal effect is provided by the radiation in the short-wave UV-C band. <br />
<br><br />
[[Image:spettro.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= E.coli SOS System =<br />
[[Image:sopravvivenza.jpg|300px|thumbnail|Fig.1 E.Coli Survival curve|right]]<br />
<br />
<br><br><br />
The maximum UV germicidal effect coincides with the peak absorbance of DNA (near 260nm) due to the dimerization of two adjacent thymines. That can be seen in the Fig.1 where is showed the living population of bacteria after irradiation. <br />
E.Coli cells have a system that recovery DNA damage when it occurs and it is the best studied transcriptional response ''[1]''. <br />
<br><br><br><br />
This systems can be divided into two class: the SOS Photoreactivation repair and the SOS respond triggered by RecA protein. The first uses the photolyase, a poorly expressed enzyme(encoded by genes phrA and phrB) which binds the pyrimidine dimers and uses the blue light to split them apart as showed in Fig.2.<br />
<br><br><br><br><br><br><br />
[[Image:fosfoliasi.jpg|300px|thumbnail|Fig.2 After dimerization of two adjacent thymines blue light gives energy to photolyase to repair the damage |left]]<br />
<br />
<br />
<br />
<br><br />
Instead single stranded DNA produced by several DNA-damaging agents can be bound by RecA protein, resulting in conversion of this protein to its activated form. The RecA repair system doesn’t need light and Lexa protein controls the expression of 43 genes ''[2]'' that cooperate together to repair the extensive genetic damage. RecA and LexA proteins play an important rule on the regulatory of SOS Recombination System. <br />
A LexA binding site is present in all the SOS promoters genes' and it works as a repressor of SOS system. In presence of DNA damage (DNA Single Strains) RecA becomes active and interacts with LexA protein , the repressor of the SOS genes ''[3]''. This interaction triggers the autocatalytic cleavage of LexA and consequent destruction of its ability to function as a repressor, which results in the derepression of SOS genes ''[4] [5]''<br />
<br><br><br><br><br><br><br />
When the damage is repaired, DNA single strains are not present in the cell and the RecA protein no longer promotes the auto-cleavage of the LexA which is restored to its initial repression level.<br><br><br><br />
{| align=center<br />
|[[Image:soslexa.jpg]]<br />
|width=70|<br />
|[[Image:lexa.jpg]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= Bibliography =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2008-10-29T12:42:41Z<p>Francesca ceroni: /* Operator site library standardization */</p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br />
<br />
<div style="text-align:justify"><br />
= Model-based analysis of the genetic Flip-Flop =<br />
<br />
== The genetic Flip-Flop ==<br />
<br />
[[Image:Circuito2.jpg|300px|thumb|right|Figure 1: Scheme of the genetic Flip-Flop]] <br />
<div style="text-align:justify"><br />
The molecular circuit in Figure 1 can switch between two different stable states (LacI-ON and TetR-ON), driven by two external stimuli (UVc and IPTG). LacI-ON represents the stable state where the LacI gene is active and LacI protein represses TetR gene expression, in a positive feedback. Therefore, the LacI-ON state coincides with the TetR-OFF condition. On the contrary, the TetR-ON represents the state with the TetR gene active and the LacI gene silenced (LacI-OFF). Owing to the coexistence of two stable states (bistability), this circuit is capable of serving as a binary of memory. We denominated it a Flip-Flop since it works as a SR Latch: LacI state is the [[Image:q.jpg]] output and TetR state is the [[Image:qneg.jpg]] output. Uvc is the set signal and IPTG is the reset signal. Indeed, IPTG stimulation inhibits LacI repressor, thus can cause the transition from the LacI-ON state to the TetR-ON. UVc radiation, inactivating LexA repressor through the SOS response (Friedberg et al., 1995) can cause the opposite transition from LacI-ON to TetR-ON.<br />
<br />
<br><br><br><br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Mathematical Model ==<br />
<br />
<br />
'''<font size="3">Model equations</font>'''<br />
<br />
<br><br />
The Flip-Flop circuit in Figure 1 can be modeled by the following equations:<br />
<br />
<br><br />
<br />
[[Image:Equazioni.jpg|center]]<br />
<br />
<br><br />
<br />
Symbol definition is listed in Table 1.<br />
<br />
<br><br />
<br />
[[Image:Tabella simboli.jpg|center]]<br />
<br />
<br><br />
<br />
A common motif in repressor proteins is the presence of a dimeric nucleotide-binding site with dimeric structure. In accordance to this general structure the cooperativity coefficients ([[Image:mu.jpg]]) were assumed equal to 2. The maximum velocity of repressor synthesis ([[Image:alfa.jpg]]) accounts for the strength of the unregulated promoter and RBS. The value of the affinity constant for the binding of repressor to the promoter strictly depends on the sequence of operator site (OS block).<br />
<br />
<br><br />
<br />
'''<font size="3">Adimensional equations</font>'''<br />
<br />
<br><br />
The equations (1.1) and (1.2) can be written dimensionless:<br />
<br />
<br />
[[Image:sistemaequazioni.jpg|center]]<br />
<br />
Where:<br />
<br />
<br><br />
<br />
[[Image:accozz.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Equibrium conditions ==<br />
<br />
In the absence of stimuli, the adimensional concentrations of LacI ([[Image:i.jpg]]) and TetR ([[Image:r.jpg]]) at equilibrium are related by the equations: <br />
<br />
[[Image:equa3new.jpg|center]]<br />
<br><br />
To obtain these relations the UVc-dependent term in equation (1.4) was ignored ([[Image:appr.jpg]] ). This is justified by the high binding constant of LexA for its operator, and the consequent negligible contribution to the LacI synthesis.<br />
Equations (1.6) and (1.7) can have one or three solutions that represent the equilibrium conditions of the circuit. The solutions, i.e. the equilibrium conditions, can be graphically identified as the intersections between [[Image:r.jpg]] and [[Image:i.jpg]] nullclines (see Figure 2). The case of multiple equilibrium conditions (bistability case) is shown in Figure 2 panel b. TetR-ON and LacI-ON are stable equilibriums separated by the unstable one (saddle point). Due to the bistability the circuit can operate as a binary memory. <br />
The existence of a bistability condition depends on the value of [[Image:kr.jpg]] and [[Image:ki.jpg]] parameters. If [[Image:kr.jpg]] decrease (see Figure 2 panel a) a saddle-node bifurcation can occur, TetR-ON equilibrium vanishes and remain only the stable equilibrium LacI-ON. The contrary occurs when [[Image:ki.jpg]] is decreased (Figure 2 panel c). Thus bistability is guaranteed only for a limited range of [[Image:ki.jpg]] and [[Image:kr.jpg]] values. <br />
<br />
<br><br />
<br />
[[Image:equicondition.jpg|900px|center|thumbnail|Figure 2: Equilibrium conditions]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Bifurcation analysis ==<br />
<br><br />
<br />
Assuming that LacI-ON exists the corresponding equilibrium value of [[Image:i.jpg]] is higher than 1 (see Figure 2), then it can be assumed that [[Image:iquadro.jpg]] and the equation (1.7) simplies to:<br />
<br />
[[Image:equa1_8b.jpg|center]]<br />
<br />
<br><br />
Substituting this expression in equation (1.6) one obtain:<br />
[[Image:equa1_9b.jpg|center]]<br><br />
Then:<br />
<br><br />
<br />
[[Image:equa1_10b.jpg|center]]<br />
<br />
<br><br />
To be real the solutions of equation (1.10) it is necessary that [[Image:krdis.jpg]] (see Figure 3). Under this condition the existence of the LacI-ON state is assured. When [[Image:kreq.jpg]] the system undergoes a saddle-node bifurcation (LacI-ON and saddle point go in collision) and the two equilibrium points vanish.<br />
<br><br />
[[Image:SaddleNodebifurcation1.jpg|thumbnail|center|500 px|Figure 3: Saddle-Node bifurcation]]<br />
<br><br />
An analogous result can be obtained for the existence of the TetR-ON state. Thus, a sufficient condition for bistability is:<br />
<br />
<br><br />
<br />
[[Image:Equa1_11_12.jpg|center]]<br />
<br />
<br><br />
<br />
Figure 4 shows the log-log plot of (1.11) and (1.12) <br />
<br />
<br><br />
<br />
[[Image:Rangeofbistability2.jpg|500 px|center|thumbnail|Figure 4: Range of bistability for the genetic Flip-Flop]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Procedure for Ki-index identification ==<br />
<br><br />
The procedure will be described for LacI, analogous procedure can be applied to the TetR case. The value of [[Image:ki.jpg]]-index can be identified comparing the experimental responses of the open loop and closed loop circuits: <br />
<br><br />
{| align="center"<br />
|<br />
<br><br><br />
* Open loop circuit<br />
<br><br><br><br />
* Closed loop circuit<br />
<br><br><br><br><br><br><br><br />
|[[Image:Molecularcircuitini.jpg|thumbnail|500px|Figure 5: Molecular circuits for the Ki-index experimental determination|right]]<br />
|}<br />
<br />
<br />
<br />
The LacI concentration in the open loop circuit is given by:<br />
<br><br />
[[Image:Equa1_13.jpg|center]]<br />
<br><br />
Thus the equilibrium condition is:<br />
<br><br />
[[Image:Equa1_14.jpg|center]]<br />
<br><br />
The time derivative of LacI concentration in the close loop circuit follows:<br />
<br><br />
[[Image:Equa1_15.jpg|center]]<br />
<br><br />
Which gives the equilibrium condition:<br />
<br><br />
[[Image:Equa1_16.jpg|center]]<br />
<br><br />
That can be rewritten <br />
<br><br />
[[Image:Equa1_17.jpg|center]]<br />
<br><br />
The affinity constant can consequently be derived from this expression<br />
<br><br />
[[Image:Equa1_18.jpg|center]]<br />
<br><br />
Inserting the (1.14) and (1.18) in the [[Image:ki.jpg]]-index definition one obtain:<br />
<br><br />
[[Image:Equa1_19b.jpg|center]]<br />
<br><br />
We assume that GFP is proportion to [[Image:imai.jpg]], then<br />
<br><br />
[[Image:Equa1_20.jpg|center]]<br />
<br><br />
We introduce the ratio [[Image:h.jpg]] between the fluorescence in open loop and in closed loop:<br />
<br><br />
[[Image:Equa1_21.jpg|center]]<br />
<br><br />
After measuring the ratio [[Image:h.jpg]] it is possible to calculate [[Image:ki.jpg]] by the curve in Figure 6 and then it is possible to establish by Figure 4 the [[Image:kr.jpg]] range that guarantees bistability. In the presence of an experimentally characterized library of regulated promoter, the procedure can be adopted to design genetic Flip-Flop with desired behaviors.<br><br />
[[Image:indexforlaci1.jpg|center|thumbnail|500 px|Figure 6: Ki-index for LacI]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
== Numerical simulation==<br />
<br />
[[Image:sim.jpg|center|500 px|thumbnail|Figure 7: State-Plane Trajectories]]<br />
[[Image:iptg4.jpg|center|500 px|thumbnail|Figure 8: Circuit response to IPTG pulse]]<br />
[[Image:UVc1.jpg|center|500 px|thumbnail|Figure 9: Circuit response to UVc radiation]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= SR Latch =<br />
<br />
In digital circuits, a flip-flop is a term referring to an electronic circuit (a bistable multivibrator) that has two stable states and thereby is capable of serving as one bit of memory. Today, the term flip-flop has come to mostly denote non-transparent (clocked or edge-triggered) devices, while the simpler transparent ones are often referred to as '''latches'''; however, as this distinction is quite new, the two words are sometimes used interchangeably.<br />
<br />
A flip-flop is usually controlled by one or two control signals and/or a gate or clock signal. The output often includes the complement as well as the normal output. As flip-flops are implemented electronically, they require power and ground connections.<br />
<br />
Flip-flops can be either simple (transparent) or clocked. Simple flip-flops can be built around a pair of cross-coupled inverting elements: vacuum tubes, bipolar transistors, field effect transistors, inverters, and inverting logic gates have all been used in practical circuits — perhaps augmented by some gating mechanism (an enable/disable input). The more advanced clocked (or non-transparent) devices are specially designed for synchronous (time-discrete) systems; such devices therefore ignores its inputs except at the transition of a dedicated clock signal (known as clocking, pulsing, or strobing). This causes the flip-flop to either change or retain its output signal based upon the values of the input signals at the transition. Some flip-flops change output on the rising edge of the clock, others on the falling edge.<br />
<br />
Our project simulates a SR Latch (Figure 10), the most fundamental latch, where S and R stand for set and reset. It can be constructed from a pair of cross-coupled NOR logic gates. The stored bit is present on the output marked Q (or the complement <span style="text-decoration:overline">Q</span>).<br />
<br />
<br />
[[Image:latchSR.jpg|thumb|350px|Figure 10. SR latch|center]]<br />
<br />
<br />
Normally, in storage mode, the S and R inputs are both low, and feedback maintains the Q and <span style="text-decoration:overline">Q</span> outputs in a constant state. If S (Set) is pulsed high while R is held low, then the Q output is forced high, and stays high when S returns low; similarly, if R (Reset) is pulsed high while S is held low, then the Q output is forced low, and stays low when R returns low (Figure 11).<br />
<br />
<br />
[[Image:tablatchSR.jpg|thumb|300px|Figure 11. SR latch truth table|center]]<br />
<br />
<br />
The R = S = 1 combination is called a restricted combination because, as both NOR gates then output zeros, it breaks the logical equation Q = not <span style="text-decoration:overline">Q</span>. The combination is also inappropriate in circuits where both inputs may go low simultaneously (i.e. a transition from restricted to keep). The output would lock at either 1 or 0 depending on the propagation time relations between the gates (a race condition). In certain implementations, it could also lead to longer ringings (damped oscillations) before the output settles, and thereby result in undetermined values (errors) in high-frequency digital circuits. This condition is therefore sometimes avoided.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Project ''Up'']<br />
<br />
= Operator site library standardization =<br />
<br />
Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 '''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor (see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
<br />
- the core region - between the -35 and the -10<br />
<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
=UV Spectrum=<br />
Ultraviolet is that part of electromagnetic radiation bounded by the lower wavelength extreme of the visible spectrum and the upper end of the X-ray radiation band. The spectral range of ultraviolet radiation is, by definition, between 100 and 400 nm and is invisible to human eyes. The UV spectrum is subdivided into three bands: UV-A (long-wave) from 315 to 400 nm, UV-B (medium-wave) from 280 to 315 nm, UV-C (short-wave) from 100 to 280 nm. A strong germicidal effect is provided by the radiation in the short-wave UV-C band. <br />
<br><br />
[[Image:spettro.jpg|center]]<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= E.coli SOS System =<br />
[[Image:sopravvivenza.jpg|300px|thumbnail|Fig.1 E.Coli Survival curve|right]]<br />
<br />
<br><br><br />
The maximum UV germicidal effect coincides with the peak absorbance of DNA (near 260nm) due to the dimerization of two adjacent thymines. That can be seen in the Fig.1 where is showed the living population of bacteria after irradiation. <br />
E.Coli cells have a system that recovery DNA damage when it occurs and it is the best studied transcriptional response ''[1]''. <br />
<br><br><br><br />
This systems can be divided into two class: the SOS Photoreactivation repair and the SOS respond triggered by RecA protein. The first uses the photolyase, a poorly expressed enzyme(encoded by genes phrA and phrB) which binds the pyrimidine dimers and uses the blue light to split them apart as showed in Fig.2.<br />
<br><br><br><br><br><br><br />
[[Image:fosfoliasi.jpg|300px|thumbnail|Fig.2 After dimerization of two adjacent thymines blue light gives energy to photolyase to repair the damage |left]]<br />
<br />
<br />
<br />
<br><br />
Instead single stranded DNA produced by several DNA-damaging agents can be bound by RecA protein, resulting in conversion of this protein to its activated form. The RecA repair system doesn’t need light and Lexa protein controls the expression of 43 genes ''[2]'' that cooperate together to repair the extensive genetic damage. RecA and LexA proteins play an important rule on the regulatory of SOS Recombination System. <br />
A LexA binding site is present in all the SOS promoters genes' and it works as a repressor of SOS system. In presence of DNA damage (DNA Single Strains) RecA becomes active and interacts with LexA protein , the repressor of the SOS genes ''[3]''. This interaction triggers the autocatalytic cleavage of LexA and consequent destruction of its ability to function as a repressor, which results in the derepression of SOS genes ''[4] [5]''<br />
<br><br><br><br><br><br><br />
When the damage is repaired, DNA single strains are not present in the cell and the RecA protein no longer promotes the auto-cleavage of the LexA which is restored to its initial repression level.<br><br><br><br />
{| align=center<br />
|[[Image:soslexa.jpg]]<br />
|width=70|<br />
|[[Image:lexa.jpg]]<br />
|}<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']<br />
<br />
= Bibliography =<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna/Modeling ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:BolognaTeam:Bologna2008-10-29T12:40:26Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
<br><br><br />
<br />
{| align="center"<br />
|[[Image:Logo1.JPG|Logo Bologna|450px]] <br />
|width=70| <br />
|[[Image:Uv2.JPG|Logo Bologna|400px]]<br />
|}<br />
<br />
<br><br><br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Project|PROJECT]]<br />
|contenuto=[[Image:Nome_Progetto2.png|550px|left|Nome Progetto]]<br />
Our project aims to design a bacterial reprogrammable memory with genetically engineered E.coli colonies in solid medium working as an array of binary memory cells. To engineer bacteria we designed a genetic flip-flop (SR Latch) composed of a binary memory and an UV sensitive trigger. We chose UV to have a fine spatial selectivity in programming the cells and IPTG to reset all the memory cells. We designed the circuit by model-based analysis. Core elements of the genetic memory are two mutually regulated promoters. Each promoter has as an operator site flanking a constitutive promoter. Thus, promoter transcriptional strength and repressor binding affinity can be independently fixed. Operators for LacI, TetR, Lambda and LexA repressors were cloned as BioBricks to allow the rational design of regulated promoters that is still lacking in the Registry. A simple procedure was established to characterize the regulated promoter. We expect these parts to be a benefit in many Synthetic Biology applications. [[Team:Bologna/Project|Click here for more information...]]<br />
<br><br><br />
}}<br />
<br />
<br />
<div style="float:left; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Team|TEAM]]<br />
|contenuto=[[Image:TeamBo2.JPG|250px|right]]<br />
The rationale underpinning the fundations of the Ecoli.PROM team consists in the synergistical collaboration of a number of various young experts in precise areas of science. Such elements will feed into the group the expertise and know-how in Biotechnology, Electronic and Biomedical engineering with the additional support of pharmacists and models experts.<br />
The innovation will indeed lie in this compound effort, directed towards the driving of synthetic biology to implement a system working as a result of complex biological activity, rather than conventional electronic elaboration. [[Team:Bologna/Team|Click here for more information...]]<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Modeling|MODELING]]<br />
|contenuto=[[Image:Circuito2.jpg|280px|right]]<br />
The aim of this work area is to determine the characteristics of the promoters that form the circuit. In this section are also collected a brief description of our model, all the equations that describe analytically our circuit, the most meaningful graphics and the results of simulations. [[Team:Bologna/Modeling|Enjoy yourself!]]<br />
<br><br />
}}<br />
</div><br />
<div style="float:right; width:49.5%"><br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Software|SOFTWARE]]<br />
|contenuto=[[Image:cuscino.JPG|260px|right]]<br />
Into this section you can find the very useful softwares we developed for this competition. The first of them realizes a fluorescence image analysis using two parameters: the bacteria dimensions and the standard deviation and mean fluorescence ratio. The second makes possible to find the registered parts you are searching for in a quick and easy way, to identify their sequence and display parts with similar behaviour. You can also download them from this [[Team:Bologna/Software|page]].<br />
<br><br />
}}<br />
<br />
<br />
{{Bologna/finestra100<br />
|titolo=[[Team:Bologna/Notebook|WET LAB]]<br />
|contenuto=[[Image:Collage2.JPG|440px|left]]<br />
<br><br><br><br><br><br><br><br />
Here's all our lab work: week by week you can find all the adopted procedures, links to the registry of standard parts and protocols. The chronological structure of this section, organized as a notebook, mirrors the real development of our project and respects the pure iGEM style.<br />
<br><br />
[[Team:Bologna/Notebook|Go to the page!]]<br />
}}<br />
</div><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
= Aknowledgements =<br />
Our Team is funded by:<br />
<br />
<br><br />
<br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:AlmaMaterStudiorum.jpg|center]]<br />
<br />
<br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|center|800px]]<br />
<br />
<br><br><br />
----<br />
<br />
<br />
[https://2008.igem.org/Team:Bologna ''Up'']</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T09:17:45Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br><br />
[[Image:Collage2.jpg|700px]]<br />
<br />
Operator site library standardization<br />
<br />
Even tough transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 '''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor(see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
<br />
- the core region - between the -35 and the -10<br />
<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
<br />
<br />
Single operator isolation</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T09:04:43Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br><br />
[[Image:Collage2.jpg|700px]]<br />
<br />
Operator site library standardization<br />
<br />
Even tough transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 '''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor(see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
<br />
- the core region - between the -35 and the -10<br />
<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
At the first, we designed a synthetic circuit, composed of the Lac operator sites downstream of the BBa_J23118 promoter controlling the LacI and GFP protein synthesis. These constructs, were meant to allow the characterization of the operator- repressor binding affinity effect on promoter activation.<br />
<br />
<br />
Single operator isolation</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T09:04:05Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
Operator site library standardization<br />
<br />
Even tough transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 '''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor(see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
- the core region - between the -35 and the -10<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
At the first, we designed a synthetic circuit, composed of the Lac operator sites downstream of the BBa_J23118 promoter controlling the LacI and GFP protein synthesis. These constructs, were meant to allow the characterization of the operator- repressor binding affinity effect on promoter activation.<br />
<br />
<br />
Single operator isolation</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T09:03:41Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
Operator site library standardization<br />
<br />
Even tough transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101 constitutive promoters]. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor(see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
- the core region - between the -35 and the -10<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
At the first, we designed a synthetic circuit, composed of the Lac operator sites downstream of the BBa_J23118 promoter controlling the LacI and GFP protein synthesis. These constructs, were meant to allow the characterization of the operator- repressor binding affinity effect on promoter activation.<br />
<br />
<br />
Single operator isolation</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T09:00:16Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
Operator site library standardization<br />
<br />
Even tough transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101/'''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor(see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
- the core region - between the -35 and the -10<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
At the first, we designed a synthetic circuit, composed of the Lac operator sites downstream of the BBa_J23118 promoter controlling the LacI and GFP protein synthesis. These constructs, were meant to allow the characterization of the operator- repressor binding affinity effect on promoter activation.<br />
<br />
<br />
Single operator isolation</div>Francesca ceronihttp://2008.igem.org/Team:Bologna/WetlabTeam:Bologna/Wetlab2008-10-29T08:56:23Z<p>Francesca ceroni: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
body {background-color:#000000}<br />
strong {color: #c09a6d;}<br />
<br />
</style><br />
</html><br />
<br />
{| style="color:#fffff1;background-color:#f6efcd;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="100%" align="center"<br />
[[Image:Logo1a.gif|220px]][[Image:Testata_dx.jpg|745px]]<br />
!align="center"|[[Team:Bologna|HOME]]<br />
!align="center"|[[Team:Bologna/Project|PROJECT]]<br />
!align="center"|[[Team:Bologna/Team|TEAM]]<br />
!align="center"|[[Team:Bologna/Software|SOFTWARE]]<br />
!align="center"|[[Team:Bologna/Modeling|MODELING]]<br />
!align="center"|[[Team:Bologna/Wetlab|WET LAB]]<br />
!align="center"|[[Team:Bologna/Notebook|LAB-BOOK]]<br />
!align="center"|[[Team:Bologna/Parts|SUBMITTED PARTS]]<br />
!align="center"|[[Team:Bologna/Biosafety|BIOSAFETY AND PROTOCOLS]]<br />
|}<br />
<br />
Operator site library standardization<br />
<br />
Even tough transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and characterization of their properties has not been formalized, yet. Even in the Registry, each promoter, though complex, is treated as a “standalone” monolithic element. At present state, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Moreover, the choice of one specific transcription factor limits the choice to one or few possible promoter. The assembly of regulated promoters as the combination of such modular parts, as transcription factor binding sites and operators, could permit the rapid design of devices with desired regulation curves. In fact, in this way, promoter transcriptional strength and repressor binding affinity could be independently fixed. <br />
<br />
A first step in the direction of promoting element rationalization has been done the past year with the inclusion in the Registry of a family of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23101/'''constitutive promoters''']. Each element differs from the other members in the family just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription spanning. We decided to use this valuable work as a platform, a starting point for a deeper and more general design strategy.<br />
<br />
To pursue this aim, we designed an operator sequence library for four commonly used repressor proteins: LacI, TetR, cI and LexA (link figura). For each of these repressors, we got three sequences from the literature (link) with different repressor binding affinities (link Registry), to get a fine modulation of promoter sensitivity to repressor(see Table 1). Then, we isolated each single operator from the library (link al metodo) to assemble it into standard plasmids from the Registry of standard parts. <br />
<br />
Once we get single operators or a combination of them, we can decide to assemble them in different position relatevely to promoter -35 and -10 sequences. It is known from the literature (Cox et al) that the position of an operator site, respectevely to the promoter, plays a crucial role in determining repression or activation. Moreover, even different repression levels can depend on the operator position. The three possible "locations" for operator sequences are:<br />
<br />
- the distal region - upstream the -35 sequence<br />
- the core region - between the -35 and the -10<br />
- the proximal region- downstream the -10 sequence<br />
<br />
Since genomic position affects the operator effect on promoter activation, we decided to take the Berkley's costitutive promoter library as a good "collection" from which we could choose the ideal promoter, depending on the desired transcriptional strengh. Chosen the promoter, we planned to change the operator position to study the effect of position in the design of specific promoter with a derired behaviour.<br />
<br />
At the first, we designed a synthetic circuit, composed of the Lac operator sites downstream of the BBa_J23118 promoter controlling the LacI and GFP protein synthesis. These constructs, were meant to allow the characterization of the operator- repressor binding affinity effect on promoter activation.</div>Francesca ceroni