http://2008.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Blackrabbit&year=&month=2008.igem.org - User contributions [en]2024-03-29T10:35:26ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T06:18:24Z<p>Blackrabbit: /* Reloxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_C0061 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_C0062 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116616 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116619 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116613 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 3R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116655 || Composite || || BBa_K116603 BBa_K116645 || pRE + Portable Synchronizer || pRE + Portable Synchronizer || || || 3R6R5T7<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T05:59:23Z<p>Blackrabbit: /* Reloxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_C0061 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_C0062 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116616 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116619 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116613 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 3R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T05:57:43Z<p>Blackrabbit: /* Reloxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_C0061 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_C0062 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116616 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116619 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T05:56:26Z<p>Blackrabbit: /* Reloxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_C0061 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_C0062 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116616 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T05:33:22Z<p>Blackrabbit: /* Reloxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_C0061 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_C0062 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T05:04:58Z<p>Blackrabbit: /* Results */</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
This was done having little knowledge of what we were actually trying to look for. We just needed some data to get a feel for what kind of information we were looking for, and we also used this experiment as an indicator to how much time the experiment would take and what we could improve upon next time (e.g. how to take the samples from the tubes and put it back in the incubator in the shortest amount of time in order not to affect the experiment too much).<br />
===Method===<br />
Diluted all samples by a 1:100 ratio and let them grow. Measured the OD and fluorescence every hour.<br />
=== Results ===<br />
# Found that doing technical replicates actually makes a lot of difference if you didn't pipette properly.<br />
# If starting with and OD600 of around 0.0325, the fast growth period where we see the most activity lies between 2 to 6 hours. From the next experiment on, we decided to dilute all samples to start off with an OD around 0.0325.<br />
# Other than that, at first we had thought that the fluorescence values were too close to the blank (LB medium), and some even lower than it, so we did not analyse the data. It wasn't until after the third reporting assay we noticed that the measured points did indeed have a sinusoidal shape.<br />
<br />
==Reporting Assay 2==<br />
==Method==<br />
Diluted the samples to start off with an OD600 of 0.0325. Measured the OD600 and a few different excitation/emission wavelengths.<br />
<br />
==Reporting Assay 3==<br />
Hogged the fluorescence measuring machine for 4 hours to let it grow in the machine. Doing this we could measure the fluorescence every five minutes. However, we couldn't measure the OD600.<br />
==Method==<br />
Samples consisted of:<br />
* LB<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Tuner + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
** 500uM IPTG<br />
** 1000uM IPTG<br />
We measured the samples every 5 minutes during the time period between 2 to 6 hours from the time of dilution.<br />
<br />
==Results==<br />
By this point, we were thinking about what we should do about getting "no results" every time since everytime we saw that the fluoresence of the blank sample was higher or similar to the fluoresence of the other samples. Then we plotted of of the samples by itself without the blank and alas! we saw a sinusoidal shape.<br />
<br />
[[Image:NYMU_RA3_sine.png]]<br />
<br />
And our hope was revived!<br />
We grouped similar samples together and plotted them.<br />
<br />
[[Image:NYMU_RA3_osc.png]]<br />
<br />
This is the plot of the oscillators + reporter. (each timestep is 5 minutes)<br />
* Red: 0 IPTG<br />
* Orange: 50 IPTG<br />
<br />
[[Image:NYMU_RA3_osctun.png]]<br />
<br />
This is the plot of the oscillators + tuner + reporter. (each timestep is 5 minutes)<br />
* Red: 0uM IPTG<br />
* Orange: 50uM IPTG<br />
* Yellow: 500uM IPTG<br />
* Green: 1000uM IPTG<br />
<br />
Some of us say that the oscillations can be seen in that plot since the time period is around 46 minutes, however, some of us disagree.<br />
<br />
<br />
[[Image:NYMU_RA3_LB.png]]<br />
<br />
However what was weird was the plot of the LB. The fluorescence was higher than those that were measured in the other samples.<br />
* Blue: 0 IPTG<br />
* Pink: 50 IPTG<br />
<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye. But there was a very very weird trough between 0 to 2 hours for all samples.</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T05:00:02Z<p>Blackrabbit: /* Results */</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
This was done having little knowledge of what we were actually trying to look for. We just needed some data to get a feel for what kind of information we were looking for, and we also used this experiment as an indicator to how much time the experiment would take and what we could improve upon next time (e.g. how to take the samples from the tubes and put it back in the incubator in the shortest amount of time in order not to affect the experiment too much).<br />
===Method===<br />
Diluted all samples by a 1:100 ratio and let them grow. Measured the OD and fluorescence every hour.<br />
=== Results ===<br />
# Found that doing technical replicates actually makes a lot of difference if you didn't pipette properly.<br />
# If starting with and OD600 of around 0.0325, the fast growth period where we see the most activity lies between 2 to 6 hours. From the next experiment on, we decided to dilute all samples to start off with an OD around 0.0325.<br />
# Other than that, at first we had thought that the fluorescence values were too close to the blank (LB medium), and some even lower than it, so we did not analyse the data. It wasn't until after the third reporting assay we noticed that the measured points did indeed have a sinusoidal shape.<br />
<br />
==Reporting Assay 2==<br />
==Method==<br />
Diluted the samples to start off with an OD600 of 0.0325. Measured the OD600 and a few different excitation/emission wavelengths.<br />
<br />
==Reporting Assay 3==<br />
Hogged the fluorescence measuring machine for 4 hours to let it grow in the machine. Doing this we could measure the fluorescence every five minutes. However, we couldn't measure the OD600.<br />
==Method==<br />
Samples consisted of:<br />
* LB<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Tuner + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
** 500uM IPTG<br />
** 1000uM IPTG<br />
We measured the samples every 5 minutes during the time period between 2 to 6 hours from the time of dilution.<br />
<br />
==Results==<br />
By this point, we were thinking about what we should do about getting "no results" every time since everytime we saw that the fluoresence of the blank sample was higher or similar to the fluoresence of the other samples. Then we plotted of of the samples by itself without the blank and alas! we saw a sinusoidal shape.<br />
<br />
[[Image:NYMU_RA3_sine.png]]<br />
<br />
And our hope was revived!<br />
We grouped similar samples together and plotted them.<br />
<br />
[[Image:NYMU_RA3_osc.png]]<br />
<br />
This is the plot of the oscillators + reporter. (each timestep is 5 minutes)<br />
* Red: 0 IPTG<br />
* Orange: 50 IPTG<br />
<br />
[[Image:NYMU_RA3_osctun.png]]<br />
<br />
This is the plot of the oscillators + tuner + reporter. (each timestep is 5 minutes)<br />
* Red: 0uM IPTG<br />
* Orange: 50uM IPTG<br />
* Yellow: 500uM IPTG<br />
* Green: 1000uM IPTG<br />
<br />
Some of us say that the oscillations can be seen in that plot since the time period is around 46 minutes, however, some of us disagree.<br />
<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye. But there was a very very weird trough between 0 to 2 hours for all samples.</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T02:35:23Z<p>Blackrabbit: /* Results */</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
This was done having little knowledge of what we were actually trying to look for. We just needed some data to get a feel for what kind of information we were looking for, and we also used this experiment as an indicator to how much time the experiment would take and what we could improve upon next time (e.g. how to take the samples from the tubes and put it back in the incubator in the shortest amount of time in order not to affect the experiment too much).<br />
===Method===<br />
Diluted all samples by a 1:100 ratio and let them grow. Measured the OD and fluorescence every hour.<br />
=== Results ===<br />
# Found that doing technical replicates actually makes a lot of difference if you didn't pipette properly.<br />
# If starting with and OD600 of around 0.0325, the fast growth period where we see the most activity lies between 2 to 6 hours. From the next experiment on, we decided to dilute all samples to start off with an OD around 0.0325.<br />
# Other than that, at first we had thought that the fluorescence values were too close to the blank (LB medium), and some even lower than it, so we did not analyse the data. It wasn't until after the third reporting assay we noticed that the measured points did indeed have a sinusoidal shape.<br />
<br />
==Reporting Assay 2==<br />
==Method==<br />
Diluted the samples to start off with an OD600 of 0.0325. Measured the OD600 and a few different excitation/emission wavelengths.<br />
<br />
==Reporting Assay 3==<br />
Hogged the fluorescence measuring machine for 4 hours to let it grow in the machine. Doing this we could measure the fluorescence every five minutes. However, we couldn't measure the OD600.<br />
==Method==<br />
Samples consisted of:<br />
* LB<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Tuner + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
** 500uM IPTG<br />
** 1000uM IPTG<br />
We measured the samples every 5 minutes during the time period between 2 to 6 hours from the time of dilution.<br />
<br />
==Results==<br />
By this point, we were thinking about what we should do about getting "no results" every time since everytime we saw that the fluoresence of the blank sample was higher or similar to the fluoresence of the other samples. Then we plotted of of the samples by itself without the blank and alas! we saw a sinusoidal shape.<br />
<br />
[[Image:NYMU_RA3_sine.png]]<br />
<br />
And our hope was revived!<br />
We grouped similar samples together and plotted them.<br />
<br />
[[Image:NYMU_RA3_osc.png]]<br />
<br />
This is the plot of the oscillators + reporter. (each timestep is 5 minutes)<br />
* Red: 0 IPTG<br />
* Orange: 50 IPTG<br />
<br />
[[Image:NYMU_RA3_osctun.png]]<br />
<br />
This is the plot of the oscillators + tuner + reporter. (each timestep is 5 minutes)<br />
* Red: 0uM IPTG<br />
* Orange: 50uM IPTG<br />
* Yellow: 500uM IPTG<br />
* Green: 1000uM IPTG<br />
<br />
Some of us say that the oscillations can be seen in that plot since the time period is around 46 minutes, however, some of us disagree.<br />
<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye. But there was a very very weird trough between 0 to 2 hours.</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T02:33:14Z<p>Blackrabbit: /* Reporting Assay 3 */</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
This was done having little knowledge of what we were actually trying to look for. We just needed some data to get a feel for what kind of information we were looking for, and we also used this experiment as an indicator to how much time the experiment would take and what we could improve upon next time (e.g. how to take the samples from the tubes and put it back in the incubator in the shortest amount of time in order not to affect the experiment too much).<br />
===Method===<br />
Diluted all samples by a 1:100 ratio and let them grow. Measured the OD and fluorescence every hour.<br />
=== Results ===<br />
# Found that doing technical replicates actually makes a lot of difference if you didn't pipette properly.<br />
# If starting with and OD600 of around 0.0325, the fast growth period where we see the most activity lies between 2 to 6 hours. From the next experiment on, we decided to dilute all samples to start off with an OD around 0.0325.<br />
# Other than that, at first we had thought that the fluorescence values were too close to the blank (LB medium), and some even lower than it, so we did not analyse the data. It wasn't until after the third reporting assay we noticed that the measured points did indeed have a sinusoidal shape.<br />
<br />
==Reporting Assay 2==<br />
==Method==<br />
Diluted the samples to start off with an OD600 of 0.0325. Measured the OD600 and a few different excitation/emission wavelengths.<br />
<br />
==Reporting Assay 3==<br />
Hogged the fluorescence measuring machine for 4 hours to let it grow in the machine. Doing this we could measure the fluorescence every five minutes. However, we couldn't measure the OD600.<br />
==Method==<br />
Samples consisted of:<br />
* LB<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
* Oscillator + Tuner + Reporter<br />
** 0uM IPTG<br />
** 50uM IPTG<br />
** 500uM IPTG<br />
** 1000uM IPTG<br />
We measured the samples every 5 minutes during the time period between 2 to 6 hours from the time of dilution.<br />
<br />
==Results==<br />
By this point, we were thinking about what we should do about getting "no results" every time since everytime we saw that the fluoresence of the blank sample was higher or similar to the fluoresence of the other samples. Then we plotted of of the samples by itself without the blank and alas! we saw a sinusoidal shape.<br />
<br />
[[Image:NYMU_RA3_sine.png]]<br />
<br />
And our hope was revived!<br />
We grouped similar samples together and plotted them.<br />
<br />
[[Image:NYMU_RA3_osc.png]]<br />
<br />
This is the plot of the oscillators + reporter. (each timestep is 5 minutes)<br />
* Red: 0 IPTG<br />
* Orange: 50 IPTG<br />
<br />
[[Image:NYMU_RA3_osctun.png]]<br />
<br />
This is the plot of the oscillators + tuner + reporter. (each timestep is 5 minutes)<br />
* Red: 0uM IPTG<br />
* Orange: 50uM IPTG<br />
* Yellow: 500uM IPTG<br />
* Green: 1000uM IPTG<br />
<br />
Some of us say that the oscillations can be seen in that plot since the time period is around 46 minutes, however, some of us disagree.<br />
<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye.</div>Blackrabbithttp://2008.igem.org/File:NYMU_RA3_sine.pngFile:NYMU RA3 sine.png2008-10-30T02:24:07Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_RA3_osctun.pngFile:NYMU RA3 osctun.png2008-10-30T02:24:00Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_RA3_osc.pngFile:NYMU RA3 osc.png2008-10-30T02:23:55Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_RA3_LB.pngFile:NYMU RA3 LB.png2008-10-30T02:23:48Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T02:03:03Z<p>Blackrabbit: /* Reporting Assay 2 */</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
This was done having little knowledge of what we were actually trying to look for. We just needed some data to get a feel for what kind of information we were looking for, and we also used this experiment as an indicator to how much time the experiment would take and what we could improve upon next time (e.g. how to take the samples from the tubes and put it back in the incubator in the shortest amount of time in order not to affect the experiment too much).<br />
===Method===<br />
Diluted all samples by a 1:100 ratio and let them grow. Measured the OD and fluorescence every hour.<br />
=== Results ===<br />
# Found that doing technical replicates actually makes a lot of difference if you didn't pipette properly.<br />
# If starting with and OD600 of around 0.0325, the fast growth period where we see the most activity lies between 2 to 6 hours. From the next experiment on, we decided to dilute all samples to start off with an OD around 0.0325.<br />
# Other than that, at first we had thought that the fluorescence values were too close to the blank (LB medium), and some even lower than it, so we did not analyse the data. It wasn't until after the third reporting assay we noticed that the measured points did indeed have a sinusoidal shape.<br />
<br />
==Reporting Assay 2==<br />
==Method==<br />
Diluted the samples to start off with an OD600 of 0.0325. Measured the OD600 and a few different excitation/emission wavelengths.<br />
<br />
==Reporting Assay 3==<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye.</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T01:58:45Z<p>Blackrabbit: /* Reporting Assay 1 */</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
This was done having little knowledge of what we were actually trying to look for. We just needed some data to get a feel for what kind of information we were looking for, and we also used this experiment as an indicator to how much time the experiment would take and what we could improve upon next time (e.g. how to take the samples from the tubes and put it back in the incubator in the shortest amount of time in order not to affect the experiment too much).<br />
===Method===<br />
Diluted all samples by a 1:100 ratio and let them grow. Measured the OD and fluorescence every hour.<br />
=== Results ===<br />
# Found that doing technical replicates actually makes a lot of difference if you didn't pipette properly.<br />
# If starting with and OD600 of around 0.0325, the fast growth period where we see the most activity lies between 2 to 6 hours. From the next experiment on, we decided to dilute all samples to start off with an OD around 0.0325.<br />
# Other than that, at first we had thought that the fluorescence values were too close to the blank (LB medium), and some even lower than it, so we did not analyse the data. It wasn't until after the third reporting assay we noticed that the measured points did indeed have a sinusoidal shape.<br />
<br />
==Reporting Assay 2==<br />
==Reporting Assay 3==<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye.</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator2008-10-30T01:49:11Z<p>Blackrabbit: New page: Only the Oscillator, Tuner, and Reporter was successfully ligated together, so we performed a few Reporting As...</p>
<hr />
<div>Only the [[Team:NYMU-Taipei/Project/Time_Regulation/Reloxilator#Experimental_Results|Oscillator, Tuner, and Reporter]] was successfully ligated together, so we performed a few Reporting Assays on it.<br />
<br />
==Reporting Assay 1==<br />
==Reporting Assay 2==<br />
==Reporting Assay 3==<br />
==Reporting Assay 4==<br />
Started doing reporting assay of the Oscillator+Tuner+Synchronizer+Reporter construct, until we found out halfway that the construct had actually failed (we were using the time between measurement assay points to validate the length of the part from plasmid extraction->digestion->gel electrophoresis.<br />
==Reporting Assay 5==<br />
* Aim<br />
** purely wanted to see the relationship that different amounts of IPTG has upon the fluorescence of the Oscillator+Tuner+Reporter construct. So OD600 was not measured except at the start.<br />
* IPTG concentrations: 0,50,100,200,300,500,1000,2000,4000 uM.<br />
* Measurement: every 5 minutes at the wavelengths (ex/em):<br />
** 488/533<br />
** 488/525<br />
** 475/515<br />
** 470/530<br />
===Results===<br />
There was no significant difference between the wavelengths used. The shape looks the same to the human eye.</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/ReloxilatorTeam:NYMU-Taipei/Project/Time Regulation/Reloxilator2008-10-30T01:30:22Z<p>Blackrabbit: /* Experimental Results */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
Our '''Reloxilator''' (Relaxation Oscillator): A four-part system consisting of an oscillator, a synchronizer, a tuner, and a reporter.<br />
<br />
[[Image:NYMU_reloxilator.png|726px]]<br />
== Brief Description ==<br />
The oscillator is a two-component [http://en.wikipedia.org/wiki/Relaxation_Oscillator relaxation oscillator]. The first component consists of the P<sub>RE</sub> promoter and the gene CII in a positive feedback loop, and both originating from from the &lambda; phage. The second component uses the HtlB gene from ''E. coli'' attached to the same promoter as the first component. The HtlB gene produces HtlB proteins that degrade CII proteins.<br />
<br />
The synchronizer allows near-full synchronization between different cells after about two time periods of oscillation[[#References|<sup>1</sup>]].<br />
The main parts of the synchronizer is made up of the P<sub>Lux</sub> promoter, and the LuxI and LuxR genes, all coming from the ''Vibrio Fischeri'' organism. P<sub>RE</sub> and the CII gene are the same as the parts used in the oscillator, tying the oscillator and synchronizer together.<br />
<br />
The Tuner is a way to control the time period of the system by inhibiting the rate of degradation HtlB has on CII in the oscillator. The protein used is the CIIICd, a DNA synthesised version of the CIIIC protein from the study done by Halder ''et al''[[#References|<sup>2</sup>]].<br />
<br />
The Reporter is the promoter P<sub>RE</sub> (the same part used in the oscillator) attached to a green flurorescent protein gene. It is used in various tests to check many of the components in the system.<br />
<br />
<br />
== System Description ==<br />
This section houses the description of our system and the we use.<br />
=== The Oscillator === <br />
A two-component oscillator consisting of two genes: one that induces both genes, while the second gene represses the first one. This oscillation is much like the oscillation of a [http://en.wikipedia.org/wiki/Relaxation_Oscillator capacitor charging and discharging].<br />
==== Components ====<br />
* [[#pRE|pRE]]<br />
* [[#CII|CII]]<br />
* [[#HtlB|HtlB]]<br />
==== Related Biobricks ====<br />
* {{:Team:NYMU-Taipei/Part|BBa_R0053}} works but comes from a different phage (P22). Therefore using it means no proof of oscillation with HtlB [<font color="blue">citation required</font>]. Just realised it doesn't mean we can't try it.<br />
** {{:Team:NYMU-Taipei/Part|BBa_I7108}} uses BBa_R0053 and produces little GFP output. But that may be good for us?<br />
** {{:Team:NYMU-Taipei/Part|BBa_R1053}} is a standardised version of it.<br />
** {{:Team:NYMU-Taipei/Part|BBa_C0053}}, the related coding region that activates BBa_R0053.<br />
<br />
==== Problems ====<br />
* [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=16131068 HtlB] already exists in the strain of ''E. coli'' we're going to use (''Escherichia coli K12 strain MG1655 (tax-id:511145'').<br />
*# Go ahead with the experiment, and then find out whether the amount that already exists would significantly impact our results or not by checking with a prediction.<br />
* Due to HtlB already existing in ''E. coli'', if the initial concentration of CII isn't enough, would the oscillator never start?<br />
<br />
==== References ====<br />
* McMillen, D. et al (2002) "[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=117365 Synchronizing genetic relaxation oscillators by intercell signalling]", Proc Natl Acad Sci USA, Vol. 22, No. 3, pp. 679-684.<br />
** Where the oscillator idea came from.<br />
<br />
<br />
----<br />
<br />
=== The Synchronizer ===<br />
The synchronizer integrates the use of cell quorum sensing to introduce synchronization of intercell oscillations.<br />
==== Components ====<br />
* [[#pRE|pRE]]<br />
* [[#LuxI|LuxI]]<br />
* [[#LuxR|LuxR]]<br />
* [[#pLUX|pLUX]]<br />
* [[#CII|CII]]<br />
<br />
<br />
===== Component positions on ''Vibrio Fischeri'' =====<br />
We performed a bunch of sequence alignments between the sequences from the Ecocyc database and the Biobrick parts to determine position of those components on ''Vibrio Fischeri''.<br />
<font color="orange">Orange colour means transcription/translation in reverse direction.</font><br />
<br>norm means normalised (norm=x-1050153+1)<br />
<html><style>.ob{background:orange;}</style></html><br />
{| border="1"<br />
|-<br />
! Component !! length !! Start !! End || norm start || norm end || Source<br />
|-<br />
| class="ob" | [[#LuxI|LuxI]] || 573 || 1050153 || 1050725 || 1 || 573 || [http://biocyc.org/VFIS312309/NEW-IMAGE?type=GENE&object=VFA0924 Biocyc]<br />
|-<br />
| class="ob" | BBa_C0161 || 585 || 1050150 || 1050734 || -2 || 582 || [http://partsregistry.org/Part:BBa_C0161 BBa_c0161] and sequence alignment[2] (87.3% consequence.)<br />
|-<br />
| class="ob" rowspan="2" | BBa_R0062 ([[#pLUX|pLUX-right]]) || 55 || 1050749 || 1050803 || 597 || 651 || [http://partsregistry.org/Part:BBa_R0062:Design BBa_R0062] and sequence alignment[2] (72.7% consequence).<br />
|-<br />
| 55->57 || 1050784 || 1050840 || 632 || 688 || sequence alignment[1] (56% consensus and added 2bp). Looks wrong.<br />
|-<br />
| rowspan="2" | BBa_R0061 || 30->28 || 1050781 || 1050808 || 627 || 656 || [http://partsregistry.org/wiki/index.php/Part:BBa_R0061 BBa_R0061] and sequence alignment[1] (75% consensus, but they deleted the first 2bp).<br />
|-<br />
| 30->43 || 1050775 || 1050817 || 623 || 665 || sequence alignment[2] (76.5% consensus. This looks wrong.)<br />
|-<br />
| BBa_R0063 (pLUX-left) || 151->150 || 1050784 || 1050933 || 632 || 781 || [http://partsregistry.org/Part:BBa_R0063:Design BBa_R0063] and sequence alignment[1] (64.5% consensus and removed 1bp).<br />
|-<br />
| BBa_c0062 || 756->753 || 1050941 || 1051693 || 789 || 1541 || [http://partsregistry.org/Part:BBa_C0062 BBa_c0062] and sequence alignment[1] (78.9% consensus and removed 3bp)<br />
|-<br />
| [[#LuxR|LuxR]] || 753 || 1050941 ||1051693 || 789 || 1541 || [http://biocyc.org/VFIS312309/NEW-IMAGE?type=GENE-IN-MAP&object=VFA0925 Biocyc]<br />
|}<br />
[1]: Sequence Alignment with [http://biocyc.org/VFIS312309/sequence-delimited?chromosome=VF-CHROM-ES114-II&object=VFA0924&left=1050153&right=1051693 Biocyc ''Vibrio Fischeri'' (1050153-1051693)] (end of LuxI to end of LuxR).<br />
<br>[2]: Sequence Alignment with the reverse compliment of [1].<br />
<br />
==== Related Biobricks ====<br />
* {{:Team:NYMU-Taipei/Part|BBa_R0062}} or {{:Team:NYMU-Taipei/Part|BBa_R1062}} in conjunction with or instead of new construct (pRE).<br />
* {{:Team:NYMU-Taipei/Part|BBa_C0062}} in conjunction with or instead of [[#LuxR|LuxR]].<br />
* {{:Team:NYMU-Taipei/Part|BBa_C0061}} or {{:Team:NYMU-Taipei/Part|BBa_C0161}} in conjunction with or instead of [[#LuxI|LuxI]].<br />
Other interesting parts that may come in use (all working):<br />
* {{:Team:NYMU-Taipei/Part|BBa_F2621}}<br />
* {{:Team:NYMU-Taipei/Part|BBa_F2622}}<br />
* {{:Team:NYMU-Taipei/Part|BBa_T9002}}<br />
Other interesting parts we may or may not use.<br />
* {{:Team:NYMU-Taipei/Part|BBa_J37019}} titled ''AHL induced LuxR generator''.<br />
* {{:Team:NYMU-Taipei/Part|BBa_J37032}} if we want to test if {{:Team:NYMU-Taipei/Part|BBa_R0062}} works.<br />
* {{:Team:NYMU-Taipei/Part|BBa_J37033}} looks pretty useless.<br />
* {{:Team:NYMU-Taipei/Part|BBa_I731012}} looks interesting, but we're probably not going to do anything about it.<br />
<br />
==== Problems ====<br />
#Aligning [http://partsregistry.org/Part:BBa_R0062 BBa_R0062] and [http://partsregistry.org/Part:BBa_R1062 BBa_R1062] gives 92.2% consensus.<br />
#Aligning [http://partsregistry.org/Part:BBa_R0063 pLUX-left] and [http://partsregistry.org/Part:BBa_R0062 pLUX-right] produced a 64% consensus.<br />
#* Why are so many nucleotides different?<br />
#* Why do the two promoters overlap so much (exactly according to the sequence alignment), yet the [http://partsregistry.org/Part:BBa_R0062:Design design] doesn't say so?<br />
#** Are they using a difference ''Vibrio Fischeri'' strain for both?<br />
#A sequence [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?tool=portal&db=protein&term=&query_key=1&dopt=gp&dispmax=20&page=1&qty=1&WebEnv=0NZu2wco5pgt4AFlKGBZSBuHz1xTMr4TRAfhLUXMT0Mg3JomrvvDqnSCvcYGDYXw1omCOSTlDgeb-UU%40264C254084F93770_0012SID&WebEnvRq=1 similar to LuxR] exists in the ''E. coli'' strain we're using. Don't know if it'll affect anything.<br />
==== References ====<br />
* McMillen, D. et al (2002) "[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=117365 Synchronizing genetic relaxation oscillators by intercell signalling]", Proc Natl Acad Sci USA, Vol. 22, No. 3, pp. 679-684.<br />
** Same paper as the main paper from the oscillator section.<br />
<br />
<br />
----<br />
<br />
=== The Tuner ===<br />
A way to control the oscillator's time period.<br />
==== Components ====<br />
* [[#pLAC|pLAC]]<br />
* [[#CIIIC|CIIIC]]<br />
==== Problems ====<br />
# The CIIIC protein does not appear in any other papers (nor does it appear on pdb for that matter, but then again CIII doesn't either). So we have to believe that one paper.<br />
# By synthesizing the CIIIC protein from DNA, we have to add the start codon ATG, resulting in an extra Methionine at the start. This may affect our experiments.<br />
==== References ====<br />
* Hadler, S. et al (2007) [http://www.ncbi.nlm.nih.gov/pubmed/17890311 Probing the Anitprotease Activity of lCIII, an Inhibitor of the Escherichia coli Metalloprotease HflB (FtsH)]", Journal of Bacteriology, Vol. 189, No. 22, pp. 8130-8138.<br />
** The only paper about the experimental results of CIIIC. Also has a lot of experimental values (such as ratios) that can be used.<br />
* Herman, C. et al (1997) "[http://jb.asm.org/cgi/content/abstract/179/2/358 The HflB Protease of Escherichia coli Degrades Its Inhibitor &lambda;cIII]", Journal of Bacteriology, Vol. 179, No. 2, pp. 358-363.<br />
** Also has a lot of experimental values that could be used.<br />
<br />
== Sequences ==<br />
This section lists the sequences of promoters and genes.<br />
=== Promoters ===<br />
The list of promoters used.<br />
==== pRE ====<br />
* few hundred bp upstream from the CI gene.<br />
* 40 to 60bp long.<br />
* Appropriate Literature<br />
** [http://www.ncbi.nlm.nih.gov/pubmed/14872063?ordinalpos=3&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum Interactions among CII protein, RNA polymerase adn &lambda; pRE promoter: contacts between RNA polymerase and the -35 region of pRE are identical in the presence and absence of CII protein]<br />
** [http://www.ncbi.nlm.nih.gov/pubmed/2953648?ordinalpos=13&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum Mutations that improve the pRE promoter of coliphage lambda]<br />
** [http://www.ncbi.nlm.nih.gov/pubmed/2953649?ordinalpos=12&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum Cross-specificities between cII-like proteins and pRE-like promoters of lambdoid bacteriophages]<br />
<br />
complement(38391->38340) on lambda phage.<br />
AGAGCCTCGTTGCGTTTGTTTGCACGAACCATATGTAAGTATTTCCTT|AGAT (52bp)<br />
+---- transcription start site ----><br />
so what we want:<br />
AGAGCCTCGTTGCGTTTGTTTGCACGAACCATATGTAAGTATTTCCTT (48bp)<br />
<br />
<br />
<br />
pRE Overlaps with CII (but in the other direction)<br />
ATGGTTCGTGCAAACAAACGCAACGAGGCTCTACGAATCGAGAGTGCGTTG--> CII cont'<br />
<--ATCTAAGGAAATACTTACATATGGTTCGTGCAAACAAACGCAACGAGGCTCT (<--pRE)<br />
<br />
For reference, [http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_report&list_uids=3827059 CI]: 37940-37227<br />
<br />
<br />
Primers:<br />
AGAGCCTCGTTGCGTTT (len:17, tm:55deg, GC%:53)<br />
AAGGAAATACTTACATATGGTTCGTG (len:26, tm:55deg, GC%:35)<br />
<br />
Primer used regions:<br />
<font color="red">AGAGCCTCGTTGCGTTT</font>GTTTG<font <br />
color="blue">CACGAACCATATGTAAGTATTTCCTT</font><br />
<br />
There is only 5bp not included in the primer. Feels kinda weird.<br />
<br />
==== pLUX ====<br />
*[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0062 Part:BBa_R0062-luxR & HSL regulated lux pR]<br />
<pre><br />
acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa(55 bp)<br />
</pre><br />
==== pLac ====<br />
{{:Team:NYMU-Taipei/Part|BBa_R0010}} (200bp)<br />
<br />
<br />
=== Genes ===<br />
The list of genes used.<br />
==== CII ====<br />
* A &lambda; phage gene.<br />
* [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NP_040630.1 NCBI protein]: 97aa<br />
* [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?WebEnv=0_IrKu54rUXySHgWXB0EaSRAhFNRuWQc8t_9Pvcu9deRGYI7MtHyfyf2B79C0DiodB6zisjQl5K8vOD%40264C254084F93770_0012SID&db=nucleotide&qty=1&c_start=1&list_uids=NC_001416.1&uids=&dopt=fasta&dispmax=5&sendto=&fmt_mask=0&from=38360&to=38653&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512 NCBI nucleotide]: 294bp<br />
<br />
<font size=4><br />
>gi|9626243:38360-38653 Enterobacteria phage lambda, complete genome<br />
ATGGTTCGTGCAAACAAACGCAACGAGGCTCTACGAATCGAGAGTGCGTTGCTTAACAAAATCGCAATGC<br />
TTGGAACTGAGAAGACAGCGGAAGCTGTGGGCGTTGATAAGTCGCAGATCAGCAGGTGGAAGAGGGACTG<br />
GATTCCAAAGTTCTCAATGCTGCTTGCTGTTCTTGAATGGGGGGTCGTTGACGACGACATGGCTCGATTG<br />
GCGCGACAAGTTGCTGCGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCC<br />
AGATGGAGTTCTGA</font><br />
<br />
<pre><br />
Primers:<br />
ATGGTTCGTGCAAACAAACG (56deg)<br />
tcagaactccatctggatttgt<br />
</pre><br />
<br />
==== CIIIC ====<br />
* CIII (A &lambda; phage gene) after residues 1-13 and 42-54 are cleaved (so only residues 14-41) are left.<br />
* Inhibites the degradation rate HtlB has on CII by binding to HtlB.<br />
* HtlB '''does not''' degrade CIIIC (unlike CIII).<br />
* [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&id=9626284 NCBI (CIII) protein]:54aa<br />
* [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?WebEnv=0cMBABYtiOTu-KvSSXngm5VVsgrz7RFiY24GdDY0xzrnBMiRgRDlrJjhu6Ybt2Q7bn2aiqpN4WI4qWl%40264C254084F93770_0012SID&db=nucleotide&qty=1&c_start=1&list_uids=NC_001416.1&uids=&dopt=fasta&dispmax=5&sendto=&from=33299&to=33463&strand=on NCBI (CIII) gene]:165bp<br />
CIII gene:<br />
<pre><br />
>gi|9626243:c33463-33299 Enterobacteria phage lambda, complete genome<br />
ATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCC<br />
GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGACTAA<br />
</pre><br />
<br />
Start with 165bp (54 residues + stop codon) then cleave off residues 2-13 (39bp) and 42-54 (39bp), leaving residues 1,14-41,55 (90bp)<br />
<br />
CIIIC (with added ATG at the start):<br />
<br />
ATG<font color="silver">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>CCTTCCGAATCTTTACTTGAACGAATCACCC<br />
GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG<font color="silver">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>TAA<br />
<br />
Changes to:<br />
<pre><br />
ATGCCTTCCGAATCTTTACTTGAACGAATCACCC<br />
GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGA<br />
TAA<br />
</pre><br />
The resulting primers are:<br />
<pre><br />
ATGCCTTCCGAATCTTTACTTG<br />
ttatcctggctgattaagtatgtcg (56deg)<br />
</pre><br />
<br />
==== HtlB ====<br />
* An ''E. coli'' gene.<br />
* HtlB degrades CII.<br />
* [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG11506 Ecocyc]: 1935bp.<br />
* No extra EcoRI,PstI,SpeI,XbaI in gene below.<br />
<pre><br />
>EG11506 hflB (complement(3324957..3323023)) E. coli<br />
atgGCGAAAA ACCTAATACT CTGGCTGGTC ATTGCCGTTG TGCTGATGTC AGTATTCCAG<br />
AGCTTTGGGC CCAGCGAGTC TAATGGCCGT AAGGTGGATT ACTCTACCTT CCTACAAGAG<br />
GTCAATAACG ACCAGGTTCG TGAAGCGCGT ATCAACGGAC GTGAAATCAA CGTTACCAAG<br />
AAAGATAGTA ACCGTTATAC CACTTACATT CCGGTTCAGG ATCCGAAATT ACTGGATAAC<br />
CTGTTGACCA AGAACGTCAA GGTTGTCGGT GAACCGCCTG AAGAACCAAG CCTGCTGGCT<br />
TCTATCTTCA TCTCCTGGTT CCCGATGCTG TTGCTGATTG GTGTCTGGAT CTTCTTCATG<br />
CGTCAAATGC AGGGCGGCGG TGGCAAAGGT GCCATGTCGT TTGGTAAGAG CAAAGCGCGC<br />
ATGCTGACGG AAGATCAGAT CAAAACGACC TTTGCTGACG TTGCGGGCTG CGACGAAGCA<br />
AAAGAAGAAG TTGCTGAACT GGTTGAGTAT CTGCGCGAGC CGAGCCGCTT CCAGAAACTC<br />
GGCGGTAAGA TCCCGAAAGG CGTCTTGATG GTCGGTCCTC CGGGTACCGG TAAAACGCTG<br />
CTGGCGAAAG CGATTGCAGG CGAAGCGAAA GTTCCGTTCT TTACTATCTC CGGTTCTGAC<br />
TTCGTAGAAA TGTTCGTCGG TGTGGGTGCA TCCCGTGTTC GTGACATGTT CGAACAGGCG<br />
AAGAAAGCGG CACCGTGCAT CATCTTTATC GATGAAATCG ACGCCGTAGG CCGCCAGCGT<br />
GGCGCTGGTC TGGGCGGTGG TCACGATGAA CGTGAACAGA CTCTGAACCA GATGCTGGTT<br />
GAGATGGATG GCTTCGAAGG TAACGAAGGT ATCATCGTTA TCGCCGCGAC TAACCGTCCG<br />
GACGTTCTCG ACCCGGCCCT GCTGCGTCCT GGCCGTTTCG ACCGTCAGGT TGTGGTCGGC<br />
TTGCCAGATG TTCGCGGTCG TGAGCAGATC CTGAAAGTTC ACATGCGTCG CGTACCATTG<br />
GCACCCGATA TCGACGCGGC AATCATTGCC CGTGGTACTC CTGGTTTCTC CGGTGCTGAC<br />
CTGGCGAACC TGGTGAACGA AGCGGCACTG TTCGCTGCTC GTGGCAACAA ACGCGTTGTG<br />
TCGATGGTTG AGTTCGAGAA AGCGAAAGAC AAAATCATGA TGGGTGCGGA ACGTCGCTCC<br />
ATGGTGATGA CGGAAGCGCA GAAAGAATCG ACGGCTTACC ACGAAGCGGG TCATGCGATT<br />
ATCGGTCGCC TGGTGCCGGA ACACGATCCG GTGCACAAAG TGACGATTAT CCCACGCGGT<br />
CGTGCGCTGG GTGTGACTTT CTTCTTGCCT GAGGGCGACG CAATCAGCGC CAGCCGTCAG<br />
AAACTGGAAA GCCAGATTTC TACGCTGTAC GGTGGTCGTC TGGCAGAAGA GATCATCTAC<br />
GGGCCGGAAC ATGTATCTAC CGGTGCGTCC AACGATATTA AAGTTGCGAC CAACCTGGCA<br />
CGTAACATGG TGACTCAGTG GGGCTTCTCT GAGAAATTGG GTCCACTGCT GTACGCGGAA<br />
GAAGAAGGTG AAGTGTTCCT CGGCCGTAGC GTAGCGAAAG CGAAACATAT GTCCGATGAA<br />
ACTGCACGTA TCATCGACCA GGAAGTGAAA GCACTGATTG AGCGTAACTA TAATCGTGCG<br />
CGTCAGCTTC TGACCGACAA TATGGATATT CTGCATGCGA TGAAAGATGC TCTCATGAAA<br />
TATGAGACTA TCGACGCACC GCAGATTGAT GACCTGATGG CACGTCGCGA TGTACGTCCG<br />
CCAGCGGGCT GGGAAGAACC AGGCGCTTCT AACAATTCTG GCGACAATGG TAGTCCAAAG<br />
GCTCCTCGTC CGGTTGATGA ACCGCGTACG CCGAACCCGG GTAACACCAT GTCAGAGCAG<br />
TTAGGCGACA AGTAA<br />
</pre><br />
<pre><br />
HtlB primers:<br />
atgGCGAAAAACCTAATACTCTG<br />
ttacttgtcgcctaactgct<br />
</pre><br />
<br />
==== LuxI ====<br />
* A ''Vibrio Fischeri'' gene.<br />
* [http://biocyc.org/VFIS312309/NEW-IMAGE?type=GENE&object=VFA0924 Biocyc]: 573bp<br />
* Biobrick available<br />
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_J37034 BBa_J37034]: LuxI + GFP. We could use this if we can extract the RBS+LuxI part.<br />
<br />
<pre><br />
>VFA0924 VFA0924 (complement(1050725..1050153)) V. fischeri chromosome es114 ii<br />
ATGataaaaa aatcggactt tttgggcatt ccatcagagg agtatagagg tattcttagt<br />
cttcgttatc aggtatttaa acgaagactg gagtgggact tggtaagtga ggataatctt<br />
gaatcagatg aatatgataa ctcaaatgca gaatatattt atgcttgtga tgatgcggaa<br />
gaggtaaatg gctgttggcg tttgttacct acaacgggtg attacatgtt aaaaactgtt<br />
tttcctgaat tgctcggaga tcaagtagcc ccaagagatc caaatatagt cgaattaagc<br />
cgttttgctg tgggaaaaaa tagctcaaaa ataaataact ctgctagtga aataacaatg<br />
aaattgtttc aagctatata taaacacgca gttagtcaag gtattacaga atatgtaaca<br />
gtaacatcaa tagcaataga gcgatttctg aaacgtatta aagttccttg tcatcgcatt<br />
ggtgataagg agattcattt attaggtaat actagatctg ttgtattgtc tatgcctatt<br />
aatgatcagt ttagaaaagc tgtatcaaat taa<br />
</pre><br />
<pre><br />
LuxI primers:<br />
ATGataaaaaaatcggactttttggg<br />
ttaatttgatacagcttttctaaactgatc (length=30 too long?)<br />
</pre><br />
==== LuxR ====<br />
* A ''Vibrio Fischeri'' gene.<br />
* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&TermToSearch=3280300&ordinalpos=1&itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum NCBI]: 753bp.<br />
* Biobrick available<br />
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_J37019 BBa_J37019]: Promoter + LuxR. 862bp<br />
<pre><br />
>VFA0925 VFA0925 1050941..1051693 V. fischeri chromosome es114 ii<br />
ATGaacatta aaaatataaa tgctaatgag aagataattg ataaaattaa aacttgtaat<br />
aataataaag atattaatca atgtttatct gaaatagcaa agataataca ttgtgaatat<br />
tacctattcg ctattatcta tcctcactca ataattaaac ctgatgtttc aattatagat<br />
aattaccctg aaaaatggcg taaatattat gatgatgccg gactactaga atatgaccct<br />
gtagtcgatt actctaagtc ccatcattca ccaattaatt ggaacgtatt cgaaaaaaaa<br />
acaataaaaa aagagtctcc gaatgtaata aaagaagcac aggaatcggg actcattact<br />
ggatttagct ttccaattca tactgcaagt aatggttttg gaatgctcag ttttgctcat<br />
tcagataaag atatttatac tgacagttta tttttacacg ctagtacaaa tgtaccatta<br />
atgcttcctt ctttagtcga taattatcaa aaaataaata cgacacgtaa aaagtcagat<br />
tctattttaa caaaaagaga aaaagaatgc ttagcgtggg cgagtgaagg aaaaagtaca<br />
tgggatattt caaaaatact tggctgcagt gagcgtactg tcacttttca tttaaccaat<br />
actcaaatga aactcaatac aactaaccgc tgccaaagta tttctaaagc aattttaact<br />
ggcgccatta attgtccata ccttaaaaat taa<br />
</pre><br />
<pre><br />
LuxR primers:<br />
ATGaacattaaaaatataaatgctaatgagaaga (length=34 too long?)<br />
ttaatttttaaggtatggacaattaatggc (length=30 too long?)<br />
</pre><br />
<br />
<br />
== Testing ==<br />
How we plan to test our parts when we've finished constructed them.<br />
=== Promoter Testing ===<br />
[[Image:NYMU_reloxilator_promoter_testing.png|700px]]<br />
<br />
We are attempting to establish a "inducible promoter standard," much like the repressible promoter standard, where instead we define the IPTG inducible "standard" pLac promoter as having a value of 1, while all other inducible promoters will be measured in multiples of this standard. Then the value of IPTG can also be varied to test the ratios between the promoters as to whether the ratio is linear, sinusoidal, polynomial, etc.<br />
<br />
We can test [[#pRE|pRE]] promoter via this standard by connecting the [[#CII||CII]] gene behind pLac, and connecting a reporter behind pRE.<br />
<br />
This standard can also be used to test promoters that require a complex to be induced, such as pLux. pLux requires the R+AHL complex to be induced. To test the the strength of pLux, first let all parts of the complex save one to be always existing, while the last one would be controlled by pLac. In this example, LuxR is always expressed and the amount of AHL is determined by pLac.<br />
<br />
=== Component Testing ===<br />
[[Image:NYMU_reloxilator_component_testing.png|700px]]<br />
<br />
This is the part where we test to see if our component works. The diagram above shows the pathway between the various inputs, and the output (GFP).<br />
<br />
== Modelling ==<br />
=== Oscillator Modelling 1 ===<br />
[[Image:NYMU reloxilator modelling.png|800px]]<br />
* <font color="red">'''HtlB'''</font> concentration<br />
* <font color="darkblue">'''CII'''</font> concentration.<br />
* 20sec intervals.<br />
<br />
==== Variables Used ====<br />
* '''pRE Stength''': 0.4 (1 CII protein produces 0.4 CII and HtlB proteins).<br />
* '''H-t<sub>1/2</sub>''': 8mins (random value I picked, its probably not the real value.)<br />
** Half life of HtlB.<br />
** Changing this value just makes the oscllation period longer.<br />
* '''C<sub>0</sub>''': 8mins.<br />
** CII t<sub>1/2</sub> with no HtlB present. Based on [http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=94496 Shotland2000])<br />
* '''C<sub>1</sub>''': 1min.<br />
** Also based on the same paper.<br />
** CII t<sub>1/2</sub> with an equal amount of HtlB is what I assume because they don't say.<br />
* '''&Delta;t''': 20sec<br />
** Time segment used for the calculation (can't be too close to the t<sub>1/2</sub>'s).<br />
==== Formulas used ====<br />
<html><style>span.bigger{font-size:141%;}</style></html><br />
The HtlB/CII ratio used to calculate the t<sub>1/2</sub> at a specific time point:<br />
<br />
<span class="bigger">R = [HtlB] / [CII] * [CII] = [HtlB]</span> ----- (1)<br />
<br />
<br />
The last *[CII] has something to do with the [HtlB][CII] --> [CII] equation.<br />
<br />
Calculation of CII's t<sub>1/2</sub> based on the ratio above:<br />
<br />
<span class="bigger">C-t<sub>1/2</sub> = C<sub>0</sub> x (C<sub>1</sub>/C<sub>0</sub>)<sup>R</sup></span> ----- (2)<br />
<br />
<br />
The calculation of amount of substrates remaining w.r.t the half lives:<br />
<br />
<span class="bigger">[HtlB] = [HtlB] x 0.5<sup>(&Delta;t / H-t<sub>1/2</sub>)</sup></span> ----- (3)<br />
<br />
<span class="bigger">[CII] = [CII] x 0.5<sup>(&Delta;t / C-t<sub>1/2</sub>)</sup></span> ----- (4)<br />
<br />
==== Conclusion ====<br />
<br />
Fiddling around a bit yields:<br />
{| border="1" style="width:90%;border:1px solid gray;"<br />
|-<br />
! colspan="2" | Variable !! Affects<br />
|-<br />
| rowspan="2" | '''Initial concentration''' of: || HtlB (higher) || rowspan="2" | (longer) startup time<br />
|-<br />
| CII (higher)<br />
|-<br />
| rowspan="2" | '''Natural degradation rate''' of || HtlB (longer) || rowspan="2" | (longer) time period<br />
|-<br />
| CII (longer)<br />
|-<br />
| colspan="2" | '''pRE strength''' (higher) || (shorter) time period<br />
|-<br />
| colspan="2" | '''HtlB to CII degradation rate''' (higher) || (lower) global maximum concentration (not counting startup)<br />
|-<br />
|}<br />
<br />
Is a promoter that can be activated by HtlB? because then our calculations would be even more accurate.<br />
<br />
== Experimental Results ==<br />
[[Image:Reloxilator_construct_schedule.png|695px]]<br />
<br />
This is a picture of all the constructs, and green constructs are the ones that were successfully created.<br />
<br />
== References ==<br />
# McMillen, D. ''et al'' (2002) "[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=117365 Synchronizing genetic relaxation oscillators by intercell signalling]", Proc Natl Acad Sci USA, Vol. 22, No. 3, pp. 679-684. <br />
# Hadler, S. ''et al'' (2007) [http://www.ncbi.nlm.nih.gov/pubmed/17890311 Probing the Anitprotease Activity of &lambda;CIII, an Inhibitor of the Escherichia coli Metalloprotease HflB (FtsH)]", Journal of Bacteriology, Vol. 189, No. 22, pp. 8130-8138.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T01:15:07Z<p>Blackrabbit: /* Cyanoxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#Seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Cyanobacteria_SequenceTeam:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence2008-10-30T01:13:04Z<p>Blackrabbit: /* Seq pOmpF */</p>
<hr />
<div>==Seq pOmpF==<br />
GACGGTGTTCACAAAGTTCCTTAAATTTTACTTTTGGTTACATATTTTTTCTTTTTGAAACCAAATCTTTATCTTTGTAG <br />
CACTTTCACGGTAGCGAAACGTTAGTTTGAATGGAAAGATGCCTGC<br />
<br />
==Seq RpaA==<br />
ATGAAACCCCGCATCCTCGTGATCGATGATGACTCAGCCATCTTGGAGCTGGTCGCCGTCAATCTGGAGATGTCTGGCTAT<br />
GACGTACGCAAAGCTGAGGACGGCATTAAAGGTCAGGCTTTAGCTGTTCAGCTAGTTCCCGACCTGATCATGCTGGATC <br />
TAATGCTGCCGCGGGTTGATGGCTTTACCGTCTGTCAGCGACTGCGGCGCGATGAGCGTACTGCCGAAATTCCGGTGCTG <br />
ATGCTGACCGCCCTCGGACAGACTCAGGATAAGGTTGAAGGCTTCAACGCGGGTGCTGACGATTATCTGACTAAGCCCTT <br />
CGAAGTTGAAGAGATGCTGGCCCGCGTGCGTGCCTTGCTGCGGCGCACCGATCGCATTCCCCATGCAGCCCGCCATAGCG <br />
AAATTCTCAGCTACGGTCCGCTGACCCTGATTCCCGAGCGGTTTGAGGCCATTTGGTTCAACCGCACGGTCAAGCTGACT <br />
CACTTGGAATTTGAGTTGTTGCACTGCCTGTTGCAACGCCACGGCCAAACGGTTGCGCCGAGCGAAATCCTCAAAGAAGT <br />
CTGGGGCTATGATCCCGACGATGACATCGAGACGATTCGCGTCCACATCCGTCATCTGCGCACCAAGCTCGAGCCCGATC <br />
CCCGGCACCCGCGCTACATCAAAACGGTCTATGGAGCGGGCTACTGCCTTGAGCTGCCGGCCGAGACGGAACTCCACCAA<br />
CACGCCGATCAGTTTCCTTCGGCGTCCTGA <br />
<br />
<br />
<br />
==Seq SasA==<br />
<br />
ATGGGAGAGTCTCTGTCACCACAAGCACTGGCTCAACCGTTGCTACTGCAACTGTTCGTC<br />
GATACCCGGCCCCTGTCACAGCACATTGTGCAGCGGGTTAAAAATATTTTGGCAGCAGTA <br />
GAGGCAACCGTCCCCATCAGCTTGCAGGTGATCAATGTGGCGGACCAGCCACAACTGGTG <br />
GAGTACTACCGCCTAGTCGTCACGCCTGCCCTGGTTAAAATTGGTCCAGGCTCTCGCCAA <br />
GTTCTGAGTGGCATCGACCTCACCGATCAATTAGCCAACCAGTTGCCCCAGTGGCTGGTT <br />
CAGCAAGAGGCCTTTTTTGCCGATCGAGAGCCACCTGAAGTCAACATTCCGTTCACGGAG <br />
CTAGGCCAACCCGAGACCCCCGCGTTGCAGCAGGCTGATGCCTTTTTTCAGCTTCAGCAA <br />
CAATACGCTGATCTCTCGGAGCGGACAAAATTCCTTGAGCAGGTCATTGCTCTCGTCGCC <br />
CACGACCTCCGCAATCCGCTAACCGCTGCTCTTTTGGCGGTCGACACCATTCAAATCCGC <br />
AGTCAATCCTTTTCTGTGGCGACAGCCAAGGAAATGCAGGGACTGTGCAGTCTGTTCGAT <br />
CAGGCACGATCGCAATTGCGTGAAATCGAGCGCATGATTGCCGAGATTTTGGAGGCAACT <br />
CGCCACTCTGGCGAAAGCTTGCGGATCAATCCCCGCGAAGTCGTCTTTGAGCCGCTCTTA<br />
CAACAGGTTCTGGAACAGTTGCATGAACGCTGGCGGAGTAAGCAGCAGCAGTTGATCACG <br />
GATGTTCCAGGCGACCTGCCCACGCTCTACGCCGACCCTGACCGTCTGCGGCAGGTTCTG <br />
GTCAATCTGCTAGACAACGCCATCAAATACACTCCGCCCGGGGGCACAATCACGATCGCA <br />
GCGCTCCATCGCACGAGCCAGAAAGTGCAGATCAGCATCAGCGACACGGGCTCTGGCATC <br />
CCTCGCGACCAGCTCAGCGTCATTTTCAAGAACTTGGTGCGGCTTTCCCGCGATAGCAGC <br />
CAAGAGGGCTACGGCATTGGACTATCGGTTTGCCAGCGAATTGTTCAGGCCCACTTTGGC <br />
CGCATCTGGGTTGCTTCGGAACTGGGCCAAGGCAGCACCTTCCACTTCACGATGCCGGTT<br />
TATCGCTACACCATGCCCTGCTAA <br />
<br />
<br />
<br />
==Seq R0082+E0240==<br />
tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggat <br />
tattctgcatttttggggagaatggacttactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttca <br />
ctggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggt <br />
gatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcac <br />
tactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgc <br />
ccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaa <br />
ggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattgga <br />
atacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagac <br />
acaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtcctttta <br />
ccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttga <br />
gtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaa <br />
cgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactgg<br />
ctcaccttcgggtgggcctttctgcgtttata</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Cyanobacteria_SequenceTeam:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence2008-10-30T01:12:51Z<p>Blackrabbit: New page: ==Seq pOmpF== GACGGTGTTCACAAAGTTCCTTAAATTTTACTTTTGGTTACATATTTTTTCTTTTTGAAACCAAATCTTTATCTTTGTAG CACTTTCACGGTAGCGAAACGTTAGTTTGAATGGAAAGATGCCTGC ==Seq RpaA== ATGAAACCCCGCATCCTCGTGATCGA...</p>
<hr />
<div>==Seq pOmpF==<br />
GACGGTGTTCACAAAGTTCCTTAAATTTTACTTTTGGTTACATATTTTTTCTTTTTGAAACCAAATCTTTATCTTTGTAG CACTTTCACGGTAGCGAAACGTTAGTTTGAATGGAAAGATGCCTGC <br />
<br />
<br />
<br />
==Seq RpaA==<br />
ATGAAACCCCGCATCCTCGTGATCGATGATGACTCAGCCATCTTGGAGCTGGTCGCCGTCAATCTGGAGATGTCTGGCTAT<br />
GACGTACGCAAAGCTGAGGACGGCATTAAAGGTCAGGCTTTAGCTGTTCAGCTAGTTCCCGACCTGATCATGCTGGATC <br />
TAATGCTGCCGCGGGTTGATGGCTTTACCGTCTGTCAGCGACTGCGGCGCGATGAGCGTACTGCCGAAATTCCGGTGCTG <br />
ATGCTGACCGCCCTCGGACAGACTCAGGATAAGGTTGAAGGCTTCAACGCGGGTGCTGACGATTATCTGACTAAGCCCTT <br />
CGAAGTTGAAGAGATGCTGGCCCGCGTGCGTGCCTTGCTGCGGCGCACCGATCGCATTCCCCATGCAGCCCGCCATAGCG <br />
AAATTCTCAGCTACGGTCCGCTGACCCTGATTCCCGAGCGGTTTGAGGCCATTTGGTTCAACCGCACGGTCAAGCTGACT <br />
CACTTGGAATTTGAGTTGTTGCACTGCCTGTTGCAACGCCACGGCCAAACGGTTGCGCCGAGCGAAATCCTCAAAGAAGT <br />
CTGGGGCTATGATCCCGACGATGACATCGAGACGATTCGCGTCCACATCCGTCATCTGCGCACCAAGCTCGAGCCCGATC <br />
CCCGGCACCCGCGCTACATCAAAACGGTCTATGGAGCGGGCTACTGCCTTGAGCTGCCGGCCGAGACGGAACTCCACCAA<br />
CACGCCGATCAGTTTCCTTCGGCGTCCTGA <br />
<br />
<br />
<br />
==Seq SasA==<br />
<br />
ATGGGAGAGTCTCTGTCACCACAAGCACTGGCTCAACCGTTGCTACTGCAACTGTTCGTC<br />
GATACCCGGCCCCTGTCACAGCACATTGTGCAGCGGGTTAAAAATATTTTGGCAGCAGTA <br />
GAGGCAACCGTCCCCATCAGCTTGCAGGTGATCAATGTGGCGGACCAGCCACAACTGGTG <br />
GAGTACTACCGCCTAGTCGTCACGCCTGCCCTGGTTAAAATTGGTCCAGGCTCTCGCCAA <br />
GTTCTGAGTGGCATCGACCTCACCGATCAATTAGCCAACCAGTTGCCCCAGTGGCTGGTT <br />
CAGCAAGAGGCCTTTTTTGCCGATCGAGAGCCACCTGAAGTCAACATTCCGTTCACGGAG <br />
CTAGGCCAACCCGAGACCCCCGCGTTGCAGCAGGCTGATGCCTTTTTTCAGCTTCAGCAA <br />
CAATACGCTGATCTCTCGGAGCGGACAAAATTCCTTGAGCAGGTCATTGCTCTCGTCGCC <br />
CACGACCTCCGCAATCCGCTAACCGCTGCTCTTTTGGCGGTCGACACCATTCAAATCCGC <br />
AGTCAATCCTTTTCTGTGGCGACAGCCAAGGAAATGCAGGGACTGTGCAGTCTGTTCGAT <br />
CAGGCACGATCGCAATTGCGTGAAATCGAGCGCATGATTGCCGAGATTTTGGAGGCAACT <br />
CGCCACTCTGGCGAAAGCTTGCGGATCAATCCCCGCGAAGTCGTCTTTGAGCCGCTCTTA<br />
CAACAGGTTCTGGAACAGTTGCATGAACGCTGGCGGAGTAAGCAGCAGCAGTTGATCACG <br />
GATGTTCCAGGCGACCTGCCCACGCTCTACGCCGACCCTGACCGTCTGCGGCAGGTTCTG <br />
GTCAATCTGCTAGACAACGCCATCAAATACACTCCGCCCGGGGGCACAATCACGATCGCA <br />
GCGCTCCATCGCACGAGCCAGAAAGTGCAGATCAGCATCAGCGACACGGGCTCTGGCATC <br />
CCTCGCGACCAGCTCAGCGTCATTTTCAAGAACTTGGTGCGGCTTTCCCGCGATAGCAGC <br />
CAAGAGGGCTACGGCATTGGACTATCGGTTTGCCAGCGAATTGTTCAGGCCCACTTTGGC <br />
CGCATCTGGGTTGCTTCGGAACTGGGCCAAGGCAGCACCTTCCACTTCACGATGCCGGTT<br />
TATCGCTACACCATGCCCTGCTAA <br />
<br />
<br />
<br />
==Seq R0082+E0240==<br />
tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggat <br />
tattctgcatttttggggagaatggacttactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttca <br />
ctggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggt <br />
gatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcac <br />
tactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgc <br />
ccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaa <br />
ggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattgga <br />
atacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagac <br />
acaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtcctttta <br />
ccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttga <br />
gtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaa <br />
cgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactgg<br />
ctcaccttcgggtgggcctttctgcgtttata</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T01:07:35Z<p>Blackrabbit: /* Cyanoxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq pOmpF|seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq RpaA|seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq SasA|seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq R0082+E0240|seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T01:06:39Z<p>Blackrabbit: /* Cyanoxilator */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence#seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T00:53:27Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T00:47:35Z<p>Blackrabbit: /* Experimental Results */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment# Experiments|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
Use Biobrick part names<br />
BBa_K116000 to BBa_K116099<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
Use Biobrick part names<br />
BBa_K116100 to BBa_K116199<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
Use Biobrick part names<br />
BBa_K116200 to BBa_K116299<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
Use Biobrick part names<br />
BBa_K116300 to BBa_K116399<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
Use Biobrick part names<br />
BBa_K116400 to BBa_K116499<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
Use Biobrick part names<br />
BBa_K116500 to BBa_K116599<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
Use Biobrick part names<br />
BBa_K116600 to BBa_K116699<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T00:46:11Z<p>Blackrabbit: /* Experimental Results */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment#Circuit Design and Methods|Attachment]]<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]]<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]]<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]]<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
Use Biobrick part names<br />
BBa_K116000 to BBa_K116099<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
Use Biobrick part names<br />
BBa_K116100 to BBa_K116199<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
Use Biobrick part names<br />
BBa_K116200 to BBa_K116299<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
Use Biobrick part names<br />
BBa_K116300 to BBa_K116399<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
Use Biobrick part names<br />
BBa_K116400 to BBa_K116499<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
Use Biobrick part names<br />
BBa_K116500 to BBa_K116599<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
Use Biobrick part names<br />
BBa_K116600 to BBa_K116699<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2008-10-30T00:45:57Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= Experimental Results = <br />
Experimental Results by subteam:<br />
* [[Team:NYMU-Taipei/Project/pH Sensor#Experimental|pH Sensor]].<br />
* [[Team:NYMU-Taipei/Project/Attachment#Circuit Design and Methods|Attachment]].<br />
* [[Team:NYMU-Taipei/Project/Urea#Experimental|Urea]].<br />
* [[Team:NYMU-Taipei/Project/Guanidine#Experimental|Guanidine]].<br />
* [[Team:NYMU-Taipei/Project/Phosphate#Experimental Results|Phosphate]].<br />
* [[Team:NYMU-Taipei/Project/Time Regulation#Experimental Results|Time Regulation]].<br />
<br />
<br />
=Parts=<br />
These are the parts that we have contributed to the Biobricks database.<br />
== pH Sensor ==<br />
Use Biobrick part names<br />
BBa_K116000 to BBa_K116099<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116001<br />
|Regulatory<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|BBa_K116002<br />
|Reporter<br />
|277<br />
| -<br />
|''nhaA'' promoter, that can be regulated by pH and nhaR protein. <br />
|It's ''E.coli'' K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. <br />
|Finish<br />
|''E.coli'' K12 MG1655<br />
|-<br />
|}<br />
<br />
== Attachment ==<br />
Use Biobrick part names<br />
BBa_K116100 to BBa_K116199<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
<br />
|-<br />
|BBa_K116101<br />
|Coding<br />
|903<br />
|<br />
|FimH binding domain (''Pst'' I mutant by our design)<br />
|The ''pst'' I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part.<br />
|Finish<br />
|''E. coli''K. 12 MG1655<br />
|-<br />
|BBa_K116102<br />
|Coding<br />
|392<br />
|<br />
BBa_R0010<br />
BBa_B0034<br />
BBa_J36835<br />
BBa_J36836<br />
|IPTG induced device. Expression of membrane protein.<br />
|This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively.<br />
|<br />
|BBa_J36848<br />
|-<br />
|}<br />
<br />
== Urea ==<br />
Use Biobrick part names<br />
BBa_K116200 to BBa_K116299<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
|-<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
| BBa_K116201 || Coding || 1324 || - || ureD promoter || An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter.|| Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993) <br />
|| ''Proteus mirabilis'' HI4320<br />
|-<br />
| BBa_K116202 || Coding ||bp|| - || ureI || An urea transpoter<br />
| The source of urea sensor is the bacteria, ''Proteus mirabilis'', whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See ''J. Bacteriol.'' 175 (2), 465-473 (1993)<br />
Since the genome of ''Proteus mirabilis'' is still undersequencing, we choose ''Helicobacter pylori'' as the source of urea transporter. See ''Nature'' 397 (6715), 176-180 (1999).<br />
These associated geens are also found in several plasmids in certain strains of enterobacteria. <br />
||<br />
''Helicobacter pylori'' J99<br />
|}<br />
<br />
== Guanidine ==<br />
Use Biobrick part names<br />
BBa_K116300 to BBa_K116399<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
|BBa_K116000<br />
|coding<br />
|1562 bp<br />
|<br />
|yaaU<br />
|predicted organic cation transporter<br />
|putative transport protein similiar to organic cation transporter 3 (OCT3)<br />
<br />
<br />
|E coli. K-12<br />
|-<br />
|BBa_K116006<br />
|coding<br />
|237 bp (total bp)<br />
|<br />
|A frontal fragment of OCT3<br />
|split gene for a point mutation at about length 230 bp of OCT3 <br />
|<br />
|Human<br />
|-<br />
|BBa_K116012<br />
|composite<br />
|bp<br />
|BBa_B0032+BBa_K116000 <br />
|Ribosomal binding site+putative transport protein<br />
|No promoter driven yet<br />
|<br />
|<br />
|-<br />
|BBa_K116013<br />
|composite<br />
| bp<br />
|BBa_R0010+BBa_B0032+BBa_K116000<br />
|pLac promoter+ribosomal binding site+putative transport protein<br />
|<br />
|<br />
|<br />
|}<br />
<br />
== Phosphate ==<br />
Use Biobrick part names<br />
BBa_K116400 to BBa_K116499<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?)<br />
|-<br />
<br />
|BBa_K116401<br />
| Basic, Regulatory<br />
| 506 bps<br />
| Basic<br />
| external phosphate sensing promoter<br />
| promoter of ''phoB'' in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation.<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116402<br />
| Basic, coding<br />
| 2067 bps<br />
| Basic<br />
| polyphosphate kinase, a synthase of Polyphosphate<br />
| gene ''ppk'' in ''E.coli'', an synthase of Polyphosphate to store phosphate into Polyphosphate form <br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116403<br />
| Basic, coding<br />
| 4673 bps<br />
| Basic<br />
| high affinity phosphate transporter<br />
| It is the operon of ''pst'' phosphate transporter in ''E.coli.'' There are five genes in this operon: ''pstS'', ''pstA'', ''pstC'', ''pstB'' and ''phoU.''<br />
| <br />
| ''E.coli''<br />
|-<br />
<br />
|BBa_K116404<br />
| Composite, Measure/Reporter<br />
| bps<br />
| <br />
BBa_K116401<br />
BBa_E0240<br />
| external phosphate sensing reporter<br />
| It will express GFP when external phosphate is low.<br />
| n/a<br />
| ''E.coli''<br />
|-<br />
<br />
|}<br />
<br />
== Time Regulation ==<br />
=== Cyanoxilator ===<br />
Use Biobrick part names<br />
BBa_K116500 to BBa_K116599<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Sequence/Design notes !! Source (where does it come from?)!!Reference<br />
|-<br />
<br />
|BBa_K116500<br />
|Regulatory<br />
|126 <br />
|<br />
|OmpF promoter that is activated or repressesed by OmpR according to osmolarity.<br />
<br />
|Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins<br />
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo<br />
larity, OmpF predominates in the outer membrane,<br />
while at high osmolarity the OmpF porin is<br />
replaced by OmpC.OmpF has a larger pore and a<br />
faster ¯ow rate than OmpC.<br />
|[[seq pOmpF]]<br />
|E. coli K12<br />
<br />
|K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).<br />
|-<br />
|BBa_K116501<br />
|Coding <br />
|750<br />
|<br />
|RpaA(regulator of phycobilisome-associated)<br />
| The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq RpaA]]<br />
|<br />
Synechococcus elongatus PCC7942<br />
|1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116502 <br />
|Coding<br />
|1164<br />
|<br />
|SasA(Synechococcus adaptive sensor A)<br />
|The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR.<br />
|[[seq SasA]]<br />
|Synechococcus elongatus PCC7942<br />
<br />
|1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).<br />
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep<br />
Sep, 2007).<br />
|-<br />
|BBa_K116503<br />
|Reporter <br />
|992<br />
|BBa_R0082 BBa_E0240<br />
|GFP under control of pOmpC promoter.R0082+E0240<br />
|<br />
|[[seq R0082+E0240]]<br />
|<br />
|<br />
|-<br />
|BBa_K116523<br />
|composite<br />
|<br />
|BBa_K116503 BBa_K116511<br />
|GFP under control of RpaA activated pOmpC promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116533<br />
|<br />
|<br />
|BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116510<br />
|Reporter <br />
|<br />
|BBa_K116500 BBa_E0240<br />
|GFP under control of pOmpF promoter.K116500+E0240<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116520<br />
|composite<br />
|<br />
|BBa_K116510 BBa_K116511<br />
|GFP under control of RpaA activated pOmpF promoter<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116530<br />
|Device<br />
|<br />
|BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04148<br />
|Intermediate<br />
|<br />
|BBa_K116501 BBa_B0034<br />
|RpaA with RBS(K116501+B0034)<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116511<br />
|Generator<br />
|<br />
|BBa_R0040 BBa_S04148<br />
|TetR regulated RpaA generator(R0040+B0034+K116501) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116512<br />
|temporary<br />
|<br />
|BBa_B0034 BBa_K116502 <br />
|SasA with RBS(B0034+K116502) <br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K116522<br />
|Generator<br />
|<br />
|BBa_K116512 BBa_B0015 <br />
|SasA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_K1165004<br />
|Device<br />
|<br />
|BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336<br />
|Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC<br />
|<br />
|KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)<br />
|<br />
<br />
|<br />
|-<br />
|BBa_K116514<br />
|Device<br />
|<br />
|BBa_K116522 BBa_K116504 <br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04149<br />
|intermediate<br />
|<br />
|R0040:B0034<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04150<br />
|intermediate<br />
|<br />
|J36801:B0015<br />
|<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|BBa_S04151<br />
|intermediate<br />
|<br />
|S04149:S04150<br />
|KaiA generator<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
<br />
=== Reloxilator ===<br />
Use Biobrick part names<br />
BBa_K116600 to BBa_K116699<br />
{| border="1" style="width:90%;margin-left:5%;"<br />
! Part Name !! Part Type !! Part Length !! Subparts !! Short Description (max 60 chars) !! Long Description (what it is, what it does, how to use) !! Design Notes !! Source (where does it come from?) || internal code<br />
<br />
|-<br />
| BBa_K116601 || Coding || 1935 || || HtlB (ftsH) coding region from ''E. coli'' || The HtlB (ftsH) coding region from ''E. coli''. It can be used to degrade many different proteins. || || ''E. coli K. 12 MG1655'' || (1) 1<br />
|-<br />
| BBa_K116602 || Coding || 294 || || CII coding region from ''&lambda; phage'' || The CII coding region from ''&lambda; phage''. || || ''&lambda; phage'' || (2) 2<br />
|-<br />
| BBa_K116603 || Regulatory || 48 || || pRE promoter from ''&lambda; phage'' || The pRE coding region from ''&lambda; phage''. It is able to be induced by CII (BBa_K116602). || || ''&lambda; phage'' || (3) 3<br />
|-<br />
| BBa_K116609 || Coding || 90 || || CIIICd: modified CIII coding region from ''&lambda; phage'' || CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.<br />
'''Original CIII''':<br />
'''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''<br />
'''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC<br />
AAACACTTATGGCTATCCAGAC</font>'''TAA'''<br />
The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).<br />
| HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. || ''&lambda; phage'' || (4) 9<br />
|-<br />
| BBa_K116611 || Intermediate || 2072 || BBa_K116601 BBa_B0015 || HtlB + BBa_B0015 || HtlB + T. || || || (5) 1T<br />
|-<br />
| BBa_K116612 || Intermediate || 431 || BBa_B0032 BBa_K116602 || BBa_B0015 + CII || R + CII. || || || (6) R2<br />
|-<br />
| BBa_K116613 || Intermediate || 69 || BBa_K116603 BBa_B0032 || CIIICd + BBa_B0015 || CIIICd + RBS. || || || (7) 3R<br />
|-<br />
| BBa_K116614 || Reporter || 932 || BBa_K116603 BBa_E0240 || pRE + BBa_E0240 || The reporter for pRE. || || || (8) 3R4T<br />
|-<br />
| BBa_K116615 || Intermediate || 755 || BBa_K116605 BBa_B0015 || LuxI + BBa_E0240 || LuxI + T. || || || (9) 5T<br />
|-<br />
| BBa_K116616 || Intermediate || 775 || BBa_B0032 BBa_K116606 || BBa_R0032 + LuxR || RBS + LuxR. || || || (10) R6<br />
|-<br />
| BBa_K116617 || Reporter || 939 || BBa_R0062 BBa_E0240 || pLux + BBa_E0240 || The reporter for pLux. || || || 7R4T<br />
|-<br />
| BBa_K116618 || Reporter || 1084 || BBa_R0010 BBa_E0240 || pLac + BBa_E0240 || The reporter for pLac. || || || 8R4T<br />
|-<br />
| BBa_K116619 || Intermediate || 227 || BBa_K116609 BBa_B0015 || CIIICd + BBa_B0015 || CIIICd + T. || || || 9T<br />
<br />
|-<br />
| BBa_K116622 || Generator || 450 || BBa_B0032 BBa_K116612 || BBa_B0032 + CII + BBa_B0015 || RBS + CII + T. || || || R2T<br />
|-<br />
| BBa_K116625 || Generator || 774 || BBa_B0032 BBa_K116615 || BBa_B0032 + LuxI + BBa_B0015 || RBS + LuxI + T. || || || R5T<br />
|-<br />
| BBa_K116626 || Generator || 912 || BBa_K116606 BBa_B0015 || BBa_B0032 + LuxR + BBa_B0015 || RBS + LuxR + T. || || || R6T<br />
|-<br />
| BBa_K116629 || Generator || 246 || BBa_B0032 BBa_K116609 || BBa_B0032 + CIIICd + BBa_B0015 || RBS + CIIICd + T. || || || R9T<br />
<br />
|-<br />
| BBa_K116631 || Generator || 2147 || BBa_K116611 BBa_K116611 || pRE + RBS + HtlB + T || HtlB regulated by the pRE promoter. || || || 2R1T<br />
|-<br />
| BBa_K116632 || Generator || 506 || BBa_K116603 BBa_K116622 || pRE + RBS + CII + T || CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. || || || 3R2T<br />
|-<br />
| BBa_K116633 || Generator || 658 || BBa_R0010 BBa_K116622 || pLac + RBS + CII + T || CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. || || || 8R2T<br />
|-<br />
| BBa_K116634 || Intermediate || 1557 || BBa_K116616 BBa_K116625 || RBS + LuxR + RBS + LuxI + T || || || || R6R5T<br />
|-<br />
| BBa_K116635 || Generator || 830 || BBa_K116603 BBa_K116625 || pRE + RBS + LuxI + T || LuxI regulated by the pRE promoter. || || || 3R5T<br />
|-<br />
| BBa_K116636 || Generator || 968 || BBa_K116603 BBa_K116626 || pRE + RBS + LuxR + T || LuxR regulated by the pRE promoter. || || || 3R6T<br />
|-<br />
| BBa_K116637 || Generator || 513 || BBa_R0062 BBa_K116622 || pLux + RBS + CII + T || CII regulated by the pLux promoter. || || || 7R2T<br />
|-<br />
| BBa_K116638 || Generator || 982 || BBa_R0010 BBa_K116625 || pLac + RBS + LuxI + T || LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. || || || 8R5T<br />
|-<br />
| BBa_K116639 || Device || 454 || BBa_R0010 BBa_K116629 || Tuner: pLac + RBS + CIIICd + T || CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. || || || 8R9T<br />
|-<br />
| BBa_K116640 || Generator || 974 || BBa_R0040 BBa_K116626 || pTet + RBS + LuxR + T || LuxR regulated by the pTet promoter. Used to constitutively express LuxR. || || || aR6T<br />
|-<br />
| BBa_K116641 || Device || 2661 || BBa_K116631 BBa_K116632 || Oscillator || The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. || Should be a lot of notes here i'll put up later. || || 3R1T 3R2T<br />
|-<br />
| BBa_K116643 || Composite || 1598 || BBa_K116633 BBa_K116614 || pRE tester || Tests the pRE promoter to check if it's working. || || || 8R2T 3R4T<br />
|-<br />
| BBa_K116645 || Devices || 1620 || BBa_K116634 BBa_R0062 || Portable Synchronizer || A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. || || || R6R5T7<br />
|-<br />
| BBa_K116646 || Intermediate || 1487 || BBa_K116640 BBa_K116637 || || || || || aR6T 7R2T<br />
|-<br />
| BBa_K116648 || Intermediate || 1956 || BBa_K116640 BBa_K116638 || || || || || aR6T 8R5T<br />
|-<br />
| BBa_K116651 || Composite || 3593 || BBa_K116641 BBa_K116614 || Oscillator + Reporter || Oscillator + Report to test in repoting Assay. || || || 3R1T 3R2T 3R4T<br />
|-<br />
| BBa_K116656 || Composite || 2226 || BBa_K116635 BBa_K116646 || Synchronizer || The full blown Synchronizer || || || 3R5T aR6T 7R2T<br />
|-<br />
| BBa_K116658 || Composite || 2895 || BBa_K116648 BBa_K116617 || pLux Tester || A part to test the pLux promoter || || || aR6T8R5T 7R4T<br />
|-<br />
| BBa_K116659 || Composite || 3115 || BBa_K116641 BBa_K116639 || Oscillator + Tuner || Oscillator + Tuner. A tunable oscillator. || || || 3R1T 3R2T 8R9T<br />
|-<br />
| BBa_K116665 || Composite || 2134 || BBa_K116655 BBa_K116622 || Short Synchronizer || The short synchronizer that uses the portable synchronizer || || || 3R6R5T7R2T<br />
|-<br />
| BBa_K116669 || Composite || 4084 || BBa_K116659 BBa_K116614 || Oscillator + Tuner + Reporter || || || || 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116675 || Composite || 6226 || BBa_K116665 BBa_K116669 || Short Synchronizer + Oscillator + Tuner + Reporter || || || || 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T<br />
|-<br />
| BBa_K116676 || Composite || 6226 || BBa_K116656 BBa_K116669 || Synchronizer + Oscillator + Tuner + Reporter || || || || 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T<br />
|}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2008-10-30T00:36:38Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
== Project Overview ==<br />
After ingesting our BacToKidney capsule, it passes the through stomach without taking any action, nor being digested, and proceeds to the small intestine. Once in the small intestine, the [[Team:NYMU-Taipei/Project/pH Sensor|pH Sensor]] detects the change in pH and activates the clearance processes of [[Team:NYMU-Taipei/Project/Urea|Urea]], [[Team:NYMU-Taipei/Project/Phosphate|Phosphate]], and [[Team:NYMU-Taipei/Project/Guanidine|Guanidine]] from the body. To allow itself more time to perform its tasks, the [[Team:NYMU-Taipei/Project/pH Sensor|pH Sensor]] also activates the [[Team:NYMU-Taipei/Project/Attachment|Attachment]] process, making the capsule attach itself to the small intestine. After a pre-selected amount of time has passed (controlled by the [[Team:NYMU-Taipei/Project/Time Regulation|time regulating oscillators]]), the capsule detaches itself from the small intestine and exits the body.<br />
<br />
<br />
== Sales Pitch ==<br />
Kidney's are a really important part of our bodies. But what happens if they break? There are two choices: get a new one, or undergo hemodialysis.<br />
Hemodialysis prolongs life, yet it really is just another form of torture. To undergo hemodialysis, one has to go to the hospital every few days for hours at a time while a machine cleans out your blood. What's life without enjoyment? Staying tied within range of a hospital, unable to travel or go on vacation anywhere easily. <br />
Some have made a "portable" dialysis machine, but as you can see, this portable dialysis machine requires nothing less than than a small vehicle to transport it along.<br />
But what if there was the possibility of dialysis without staying tied to a hospital? if there was no need to bring heavy machinery everywhere you go?<br />
What if there was something more portable ... something you could ingest ... something ... convenient? Our project BacToKidney tries to realise this dream. We designed an ingestable bacteria capsule which would clean out the waste products in your bloodstream without the need of a machine. Think about the possibilities. Not needing to goto hospital as often. Being able to travel to faraway places. Freedom. As if life can be enjoyed once again. Wouldn't that be wonderful ...<br />
<br />
== Design ==<br />
<br />
Our design was split into four parts:<br />
* The [[Team:NYMU-Taipei/Project/pH Sensor | pH Sensor]] -- a promoter (pNhaA) which activates in an alkaline pH of around 7 to 8, the pH of the small intestine.<br />
* The [[Team:NYMU-Taipei/Project/Attachment | Attachment]] -- A mechanism to allow attaching to the small intestine.<br />
* The [[Team:NYMU-Taipei/Project/Time Regulation | regulation of time]] -- where we create a timer to control the time before detaching from the small intestine<br />
* The [[Team:NYMU-Taipei/Project/Waste Removal | removal of the waste products]] -- the removal of Urea and Guanidine; and the balancing of Phosphate.<br />
<br />
== Delegation ==<br />
Our subteams were split in this manner:<br />
<br />
* [[Team:NYMU-Taipei/Project/pH Sensor|pH Sensor]]<br />
* [[Team:NYMU-Taipei/Project/Attachment | Attachment and Detachment]]<br />
* [[Team:NYMU-Taipei/Project/Time Regulation | Time Regulation]]<br />
* [[Team:NYMU-Taipei/Project/Urea | Removal of Urea]] (part of the [[Team:NYMU-Taipei/Project/Waste Removal | Waste Removal]])<br />
* [[Team:NYMU-Taipei/Project/Guanidine | Removal of Guanidine]] (part of the [[Team:NYMU-Taipei/Project/Waste Removal | Waste Removal]])<br />
* [[Team:NYMU-Taipei/Project/Phosphate | Balancing of Phosphate]] (part of the [[Team:NYMU-Taipei/Project/Waste Removal | Waste Removal]])</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2008-10-30T00:35:54Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
== Project Overview ==<br />
After ingesting our BacToKidney capsule, it passes the through stomach without taking any action, nor being digested, and proceeds to the small intestine. Once in the small intestine, the [[Team:NYMU-Taipei/Project/pH Sensor|pH Sensor]] detects the change in pH and activates the clearance processes of [[Team:NYMU-Taipei/Project/Urea|Urea]], [[Team:NYMU-Taipei/Project/Phosphate|Phosphate]], and [[Team:NYMU-Taipei/Project/Guanidine|Guanidine]] from the body. To allow itself more time to perform its tasks, the [[Team:NYMU-Taipei/Project/pH Sensor|pH Sensor]] also activates the [[Team:NYMU-Taipei/Project/Attachment|Attachment]] process, making the capsule attach itself to the small intestine. After a pre-selected amount of time has passed (controlled by the [[Team:NYMU-Taipei/Project/Time Regulation|time regulating oscillators]]), the capsule detaches itself from the small intestine and exits the body.<br />
<br />
<br />
== Sales Pitch ==<br />
Kidney's are a really important part of our bodies. But what happens if they break? There are two choices: get a new one, or undergo hemodialysis.<br />
Hemodialysis prolongs life, yet it really is just another form of torture. To undergo hemodialysis, one has to go to the hospital every few days for hours at a time while a machine cleans out your blood. What's life without enjoyment? Staying tied within range of a hospital, unable to travel or go on vacation anywhere easily. <br />
Some have made a "portable" dialysis machine, but as you can see, this portable dialysis machine requires nothing less than than a small vehicle to transport it along.<br />
But what if there was the possibility of dialysis without staying tied to a hospital? if there was no need to bring heavy machinery everywhere you go?<br />
What if there was something more portable ... something you could ingest ... something ... convenient? Our project BacToKidney tries to realise this dream. We designed an ingestable bacteria capsule which would clean out the waste products in your bloodstream without the need of a machine. Think about the possibilities. Not needing to goto hospital as often. Being able to travel to faraway places. Freedom. As if life can be enjoyed once again. Wouldn't that be wonderful ...<br />
<br />
== Design ==<br />
<br />
Our design was split into four parts:<br />
* The [[/pH Sensor | pH Sensor]] -- a promoter (pNhaA) which activates in an alkaline pH of around 7 to 8, the pH of the small intestine.<br />
* The [[/Attachment | Attachment]] -- A mechanism to allow attaching to the small intestine.<br />
* The [[/Time Regulation | regulation of time]] -- where we create a timer to control the time before detaching from the small intestine<br />
* The [[/Waste Removal | removal of the waste products]] -- the removal of Urea and Guanidine; and the balancing of Phosphate.<br />
<br />
== Delegation ==<br />
Our subteams were split in this manner:<br />
<br />
* [[/pH Sensor|pH Sensor]]<br />
* [[/Attachment | Attachment and Detachment]]<br />
* [[/Time Regulation | Time Regulation]]<br />
* [[/Urea | Removal of Urea]] (part of the [[/Waste Removal | Waste Removal]])<br />
* [[/Guanidine | Removal of Guanidine]] (part of the [[/Waste Removal | Waste Removal]])<br />
* [[/Phosphate | Balancing of Phosphate]] (part of the [[/Waste Removal | Waste Removal]])</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_CyanoxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator2008-10-30T00:32:11Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=== Extraction of the genomic DNA of S. elongatus PCC 7942===<br />
<br />
{|<br />
|<br />
[[Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG]]<br />
|<br />
* tube 1: 101.3 ng/uL (260/280=1.85)<br />
* tube 2: 72.9 ng/uL (260/280 = 1.90)<br />
|-<br />
|}<br />
<br />
===PCR of RpaA and SasA===<br />
{| border=1<br />
! Gel check<br />
<br />
! Comments & Actions<br />
|-<br />
<br />
|[[Image:NYMU PCR rpaa sasa.jpg]]<br />
# front part of RpaA<br />
# back part of RpaA<br />
# front part of SasA<br />
# back part ofRpaA<br />
# positive control<br />
Expected length(bp)<br />
# 389<br />
# 420<br />
# 750<br />
# 472<br />
# 1600<br />
<br />
|<br />
|-<br />
<br />
|[[Image:NYMU 0910cyanopfu47M.JPG]]<br />
<br />
|successfully pcr back-SasA <br />
|-<br />
<br />
|[[Image:NYMU FRpfu47.JPG]]<br />
||successfully pcr front-RpaA<br />
|-<br />
<br />
|[[Image:NYMU 0914BR,FS49.jpg]]<br />
<br />
|<br />
* comment:<br />
successfully pcr back-RpaA and front-SasA; however they are too weak and we encountered a little bit of trouble doing overlap extension PCR<br />
* action:<br />
**gel extraction<br />
**re-design the primer of FP-in RpaA and RP-in SasA <br />
<br />
<br />
|}<br />
<br />
==Reporting assay==<br />
{| border=1<br />
! Date<br />
! O.D.600 <br />
! GFP expression<br />
! Protocol & Comments <br />
|-<br />
|9/29<br />
|[[Image:NYMU 20080929 od m9.jpg]]<br />
|[[Image:NYMU 0929GFPm.jpg]]<br />
|<br />
* The M9 does not seems to have enough nutrition for ''E. coli'' to grow.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004ODm9m.jpg]]<br />
|[[Image:NYMU 1004GFPm9m.jpg]]<br />
|<br />
|-<br />
|9/30<br />
|[[Image:NYMU 20080930 od lb.jpg|500px]]<br />
|[[Image:NYMU 0930GFPm.jpg]]<br />
|* For the 3 hr measure, the plate was not washed carefully, so there is a large background.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004odlbm.jpg]]<br />
|[[Image:NYMU 1004gfplbm.jpg]]<br />
|<br />
|-<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
==Discussion of the reporting==<br />
* Is the freshness of the bacteria important to GFP expression? If so, we should use freshly streaked plates.<br />
* The white and black plates must be cleaned carefully, otherwise there would be too much background.<br />
*pBF seemes to grow much faster than the others.<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_CyanoxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator2008-10-30T00:32:00Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=== Extraction of the genomic DNA of S. elongatus PCC 7942===<br />
<br />
{|<br />
|<br />
[[Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG]]<br />
|<br />
* tube 1: 101.3 ng/uL (260/280=1.85)<br />
* tube 2: 72.9 ng/uL (260/280 = 1.90)<br />
|-<br />
|}<br />
<br />
===PCR of RpaA and SasA===<br />
{| border=1<br />
! Gel check<br />
<br />
! Comments & Actions<br />
|-<br />
<br />
|[[Image:NYMU PCR rpaa sasa.jpg]]<br />
# front part of RpaA<br />
# back part of RpaA<br />
# front part of SasA<br />
# back part ofRpaA<br />
# positive control<br />
Expected length(bp)<br />
# 389<br />
# 420<br />
# 750<br />
# 472<br />
# 1600<br />
<br />
|<br />
|-<br />
<br />
|[[Image:NYMU 0910cyanopfu47M.JPG]]<br />
<br />
|successfully pcr back-SasA <br />
|-<br />
<br />
|[[Image:NYMU FRpfu47.JPG]]<br />
||successfully pcr front-RpaA<br />
|-<br />
<br />
|[[Image:NYMU 0914BR,FS49.jpg]]<br />
<br />
|<br />
* comment:<br />
successfully pcr back-RpaA and front-SasA; however they are too weak and we encountered a little bit of trouble doing overlap extension PCR<br />
* action:<br />
**gel extraction<br />
**re-design the primer of FP-in RpaA and RP-in SasA <br />
<br />
<br />
|}<br />
<br />
==Reporting assay==<br />
{| border=1<br />
! Date<br />
! O.D.600 <br />
! GFP expression<br />
! Protocol & Comments <br />
|-<br />
|9/29<br />
|[[Image:NYMU 20080929 od m9.jpg]]<br />
|[[Image:NYMU 0929GFPm.jpg]]<br />
|<br />
* The M9 does not seems to have enough nutrition for ''E. coli'' to grow.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004ODm9m.jpg]]<br />
|[[Image:NYMU 1004GFPm9m.jpg]]<br />
|<br />
|-<br />
|9/30<br />
|[[Image:NYMU 20080930 od lb.jpg]]<br />
|[[Image:NYMU 0930GFPm.jpg]]<br />
|* For the 3 hr measure, the plate was not washed carefully, so there is a large background.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004odlbm.jpg]]<br />
|[[Image:NYMU 1004gfplbm.jpg]]<br />
|<br />
|-<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
==Discussion of the reporting==<br />
* Is the freshness of the bacteria important to GFP expression? If so, we should use freshly streaked plates.<br />
* The white and black plates must be cleaned carefully, otherwise there would be too much background.<br />
*pBF seemes to grow much faster than the others.<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_CyanoxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator2008-10-30T00:31:14Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=== Extraction of the genomic DNA of S. elongatus PCC 7942===<br />
<br />
{|<br />
|<br />
[[Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG]]<br />
|<br />
* tube 1: 101.3 ng/uL (260/280=1.85)<br />
* tube 2: 72.9 ng/uL (260/280 = 1.90)<br />
|-<br />
|}<br />
<br />
===PCR of RpaA and SasA===<br />
{| border=1<br />
! Gel check<br />
<br />
! Comments & Actions<br />
|-<br />
<br />
|[[Image:NYMU PCR rpaa sasa.jpg]]<br />
# front part of RpaA<br />
# back part of RpaA<br />
# front part of SasA<br />
# back part ofRpaA<br />
# positive control<br />
Expected length(bp)<br />
# 389<br />
# 420<br />
# 750<br />
# 472<br />
# 1600<br />
<br />
|<br />
|-<br />
<br />
|[[Image:NYMU 0910cyanopfu47M.JPG]]<br />
<br />
|successfully pcr back-SasA <br />
|-<br />
<br />
|[[Image:NYMU FRpfu47.JPG]]<br />
||successfully pcr front-RpaA<br />
|-<br />
<br />
|[[Image:NYMU 0914BR,FS49.jpg]]<br />
<br />
|<br />
* comment:<br />
successfully pcr back-RpaA and front-SasA; however they are too weak and we encountered a little bit of trouble doing overlap extension PCR<br />
* action:<br />
**gel extraction<br />
**re-design the primer of FP-in RpaA and RP-in SasA <br />
<br />
<br />
|}<br />
<br />
==Reporting assay==<br />
{| border=1<br />
! Date<br />
! O.D.600 <br />
! GFP expression<br />
! Protocol & Comments <br />
|-<br />
|9/29<br />
|[[Image:NYMU 20080929 od m9.jpg]]<br />
|[[Image:NYMU 0929GFPm.jpg]]<br />
|<br />
* The M9 does not seems to have enough nutrition for ''E. coli'' to grow.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004ODm9m.jpg]]<br />
|[[Image:NYMU 1004GFPm9m.jpg]]<br />
|<br />
|-<br />
|9/30<br />
|[[Image:NYMU 20080930 od lb.jpg|500px]]<br />
|[[Image:NYMU 0930GFPm.jpg]]<br />
|* For the 3 hr measure, the plate was not washed carefully, so there is a large background.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004odlbm.jpg]]<br />
|[[Image:NYMU 1004gfplbm.jpg]]<br />
|<br />
|-<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
==Discussion of the reporting==<br />
* Is the freshness of the bacteria important to GFP expression? If so, we should use freshly streaked plates.<br />
* The white and black plates must be cleaned carefully, otherwise there would be too much background.<br />
*pBF seemes to grow much faster than the others.<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2008.igem.org/File:NYMU_PCR_rpaa_sasa.jpgFile:NYMU PCR rpaa sasa.jpg2008-10-30T00:28:36Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_FRpfu47.JPGFile:NYMU FRpfu47.JPG2008-10-30T00:28:29Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_20080930_od_lb.jpgFile:NYMU 20080930 od lb.jpg2008-10-30T00:28:26Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_20080929_od_m9.jpgFile:NYMU 20080929 od m9.jpg2008-10-30T00:28:21Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_20080826_PCC7942_genomic_DNA_with_1kb_marker.JPGFile:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG2008-10-30T00:28:16Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_1004ODm9m.jpgFile:NYMU 1004ODm9m.jpg2008-10-30T00:28:10Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_1004odlbm.jpgFile:NYMU 1004odlbm.jpg2008-10-30T00:28:04Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_1004GFPm9m.jpgFile:NYMU 1004GFPm9m.jpg2008-10-30T00:27:58Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_1004gfplbm.jpgFile:NYMU 1004gfplbm.jpg2008-10-30T00:27:53Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_0930GFPm.jpgFile:NYMU 0930GFPm.jpg2008-10-30T00:27:47Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_0929GFPm.jpgFile:NYMU 0929GFPm.jpg2008-10-30T00:27:43Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_0914BR,FS49.jpgFile:NYMU 0914BR,FS49.jpg2008-10-30T00:27:38Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_0910cyanopfu47M.JPGFile:NYMU 0910cyanopfu47M.JPG2008-10-30T00:27:35Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/Results_of_CyanoxilatorTeam:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator2008-10-30T00:26:14Z<p>Blackrabbit: New page: {{:Team:NYMU-Taipei/Header}} === Extraction of the genomic DNA of S. elongatus PCC 7942=== {| | Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG | * tube 1: 101.3 ng/uL (26...</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=== Extraction of the genomic DNA of S. elongatus PCC 7942===<br />
<br />
{|<br />
|<br />
[[Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG]]<br />
|<br />
* tube 1: 101.3 ng/uL (260/280=1.85)<br />
* tube 2: 72.9 ng/uL (260/280 = 1.90)<br />
|-<br />
|}<br />
<br />
===PCR of RpaA and SasA===<br />
{| border=1<br />
! Gel check<br />
<br />
! Comments & Actions<br />
|-<br />
<br />
|[[Image:NYMU PCR rpaa sasa.jpg]]<br />
# front part of RpaA<br />
# back part of RpaA<br />
# front part of SasA<br />
# back part ofRpaA<br />
# positive control<br />
Expected length(bp)<br />
# 389<br />
# 420<br />
# 750<br />
# 472<br />
# 1600<br />
<br />
|<br />
|-<br />
<br />
|[[Image:NYMU 0910cyanopfu47M.JPG]]<br />
<br />
|successfully pcr back-SasA <br />
|-<br />
<br />
|[[Image:NYMU FRpfu47.JPG]]<br />
||successfully pcr front-RpaA<br />
|-<br />
<br />
|[[Image:NYMU 0914BR,FS49.jpg]]<br />
<br />
|<br />
* comment:<br />
successfully pcr back-RpaA and front-SasA; however they are too weak and we have trouble doing overlap extension pcr <br />
* action:<br />
**gel extraction<br />
**re-design the primer of FP-in RpaA and RP-in SasA <br />
<br />
<br />
|}<br />
<br />
==Reporting assay==<br />
{| border=1<br />
! Date<br />
! O.D.600 <br />
! GFP expression<br />
! Protocol & Comments <br />
|-<br />
|9/29<br />
|[[Image:NYMU 20080929 od m9.jpg]]<br />
|[[Image:NYMU 0929GFPm.jpg]]<br />
|<br />
* The M9 seems not having enough nutrition for E. coli to grow.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004ODm9m.jpg]]<br />
|[[Image:NYMU 1004GFPm9m.jpg]]<br />
|<br />
|-<br />
|9/30<br />
|[[Image:NYMU 20080930 od lb.jpg|500px]]<br />
|[[Image:NYMU 0930GFPm.jpg]]<br />
|* For the 3 hr measure, the plate was not wash carefully, so there are large background.<br />
|-<br />
|10/4<br />
|[[Image:NYMU 1004odlbm.jpg]]<br />
|[[Image:NYMU 1004gfplbm.jpg]]<br />
|<br />
|-<br />
|<br />
|<br />
|<br />
|<br />
|-<br />
|}<br />
==Discussion of the reporting==<br />
* Are bacteria fresh or not important to GFP expression? If so, we should use freshly streaked plates.<br />
* The white and black plates must clean carefully, otherwise, there would be too much background.<br />
*pBF seem to grow much faster then others.<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2008.igem.org/Team:NYMU-Taipei/Project/Time_Regulation/CyanoxilatorTeam:NYMU-Taipei/Project/Time Regulation/Cyanoxilator2008-10-30T00:25:31Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
== Motivation ==<br />
[[Image:NYMU Timer cyano.jpg|600px|right]]<br />
* To enhance the the effect of the micro dialysis machine in the intestine lumen, the half life of the micro dialysis machine is designed to be prolonged. However, since our micro dialysis machine is made in the chassis of ''E. coli'', there are two possible risks while staying in the intestine too long. One is that the ''E. coli'' may be apoptosis or necrosis due to large amount of the metabolite wastes it absorbed. The other is the bacteria balance in the intestine may be disturbed thanks to the ''E. coli'' being added. Thus, it's crucial and necessary to have a timer in our micro dialysis machine.<br />
* Besides, the timer has many biological and engineering application, such as artificial pacemakers, biological clocks, etc.<br />
<br />
== Literature review ==<br />
===Overview of the cyanobacterial Kai oscillators [3]===<br />
[[Image:NYMU Cyanobacteria.JPG|thumb|[http://www.dkimages.com/discover/DKIMAGES/Discover/Home/Plants/Fungi-Monera-Protista/Cyanobacteria/Cyanobacteria-2.html Cyanobacteria]]]<br />
Kai proteins globally regulate circadian gene expression of cyanobacteria. The<br />
KaiC phosphorylation cycle, which persists even without transcription or<br />
translation, is assumed to be a basic timing process of the circadian clock. The self-sustainable oscillation of KaiC phosphorylation had been reconstituted in<br />
vitro by incubating KaiC with KaiA, KaiB, and adenosine triphosphate. The period<br />
of the in vitro oscillation was stable despite temperature change (temperature<br />
compensation), and the circadian periods observed in vivo in KaiC mutant<br />
strains were consistent with those measured in vitro. Therefore, it's of great possibility that the cyanobacterial Kai oscillators can also be reconstituted in ''E. coli.'' <br />
<br />
===The relationship between KaiABC proteins and their output pathways [1]===<br />
[[Image:NYMU KaiABC.JPG|center]]<br />
* (B) The oscillation in KaiC phosphorylation results from the opposing actions of KaiA, which stimulates KaiC autokinase activity, and KaiB, which attenuates the positive effect of KaiA. Increasing evidence supports the hypothesis that the phosphorylation state of KaiC affects the ability of the clock to reset properly.<br />
* (C) The SasA protein interacts with KaiC through its N terminus (hexagonal domain), which is similar in sequence but not structure to KaiB. Temporal information is transduced from the Kai oscillator to SasA through the stimulation of SasA autophosphorylation by KaiC. RpaA is activated by SasA through transfer of a phosphoryl group. LabA acts as a mediator of negative regulation from KaiC and is predicted to repress RpaA function.<br />
* (D) In addition, the Kai oscillator regulates the compaction rhythm of the cyanobacterial nucleoid (double-stranded loop), which would control accessibility of transcriptional machinery to promoter regions. <br />
* (E) SasA is not required for rhythmic chromosome compaction, but it is necessary (as is RpaA) for overt rhythmicity of gene expression. Arrows and perpendicular lines indicate, respectively, positive and negative regulation.<br />
<br />
== Aims ==<br />
# Building KaiABC proteins, SasA and RpaA in ''E. coli''.<br />
# Measuring the output of the phosphorylation status of KaiC through pPhoB, pOmpC and pOmpF.<br />
# Tuning the period of oscillation by regulating the amount of KaiA.<br />
<br />
== System Design ==<br />
=== Aim 1: Building KaiABC proteins, SasA and RpaA in E. coli.===<br />
{| border=1<br />
! States of oscillation<br />
! Status <br />
|-<br />
|[[Image:NYMU Design p.jpg|400px]]<br />
|<br />
*Interaction of C-KaiA with KaiC stimulates the autokinase activity of KaiC to result in a hyperphosphorylated KaiC protein.<br />
*Temporal information is transduced from the Kai oscillator to RpaA through SasA.<br />
<br />
|-<br />
|[[Image:NYMU Design unp.jpg|400px]]<br />
| <br />
*KaiB interacts with phosphorylated KaiC, thereby decreasing the positive role of KaiA on KaiC and promoting dephosphorylation of KaiC. <br />
*Non-phosphorylated KaiC is bound by KaiA and the cycle begins again.<br />
|}<br />
<br />
<br />
===Aim 2: Measuring the output of the phosphorylation status of KaiC through pPhoB, pOmpC and pOmpF. ===<br />
{|<br />
|[[Image:NYMU Cyano reporting circuit.jpg|400px|left]]<br />
| <br />
* Although the direct target of RpaA is still unknown, there still some predicted targets. <br />
* Since SasA and RpaA is highly homologous to EnvZ and OmpR, respectively, we predicted that RpaA may also bind to the targets of OmpR. <br />
* Besides,PhoB and OmpR are response regulators in the same subfamily and are highly homologous. Thus. PhoB may be a predicted target. Response regulators is composed of an N-terminal phosphorylation domain and a C-terminal DNA binding effector domain connected by a flexible interdomain linker. <br />
<br />
|-<br />
|}<br />
<br />
===Aim 3: Tuning the period of oscillation by regulating the amount of KaiA. ===<br />
[[Image:NYMU KaiABCcircuit.JPG]]<br />
* KaiA and KaiBC proteins is under the control of the inducible promoter in order to tune the period of oscillation by regulating the amount of KaiA<br />
<br />
== Materials ==<br />
* [http://www.bio.tamu.edu/synecho/ ''S. elongatus'' PCC 7942] from [http://www.bio.tamu.edu/facmenu/faculty/GoldenS.htm Susan Golden] and Takao Kondo<br />
* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=Search&TermToSearch=txid1140 Genome sequences of PCC 7942 at NCBI]<br />
<br />
== Method ==<br />
===assembly process===<br />
[[Image:NYMU Cyanoassembly0923.jpg|700px]]<br />
=== Extract Cyanobacteria Genomic DNA ===<br />
* [http://www.protocol-online.org/prot/Protocols/Rapid-DNA-Extraction-from-Cyanobacteria-3993.html Rapid DNA Extraction from Cyanobacteria]<br />
<pre><br />
Materials<br />
<br />
* Phenol<br />
* Chloroform<br />
* Absolute ethanol<br />
* 70% ethanol<br />
* TE buffer (10T/1E), pH 8.0<br />
* 10% SDS<br />
* 50 mg/ml lysozyme<br />
* 5 M NaCl<br />
<br />
Procedure<br />
<br />
1. Macerate Cyanobacteria in TE Buffer (10T/1E)<br />
2. Pellet the cells by centrifugation for 2 min at 10,000 rpm at room temperature<br />
3. Remove supernatant. Add 500 µl TE buffer (10T/1E).<br />
4. Add 1% SDS and 50 µl of 50 mg/ml lysozyme stock solution<br />
5. Keep at 70°C for 15 min.<br />
6. Add equal volume of Phenol : Chloroform<br />
7. Centrifuge for 10 min at 10,000 rpm at room temperature<br />
8. Take supernatant and extract it twice using 100% Chloroform extraction procedure.<br />
9. Finally take supernatant and add 0.1 volume of 5M NaCl and 2 volumes of 100% ethanol and keep for precipitation at –20°C for 2 hrs<br />
10. Centrifuge the tubes for 30 min at 15,000 rpm at 10°C<br />
11. Wash the pellet twice by 70% ethanol by centrifuging it at 10,000 rpm for 10 minutes.<br />
12. Dry the pellet and resuspend in TE buffer (10T/1E)<br />
</pre><br />
<br />
<br />
<br />
== [[Team:NYMU-Taipei/Project/Time_Regulation/Results_of_Cyanoxilator|Results]]==<br />
===Promoter Verifications of pOmpC, pOmpF and pPhoB===<br />
{|<br />
|<br />
[[Image:NYMU Cyano promoter reporter.jpg|350px]]<br />
|<br />
* pOmpC(BBa_R0082) are an already exist biobrick but so far without any verifications<br />
* pOmpF and pPhoB are two biobricks we created from PCR of ''E. coli'' K12. <br />
* Experimental results shows that the above three promoters can promote the expression of the GFP compare to blank which is GFp only without any promoter. <br />
|-<br />
|}<br />
* For other experimental data, please click [[Team:NYMU-Taipei/Project/Time_Regulation/Results_of_Cyanoxilator|here]]<br />
<br />
== Reference ==<br />
# Mackey, S. R. and S. S. Golden (2007). "Winding up the cyanobacterial circadian clock." Trends in Microbiology 15(9): 381-8.<br />
# Y. Murayama, T. Oyama, T. Kondo, J Bacteriol 190, 1691 (Mar. 2008).<br />
# Nakajima, M., K. Imai, et al. (2005). "Reconstitution of circadian oscillation of cyanobacterial KaiC phosphorylation in vitro." Science 308(5720): 414-5.<br />
# Takai, N., M. Nakajima, et al. (2006). "A KaiC-associating SasA-RpaA two-component regulatory system as a major circadian timing mediator in cyanobacteria.[see comment]." Proceedings of the National Academy of Sciences of the United States of America 103(32): 12109-14.<br />
# [http://openwetware.org/wiki/IGEM:Harvard/2006/Cyanobacteria iGEM 2006 Harvard U.]<br />
# S. Kutsuna et al., J Bacteriol 189, 7690 (Nov, 2007).<br />
<br />
== Acknowledgments ==<br />
[[Image:NYMU Takao.jpg]][[Image:NYMU Susan.jpg]]<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2008.igem.org/File:NYMU_Cyano_promoter_reporter.jpgFile:NYMU Cyano promoter reporter.jpg2008-10-30T00:22:26Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_Timer_cyano.jpgFile:NYMU Timer cyano.jpg2008-10-30T00:20:52Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_Takao.jpgFile:NYMU Takao.jpg2008-10-30T00:20:47Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_Susan.jpgFile:NYMU Susan.jpg2008-10-30T00:20:43Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2008.igem.org/File:NYMU_KaiABCcircuit.JPGFile:NYMU KaiABCcircuit.JPG2008-10-30T00:20:39Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbit