http://2008.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Jinism832008.igem.org - User contributions [en]2024-03-29T13:20:03ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/Jamboree/Schedule/Practice_sessionsJamboree/Schedule/Practice sessions2008-10-30T06:53:56Z<p>Jinism83: /* Friday November 7 : Practice Talks sign-up sheet */</p>
<hr />
<div>== Friday November 7 : Practice Talks sign-up sheet ==<br />
<br />
<br />
Use this sign-up sheet to sign up for a slot on Friday night (November 7) to practice your talk. Note that there will NOT be any A/V (audio/visual) support on staff. All classrooms will be unlocked and you should use them and leave them as you found them. <br />
<br />
There are a limited number of time slots available so please only choose one slot. We cannot match the room that you will ultimately give your presentation in with the practice room. This should, however, give you a chance to practice your talk in a new environment.<br />
<br />
Also, there will also be pre-registration available beginning at 6pm. Conference services will be on-site to pass out team registration boxes (see the [[Jamboree/Compete#Team_boxes | Jamboree compete]] page). <br />
<br />
<br />
(Pizza and refreshments will be available on a first-come first-serve basis)<br />
<br />
<br />
<html><br />
<link rel="stylesheet" href="http://parts.mit.edu/igem07/index.php?title=User:Macowell/schedule.css&action=raw&ctype=text/css"><br />
<table class="calendar"><h2 class="date"><a name="Friday Practice">Friday, November 7</a></h2><br />
<thead><br />
<tr><br />
<th width="15%">Time</th><br />
<th>room 123</th><br />
<th>room 124</th><br />
<th>room 141</th><br />
<th>room 144</th><br />
<th>room 155</th><br />
<th>room G449</th><br />
<th>room D463</th><br />
<th>room 261*</th><br />
<th>room 262*</th><br />
<th>room 346*</th><br />
<th>room 397*</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="even"><br />
<th>6:00p - 6:30p</th><br />
<td>KULeuven</td><br />
<td>UC Berkeley Tools</td><br />
<td>University of Sheffield</td><br />
<td>Melbourne</td><br />
<td>Imperial College</td><br />
<td>F1</td><br />
<td>G1</td><br />
<td>H1</td><br />
<td>I1</td><br />
<td>J1</td><br />
<td>K1</td><br />
</tr><br />
<tr class="odd"><br />
<th>6:30p - 7:00p</th><br />
<td>Heidelberg</td><br />
<td>HKUSTers</td><br />
<td>IIT madras</td><br />
<td>Slovenia</td><br />
<td>E2</td><br />
<td>F2</td><br />
<td>G2</td><br />
<td>H2</td><br />
<td>I2</td><br />
<td>J2</td><br />
<td>K2</td><br />
</tr><br />
<tr class="even"><br />
<th>7:00p - 7:30p</th><br />
<td>Warsaw</td><br />
<td>UVA</td><br />
<td>UChicago</td><br />
<td>Bologna</td><br />
<td>NYMU-Taipei</td><br />
<td>F3</td><br />
<td>UNIPV-Pavia</td><br />
<td>UC Berkeley</td><br />
<td>I3</td><br />
<td>J3</td><br />
<td>K3</td><br />
</tr><br />
<tr class="even"><br />
<th>7:30p - 8:00p</th><br />
<td>UCSF</td><br />
<td>Peking</td><br />
<td>Delft UT</td><br />
<td>Calgary WetWare</td><br />
<td>iHKU</td><br />
<td>F4</td><br />
<td>Valencia</td><br />
<td>H4</td><br />
<td>I4</td><br />
<td>J4</td><br />
<td>K4</td><br />
</tr><br />
<tr class="odd"><br />
<th>8:00p - 8:30p</th><br />
<td>Caltech</td><br />
<td>Tsinghua</td><br />
<td>CPU-NanJing</td><br />
<td>Paris</td><br />
<td>Washington</td><br />
<td>F5</td><br />
<td>G5</td><br />
<td>H5</td><br />
<td>I5</td><br />
<td>J5</td><br />
<td>K5</td><br />
</tr><br />
<tr class="even"><br />
<th>8:30p - 9:00p</th><br />
<td>Kyoto</td><br />
<td>Alberta_NINT</td><br />
<td>ULeth</td><br />
<td>UAlberta</td><br />
<td>USTC</td><br />
<td>F6</td><br />
<td>G6</td><br />
<td>H6</td><br />
<td>I6</td><br />
<td>J6</td><br />
<td>K6</td><br />
</tr><br />
<tr class="odd"><br />
<th>9:00p - 9:30p</th><br />
<td>Tianjin</td><br />
<td>Waterloo</td><br />
<td>Lethbridge_CCS</td><br />
<td>Rice University</td><br />
<td>Calgary_Ethics</td><br />
<td>H7</td><br />
<td>Chiba</td><br />
<td>H7</td><br />
<td>I7</td><br />
<td>J7</td><br />
<td>K7</td><br />
</tr><br />
<tr class="even"><br />
<th>9:30p - 10:00p</th><br />
<td>Utah State</td><br />
<td>Michigan</td><br />
<td>C8</td><br />
<td>D8</td><br />
<td>E8</td><br />
<td>F8</td><br />
<td>G8</td><br />
<td>H8</td><br />
<td>I8</td><br />
<td>J8</td><br />
<td>K8</td><br />
</tr><br />
</tbody><br />
</table><br />
</html><br />
<br />
<br />
Note that rooms marked with an asterisk (*) are smaller conference rooms throughout the Stata Center. Saturday sessions will not be held in these rooms but in order to accommodate all teams who would like to practice their presentations in the 4-hour period on Friday night, we must open these rooms for practice sessions.</div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T06:51:20Z<p>Jinism83: /* D. Testing the viability of enzymes produced by the cells */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
<br />
1) Ligase strain – The gene for ligase has been cloned and integrated into the genome of lefty and righty cells, and they were named as Ligase Lefty (LL) and Ligase Righty (LR). These strains have successfully been used to simplify the cloning procedure. <br />
<br />
To test these strains, we put tet promoter in pBjh1601CA plasmid and methylated BglII restriction site by passaging it through Lefty cells by transformation and plasmid DNA purification. Similarly the GFP with RBS was put in pBjh1601AK plasmid and BamHI restriction site was methylated by Righty cell. In a single microcentrifuge tube, 5.8uL of water, 1uL of 10X NEB2+10mM ATP, 0.3uL of each BamHI, BglII, XhoI, and T4 DNA ligase, and 1uL of each Lefty and Righty metyhlated plasmids were added. It was incubated at 37C for 1hr, and 30min at room temperature. It was then introduced into LL and LR by transformation, plated on LB agar plate with CmR and KanR, and grown overnight at 37C. As a control, we also introduced the same reaction cocktail into regular Lefty and Righty cells by transformation. A lot more colonies were growing when they were transformed into LL and LR. About 90% of the LL and LR were glowing green which meant the ligase strains are working well. Some of the colonies from the other 10% of the population that were not glowing green were sequenced, and deletion of DNA was observed which suggests that ligases are mutagenic and the expression of ligase must be regulated. <br />
<br />
[[Image:LLLR.jpg|800px|]]<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T06:50:18Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.png|800px|thumb|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombo.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.gif|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T06:49:41Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.png|800px|thumb|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombo.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.gif|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T06:48:42Z<p>Jinism83: /* References */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.png|800px|thumb|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombo.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.gif|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-30T06:45:15Z<p>Jinism83: /* Entry Layer */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transferred to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-30T06:45:00Z<p>Jinism83: /* Entry Layer */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg|500px|]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transferred to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-30T06:44:48Z<p>Jinism83: /* Entry Layer */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg|1000px|]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transferred to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/LayeredAssemblyTeam:UC Berkeley/LayeredAssembly2008-10-30T06:44:37Z<p>Jinism83: /* Entry Layer */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Project Motivation'''</font></div><br><br />
<br />
=='''Project Motivation'''==<br />
<br />
Imagine a world with no mini-preps. A world where expensive cloning reagents were unnecessary. A world where DNA and protein extraction and purification could be accomplished in a single microcentrifuge tube. We did, and so we created Clonebots, an automated approach to synthetic biology. <br />
<br />
Clonebots seeks to simplify and automate common laboratory procedures to protocols involving only liquid handling steps that can be readily performed by robots. We will accomplish this by genetically encoding many of the required steps in ''E. coli'', thereby allowing the cells to perform the required protocols ''in vivo''. We worked on a wide variety of devices for these projects, and the details about our devices are described throughout this wiki. Most of our devices are associated with biologically encoding the reactions needed for standard assembly.<br />
<br />
=='''Layered Assembly'''==<br />
<br />
Our efforts to genetically encode standard assembly protocols centered around the layered assembly scheme used by the Anderson Lab at UC Berkeley. Layered assembly is a straight-forward and robust method for combining two or more basic parts into a destination vector. It involves three basic layers of vectors: Entry, Assembly and Destination. Parts are passed between the layers using Gateway reactions (normal arrows) and are assembled within the Assembly layer using 2ab reactions (Chevron arrows), a variation on Biobrick standard assembly. Entry and Assembly vectors are standardized for ease of use, while the Destination vectors can be tailored to a specific experiment or assay.<br />
<br />
[[Image:layered Assembly.jpg|center|frame|350px|A schematic representation of Layered Assembly]]<br />
<br />
==='''Entry Layer'''===<br />
<br />
Biobrick parts are created in an entry vector. The Entry vector contains a Spectinomycin antibiotic resistance marker and Biobrick restriction sites (EcoRI, XbaI, and SpeI for the BBa standard; EcoRI, BglII, and BamHI for the BBb1 standard). The restriction sites are flanked by attR1 and attR2 recombination sites. Since the entry plasmid contains attR recombination sites, the basic part can easily be transferred into one of six different assembly vectors using the Gateway cloning scheme:<br />
<br />
[[Image: entry plasmid.jpg|300px|]]<br />
<br />
==='''Assembly Layer'''===<br />
<br />
The Assembly layer is used to combine two or more basic parts in a specified order to create a composite part. <br />
<br />
There are six assembly plasmids which contain two of three different antibiotic resistance markers (kanamycin, ampicillin and Chloramphenicol) separated by a XhoI restriction site. The basic parts are flanked by BglII and BamHI restriction sites. <br />
<br />
The choice of antibiotic resistance markers in the assembly plasmids is predetermined such that once the two plasmids recombine, the new plasmid will have a combination of markers from the two assembly vectors. Although there are four possible products of this reaction, only one will have both of the correct antibiotic resistance markers. <br />
<br />
The [[Team:UC_Berkeley_Tools/Project/Downloads|Clotho]] program developed by the UC Berkeley Comp team generates an assembly tree that minimizes the number of reactions required to make a composite part.<br />
<br />
The Assembly plasmids are transformed into cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites.<br />
<br />
In a single microcentrifuge tube, lefty and righty plasmid DNA is combined, along with BamHI, BglII, XhoI restriction enzymes and ligase. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The BamHI site in lefty and the BglII site in righty, and the XhoI sites in both plasmids will be cut. Ligase will join the XhoI sites and the BglII/BamHI complimentary sticky ends to create a composite part with a different combination of antibiotic resistance genes than either parent plasmid.<br />
<br />
[[Image:cdb2ab.jpg]]<br />
<br />
The assembly reaction can be repeated to combine a number of basic parts in a desired order.<br />
<br />
Once the composite part is complete, it is transferred to a destination plasmid.<br />
<br />
==='''Destination Layer'''===<br />
<br />
Completed composite parts are transferred from the assembly layer to the destination layer using the Gateway cloning scheme. The destination plasmid is tailored to a specific experiment or assay. This allows a single composite part to be transferred to several different destination plasmids for further experimentation or characterization.<br />
<br />
=='''Issues with Current Methods'''==<br />
# Current protocols for standard assembly work pretty well, but assembly of basic parts remains the time and cost-limiting aspect of synthetic biology research. Clonebots will help us simplify standard assembly procedures making them more amenable to large-scale automation.<br />
# Gateway reactions, used for transferring basic parts into the assembly plasmids and transferring composite parts into destination plasmids, are expensive ($8.65/reaction).<br />
# Mini-preps are time-consuming and expensive. <br />
# People are more prone to make mistakes, i.e. switch tubes, use the wrong enzymes, etc. than robots.<br />
<br />
=='''Clonebots Solutions'''==<br />
<br />
# Engineer cells to express their own integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes to perform ''in vivo'' Gateway reactions.<br />
# Eliminate mini-prep steps from cloning protocols by using our lysis device and ''in vivo'' assembly.<br />
# Engineer cells and plasmids to express their own BamHI, BglII, Cre, and ligase enzymes so that assembly reactions in cell lysate and ''in vivo'' are possible.<br />
# Develop protocols that involve only liquid handling steps, so that cloning can be automated, requiring less money and labor.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_anthropological_narrativeTemplate:Team:UC Berkeley/Notebook/MT anthropological narrative2008-10-30T06:43:06Z<p>Jinism83: </p>
<hr />
<div>{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Summary and Narrative'''</font></div><br><br />
<br />
'''Summary:'''<br />
<br />
This year’s UC Berkeley iGEM team project includes a human practices component. It is the second Berkeley team to include one, and the 2007 UC Berkeley iGEM team was the first of any team to address human practices issues (read Kristin Fuller’s notebook [https://2007.igem.org/Kristin_Fuller_Notebook here]). In relation to research being conducted under the banner of synthetic biology, human practices, as defined by the Synthetic Biology Engineering Research Center (SynBERC), proposes to: <br />
<br />
-PROBLEMATIZE critical domains of human life, such as energy, health, security, and environment.<br />
<br />
-RAISE THE QUESTION of the good life (''eudaimonia'') in contemporary forms.<br />
<br />
-CALL FOR COLLABORATION in the recognition of shared problems, stakes, challenges, and evolving norms. [1]<br />
<br />
This year’s HP component differs from last year’s in its focus not on a delineated controversial topic but instead on the attempt to facilitate these three proposed goals within multiple problem spaces and venues. <br />
<br />
My work focused on these three goals through the following modes of inquiry: (1) situating research done in the lab within a larger cultural context and distinguishing the assumptions on which proposed research and research organization was founded (e.g.: how are standards made, who has the power to change them, and how are habits changed to herald them in?); (2) complicating the terms which give meaning to work in the lab and to other projects under the synthetic biology header in the United States (e.g.: what conditions are established to designate that a rhetorically separated “public” is benefiting from synthetic biology research?); and (3) aiding in the search for an appropriate and effective forum for collaboration between the many actors and stakeholders of synthetic biology (e.g.: seeking a space where discussion about synthetic biology is multi-facetted and unfettered by power structures). To achieve these goals, I became a participant observer of research done in the iGEM lab and maintained a blog; maintained an on-line lab notebook; conducted filmed interviews of many actors of the research and organization; and generated and edited content for, as well as helped conceptually design, the preliminary version of the website ''Ars Synthetica'' with the purpose of creating an engaging space of education, collaboration, and discussion between those who have an interest in synthetic biology. <br />
<br />
<br />
'''Narrative:'''<br />
<br />
'''''Context:'''''<br />
Human Practices and its connection to the International Genetically Engineered Machines competition, and to synthetic biology in general, are situated within the organization of SynBERC. In the early 2000s, UC Berkeley chemical engineer Jay Keasling began courting the National Science Foundation to get funding for work he was doing and planning engineering biological systems. In 2006, the NSF actually granted the $16 million, to be spent over the span of 5 years, to Keasling and a loosely associated pool of scientists at academic institutions across the United States through its Engineering Research Center program—the result of which was the creation of SynBERC. One of the conditions the NSF required from the newly organized ERC was that it must have an “ethical component" to its research. In 2004, in the initial stages of applying for the funding, the NSF mandated that the newly developing field of science address pressing problems of biosafety, biosecurity, and preparedness—problems of how to regulate, through policy, possibilities for catastrophe—and that it have the capacity to be reflexive on its own practices, regulation, organization, and products. These conditions for funding spurred the creation of a fourth branch, or “thrust,” of the organization (along with Thrusts 1-Parts, 2-Devices, and 3-Chassis), coined Human Practices, which in the first proposal composed of a research director who would investigate how "science," as it exists in the labs of those performing synthetic biology, would impact "society," as it exists separate from lab practice. <br />
<br />
This first model of human practices inquiry worked on the assumption that social, ethical, economic, and political questions are separate from the actual research being conducted, and Thrust 4 was placed downstream of scientific research—the "ethical component" of SynBERC became a bureaucratic rubber stamping of research being done after the fact. In Paul Rabinow and Gaymon Bennett's "Human Practices: Interfacing 3 Modes of Collaboration," the authors describe this sort of inquiry as Mode 2 inquiry: "facilitating relations between science and society." [2] This form of inquiry could not facilitate and perform the dynamic reflection on the actions of SynBERC for many reasons, all deriving from the problem that this was a proposal of a form of cooperation between social scientists, policy makers, activists, and natural scientists and not the collaboration between them. As such, when anthropologist Paul Rabinow became UC Berkeley's Human Practices Project Investigator in 2006, his condition for joining SynBERC was to have the power to collaborate: the inquiry being done by the social scientists and ethicists on his team should be held in equal status with the research of the other PIs and HP inquiry would be located upstream of scientific research. His view is that reflection on design, ethics, and production is ineffective downstream, and therefore it would require human practices inquiry present for all actors to reflect on these aspects of synthetic biology. <br />
<br />
The international Genetically Engineered Machines (iGEM) competition predates SynBERC. First started by Randy Rettberg in 2003 at the Massachusetts Institute of Technology, iGEM began as the meeting of a small group of scientists from the university presenting projects to each other, all of which required the manipulation of DNA to produce. In 2004, it became an actual competition, with five teams (from the academic institutions of Boston University, Caltech, MIT, Princeton, and UT Austin) presenting projects including the Texas’ infamous “bio-film” application. The next year was its first as an international competition, and the establishment of standards for judging has become more and more concrete since then—although the qualifications for winning the Golden Brick have always centered on the publishing of parts on MIT’s parts Registry and the importance of open source sharing of the new technologies and applications of synthetic biology. Synthetic biology is often referred to as the “application of engineering principles to biological systems,” and iGEM’s usage of robotics competitions in the past as a model establishes the prominent role of the search for innovation in the competition. <br />
<br />
iGEM and SynBERC are distinct entities, but overlap overwhelmingly in intellectual pursuit: many of SynBERC’s PIs (like Chris Anderson) get involved with iGEM, and SynBERC (and the developing field of synthetic biology itself) rely heavily on iGEM and the reaching scope of attempts at expanding tools and applications of the manipulation of DNA. As Anderson has said in an interview, there is a need for a revolutionary improvement of the tools available to manipulate DNA, something similar to the scale of effect of the development of the polymerase chain reaction (PCR) on biology and biotech 18 years ago, in order for the “industrial revolution” of synthetic biology to take hold. [3] <br />
<br />
'''''UC Berkeley Human Practices 2008:'''''<br />
What does it mean to be the human practices member of an iGEM team? It means walking the line between two distinct methods of thinking, perceiving, and problem solving—two paradigms of “approaching thought, action, and the world.” The human practices thrust has come to focus partly on the fact that doing synthetic biology (experimenting in it, designing projects related to it, situating findings within it, making decisions about what projects are important, etc.) is a ''human practice''. These scientists and their work do not exist in a world separate from humanity and the cultural, political, economic, and ethical structures that shape it, because there is no such separation. Assumptions and ideologies control lab practice, organization, and regulation just as they do political entities, religious groups, and intellectual schools of thought. With such clarity, it is the task of the human practice research of synthetic biology to analyze and bring to light the truth claims regarding synthetic biology research and the conditions under which such claims are imbued with meaning. Whereas the methodology of human practices is focused on the act of inquiry and contextualization itself as an act of education, the scientific and engineering methodology with which I interfaced as a participant observer sought a conclusive deliverable. Reflection, as I was trained, is the act of opening discussion not narrowing it.<br />
<br />
Expectations for the product of my inquiry were faintly defined at the beginning of my interim as the human practice researcher of the team. On my first day, the head scientific advisor for the team, Chris Anderson, asserted that my project not necessarily be cohesive with the iGEM project and that he sought merely for it to be “educational and useful.” By nature of being the product of the expectations of the members of Berkeley's iGEM team, those a part of the Berkeley human practices lab, and those of my own, my work became focused on the contextualization of the research happening in the iGEM lab: how does the research being done by these students relate to other projects being pursued under the banner of synthetic biology? In this way, my project and acts of inquiry could be labeled "successes," as my ultimate goal was a sort of similar building of foundational form and forum of reflection and discussion around synthetic biology. As stated in my lab notebook, my research had been focused on the discussion of rhetoric of ''eudaimonia'' (roughly translated from Aristotle as "happiness" or "flourishing"--what conditions qualify the "good life?") claimed by the different stakeholders involved with the biofuels research associated with the UC Berkeley campus. My experience and research with the iGEM team over the summer was, as predicted, quite a departure from my approach during the spring of 2008. First, and foremost, those with an invested interest in the product of my research increased manifold. Whereas my spring research had one methodology to use, that of human practices, being on the iGEM team influenced my goals toward being more "relevant" and "utilitarian." <br />
<br />
This liminality of methodology was mediated through providing the role of facilitator, which was tremendous. The students themselves had extreme interest in contextualizing and discussing their research, although discussion would sometimes be hard as they became more entrenched in their particular tasks associated with creating the self-lysis, part assembling biological device. The ambiguity of my research goals (as my research was defined almost purely by method) was somewhat off-putting, and I felt the need to concretize my role in the lab. I found myself drawn to justification of my mode of "inquiry" through producing an approachable and manageable interface between what is happening in the lab, scientists' perceptions of the importance of the research in the lab, and my reflection on both. Essentially, the role of "chronicler" and "multi-media contributor" defined my role in a non-intrusive, framable way. <br />
<br />
'''''Foundational Technologies:'''''<br />
Most interesting was being present to such a focus on foundational technologies in the lab. Synthetic biology is such a young field, and a field with such closely similar goals to other scientific and engineering disciplines. Although there are varying and inconclusive definitions of what defines synthetic biology, it is true that there are biology-manipulating methods that have a wide range of application and possibility for innovation within biology-associated fields. ''Clonebots'', indeed, seems to be able to reach farther than the audience of "synthetic biologists," the simplest example being to the world of microbiologists. Its goal in application is, however, the innovation for the manipulation of DNA within the field of synthetic biology. Thus, the question relating to standardization remains the same: how does one establish tools in an emerging environment? The creation of streamlined processes walks the line of tension between creating something cost effective and more manageable, and the enabling qualities of those streamlined processes. As previously stated in my on-line lab notebook, I do not mean to point out only the intricacies and implementation of oversight related to safety and security issues within synthetic biology, but more simply and generally to the intricacies and implementation of oversight of ''which'' problems and ''which'' solutions are given precedence over others. This is a contextual question: what politics are involved and which "societal sufferings" are chosen to be remedied? ''Here'' is why concurrent reflection on research by many actors is imperative to understanding and responsibly creating "novel organisms."<br />
<br />
<br />
'''Links:'''<br />
<br />
[http://blogs.coe.berkeley.edu/igem The UC Berkeley College of Engineering blog for iGEM] is the location for discussion and chronicling of controversial issues surrounding synthetic biology.<br />
<br />
[https://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_notes My on-line lab notebook] is the location for less restrictive discussion of problematization of research done in the lab and reflection on readings, experiences, and conversations relating to the lab.<br />
<br />
[http://www.ars-synthetica.net ''Ars Synthetica''] will be evolving over the next few months to include more content from other human practice members on the UC Berkeley campus, as well as building the necessary framework to implement design principles surrounding creating a space for discussion.<br />
<br />
[http://www.vuvox.com/collage/detail/0a23ffbf4 "How do you become a synthetic biologist?"] and [http://www.vuvox.com/collage/detail/08a9f807d "A day in the life of an igemmer"] are two interactive slideshows hoping to expand the limits of form of discussion.<br />
<br />
[http://www.youtube.com/user/arssynthetica This] is the link to videos of interviews conducted over the summer, some which are yet to be integrated into the ''Ars Synthetica'' website. <br />
<br />
<br />
----<br />
'''References:'''<br />
<br />
[1] Rabinow, Paul and Gaymon Bennett, “Conceptual Addition: From SynBERC through Weber to the Three Modes and Human Practices,” Powerpoint Given in UCB Anthropology 112 Lecture, Fall 2007.<br />
<br />
[2] Rabinow, Paul, and Gaymon Bennett, "Human Practices: Interfacing 3 Modes of Collaboration,” in T''he Prospect of Protocells: Social and Ethical Implications of Recreating Life'', Bedau and Parke, eds. Cambridge, MA: MIT Press, 2008. <br />
<br />
[3] Anderson, J. Chris, Personal Interview, 25 June 2008.<br />
<br><br />
<br><br />
<div style="text-align: left;"><font size="4">'''Thanks for visiting our wiki!<br />
<br />
The next link will take you to what is, at the publishing of this wiki, a preliminary version of the ''Ars Synthetica'' website.'''</font></div><br><br />
<br />
<html><br />
<a href="http://www.ars-synthetica.net/omeka/" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_anthropological_narrativeTemplate:Team:UC Berkeley/Notebook/MT anthropological narrative2008-10-30T06:41:48Z<p>Jinism83: </p>
<hr />
<div>{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Human Practices: Summary and Narrative'''</font></div><br><br />
<br />
'''Summary:'''<br />
<br />
This year’s UC Berkeley iGEM team project includes a human practices component. It is the second Berkeley team to include one, and the 2007 UC Berkeley iGEM team was the first of any team to address human practices issues (read Kristin Fuller’s notebook [http://parts.mit.edu/igem07/index.php/Kristin_Fuller_Notebook here]). In relation to research being conducted under the banner of synthetic biology, human practices, as defined by the Synthetic Biology Engineering Research Center (SynBERC), proposes to: <br />
<br />
-PROBLEMATIZE critical domains of human life, such as energy, health, security, and environment.<br />
<br />
-RAISE THE QUESTION of the good life (''eudaimonia'') in contemporary forms.<br />
<br />
-CALL FOR COLLABORATION in the recognition of shared problems, stakes, challenges, and evolving norms. [1]<br />
<br />
This year’s HP component differs from last year’s in its focus not on a delineated controversial topic but instead on the attempt to facilitate these three proposed goals within multiple problem spaces and venues. <br />
<br />
My work focused on these three goals through the following modes of inquiry: (1) situating research done in the lab within a larger cultural context and distinguishing the assumptions on which proposed research and research organization was founded (e.g.: how are standards made, who has the power to change them, and how are habits changed to herald them in?); (2) complicating the terms which give meaning to work in the lab and to other projects under the synthetic biology header in the United States (e.g.: what conditions are established to designate that a rhetorically separated “public” is benefiting from synthetic biology research?); and (3) aiding in the search for an appropriate and effective forum for collaboration between the many actors and stakeholders of synthetic biology (e.g.: seeking a space where discussion about synthetic biology is multi-facetted and unfettered by power structures). To achieve these goals, I became a participant observer of research done in the iGEM lab and maintained a blog; maintained an on-line lab notebook; conducted filmed interviews of many actors of the research and organization; and generated and edited content for, as well as helped conceptually design, the preliminary version of the website ''Ars Synthetica'' with the purpose of creating an engaging space of education, collaboration, and discussion between those who have an interest in synthetic biology. <br />
<br />
<br />
'''Narrative:'''<br />
<br />
'''''Context:'''''<br />
Human Practices and its connection to the International Genetically Engineered Machines competition, and to synthetic biology in general, are situated within the organization of SynBERC. In the early 2000s, UC Berkeley chemical engineer Jay Keasling began courting the National Science Foundation to get funding for work he was doing and planning engineering biological systems. In 2006, the NSF actually granted the $16 million, to be spent over the span of 5 years, to Keasling and a loosely associated pool of scientists at academic institutions across the United States through its Engineering Research Center program—the result of which was the creation of SynBERC. One of the conditions the NSF required from the newly organized ERC was that it must have an “ethical component" to its research. In 2004, in the initial stages of applying for the funding, the NSF mandated that the newly developing field of science address pressing problems of biosafety, biosecurity, and preparedness—problems of how to regulate, through policy, possibilities for catastrophe—and that it have the capacity to be reflexive on its own practices, regulation, organization, and products. These conditions for funding spurred the creation of a fourth branch, or “thrust,” of the organization (along with Thrusts 1-Parts, 2-Devices, and 3-Chassis), coined Human Practices, which in the first proposal composed of a research director who would investigate how "science," as it exists in the labs of those performing synthetic biology, would impact "society," as it exists separate from lab practice. <br />
<br />
This first model of human practices inquiry worked on the assumption that social, ethical, economic, and political questions are separate from the actual research being conducted, and Thrust 4 was placed downstream of scientific research—the "ethical component" of SynBERC became a bureaucratic rubber stamping of research being done after the fact. In Paul Rabinow and Gaymon Bennett's "Human Practices: Interfacing 3 Modes of Collaboration," the authors describe this sort of inquiry as Mode 2 inquiry: "facilitating relations between science and society." [2] This form of inquiry could not facilitate and perform the dynamic reflection on the actions of SynBERC for many reasons, all deriving from the problem that this was a proposal of a form of cooperation between social scientists, policy makers, activists, and natural scientists and not the collaboration between them. As such, when anthropologist Paul Rabinow became UC Berkeley's Human Practices Project Investigator in 2006, his condition for joining SynBERC was to have the power to collaborate: the inquiry being done by the social scientists and ethicists on his team should be held in equal status with the research of the other PIs and HP inquiry would be located upstream of scientific research. His view is that reflection on design, ethics, and production is ineffective downstream, and therefore it would require human practices inquiry present for all actors to reflect on these aspects of synthetic biology. <br />
<br />
The international Genetically Engineered Machines (iGEM) competition predates SynBERC. First started by Randy Rettberg in 2003 at the Massachusetts Institute of Technology, iGEM began as the meeting of a small group of scientists from the university presenting projects to each other, all of which required the manipulation of DNA to produce. In 2004, it became an actual competition, with five teams (from the academic institutions of Boston University, Caltech, MIT, Princeton, and UT Austin) presenting projects including the Texas’ infamous “bio-film” application. The next year was its first as an international competition, and the establishment of standards for judging has become more and more concrete since then—although the qualifications for winning the Golden Brick have always centered on the publishing of parts on MIT’s parts Registry and the importance of open source sharing of the new technologies and applications of synthetic biology. Synthetic biology is often referred to as the “application of engineering principles to biological systems,” and iGEM’s usage of robotics competitions in the past as a model establishes the prominent role of the search for innovation in the competition. <br />
<br />
iGEM and SynBERC are distinct entities, but overlap overwhelmingly in intellectual pursuit: many of SynBERC’s PIs (like Chris Anderson) get involved with iGEM, and SynBERC (and the developing field of synthetic biology itself) rely heavily on iGEM and the reaching scope of attempts at expanding tools and applications of the manipulation of DNA. As Anderson has said in an interview, there is a need for a revolutionary improvement of the tools available to manipulate DNA, something similar to the scale of effect of the development of the polymerase chain reaction (PCR) on biology and biotech 18 years ago, in order for the “industrial revolution” of synthetic biology to take hold. [3] <br />
<br />
'''''UC Berkeley Human Practices 2008:'''''<br />
What does it mean to be the human practices member of an iGEM team? It means walking the line between two distinct methods of thinking, perceiving, and problem solving—two paradigms of “approaching thought, action, and the world.” The human practices thrust has come to focus partly on the fact that doing synthetic biology (experimenting in it, designing projects related to it, situating findings within it, making decisions about what projects are important, etc.) is a ''human practice''. These scientists and their work do not exist in a world separate from humanity and the cultural, political, economic, and ethical structures that shape it, because there is no such separation. Assumptions and ideologies control lab practice, organization, and regulation just as they do political entities, religious groups, and intellectual schools of thought. With such clarity, it is the task of the human practice research of synthetic biology to analyze and bring to light the truth claims regarding synthetic biology research and the conditions under which such claims are imbued with meaning. Whereas the methodology of human practices is focused on the act of inquiry and contextualization itself as an act of education, the scientific and engineering methodology with which I interfaced as a participant observer sought a conclusive deliverable. Reflection, as I was trained, is the act of opening discussion not narrowing it.<br />
<br />
Expectations for the product of my inquiry were faintly defined at the beginning of my interim as the human practice researcher of the team. On my first day, the head scientific advisor for the team, Chris Anderson, asserted that my project not necessarily be cohesive with the iGEM project and that he sought merely for it to be “educational and useful.” By nature of being the product of the expectations of the members of Berkeley's iGEM team, those a part of the Berkeley human practices lab, and those of my own, my work became focused on the contextualization of the research happening in the iGEM lab: how does the research being done by these students relate to other projects being pursued under the banner of synthetic biology? In this way, my project and acts of inquiry could be labeled "successes," as my ultimate goal was a sort of similar building of foundational form and forum of reflection and discussion around synthetic biology. As stated in my lab notebook, my research had been focused on the discussion of rhetoric of ''eudaimonia'' (roughly translated from Aristotle as "happiness" or "flourishing"--what conditions qualify the "good life?") claimed by the different stakeholders involved with the biofuels research associated with the UC Berkeley campus. My experience and research with the iGEM team over the summer was, as predicted, quite a departure from my approach during the spring of 2008. First, and foremost, those with an invested interest in the product of my research increased manifold. Whereas my spring research had one methodology to use, that of human practices, being on the iGEM team influenced my goals toward being more "relevant" and "utilitarian." <br />
<br />
This liminality of methodology was mediated through providing the role of facilitator, which was tremendous. The students themselves had extreme interest in contextualizing and discussing their research, although discussion would sometimes be hard as they became more entrenched in their particular tasks associated with creating the self-lysis, part assembling biological device. The ambiguity of my research goals (as my research was defined almost purely by method) was somewhat off-putting, and I felt the need to concretize my role in the lab. I found myself drawn to justification of my mode of "inquiry" through producing an approachable and manageable interface between what is happening in the lab, scientists' perceptions of the importance of the research in the lab, and my reflection on both. Essentially, the role of "chronicler" and "multi-media contributor" defined my role in a non-intrusive, framable way. <br />
<br />
'''''Foundational Technologies:'''''<br />
Most interesting was being present to such a focus on foundational technologies in the lab. Synthetic biology is such a young field, and a field with such closely similar goals to other scientific and engineering disciplines. Although there are varying and inconclusive definitions of what defines synthetic biology, it is true that there are biology-manipulating methods that have a wide range of application and possibility for innovation within biology-associated fields. ''Clonebots'', indeed, seems to be able to reach farther than the audience of "synthetic biologists," the simplest example being to the world of microbiologists. Its goal in application is, however, the innovation for the manipulation of DNA within the field of synthetic biology. Thus, the question relating to standardization remains the same: how does one establish tools in an emerging environment? The creation of streamlined processes walks the line of tension between creating something cost effective and more manageable, and the enabling qualities of those streamlined processes. As previously stated in my on-line lab notebook, I do not mean to point out only the intricacies and implementation of oversight related to safety and security issues within synthetic biology, but more simply and generally to the intricacies and implementation of oversight of ''which'' problems and ''which'' solutions are given precedence over others. This is a contextual question: what politics are involved and which "societal sufferings" are chosen to be remedied? ''Here'' is why concurrent reflection on research by many actors is imperative to understanding and responsibly creating "novel organisms."<br />
<br />
<br />
'''Links:'''<br />
<br />
[http://blogs.coe.berkeley.edu/igem The UC Berkeley College of Engineering blog for iGEM] is the location for discussion and chronicling of controversial issues surrounding synthetic biology.<br />
<br />
[https://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_notes My on-line lab notebook] is the location for less restrictive discussion of problematization of research done in the lab and reflection on readings, experiences, and conversations relating to the lab.<br />
<br />
[http://www.ars-synthetica.net ''Ars Synthetica''] will be evolving over the next few months to include more content from other human practice members on the UC Berkeley campus, as well as building the necessary framework to implement design principles surrounding creating a space for discussion.<br />
<br />
[http://www.vuvox.com/collage/detail/0a23ffbf4 "How do you become a synthetic biologist?"] and [http://www.vuvox.com/collage/detail/08a9f807d "A day in the life of an igemmer"] are two interactive slideshows hoping to expand the limits of form of discussion.<br />
<br />
[http://www.youtube.com/user/arssynthetica This] is the link to videos of interviews conducted over the summer, some which are yet to be integrated into the ''Ars Synthetica'' website. <br />
<br />
<br />
----<br />
'''References:'''<br />
<br />
[1] Rabinow, Paul and Gaymon Bennett, “Conceptual Addition: From SynBERC through Weber to the Three Modes and Human Practices,” Powerpoint Given in UCB Anthropology 112 Lecture, Fall 2007.<br />
<br />
[2] Rabinow, Paul, and Gaymon Bennett, "Human Practices: Interfacing 3 Modes of Collaboration,” in T''he Prospect of Protocells: Social and Ethical Implications of Recreating Life'', Bedau and Parke, eds. Cambridge, MA: MIT Press, 2008. <br />
<br />
[3] Anderson, J. Chris, Personal Interview, 25 June 2008.<br />
<br><br />
<br><br />
<div style="text-align: left;"><font size="4">'''Thanks for visiting our wiki!<br />
<br />
The next link will take you to what is, at the publishing of this wiki, a preliminary version of the ''Ars Synthetica'' website.'''</font></div><br><br />
<br />
<html><br />
<a href="http://www.ars-synthetica.net/omeka/" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T06:40:53Z<p>Jinism83: /* D. Testing the viability of enzymes produced by the cells */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
<br />
1) Ligase strain – The gene for ligase has been cloned and integrated into the genome of lefty and righty cells, and they were named as Ligase Lefty (LL) and Ligase Righty (LR). These strains have successfully been used to simplify the cloning procedure. <br />
<br />
To test these strains, we put tet promoter in pBjh1601CA plasmid and methylated BglII restriction site by passaging it through Lefty cells by transformation and plasmid DNA purification. Similarly the GFP with RBS was put in pBjh1601AK plasmid and BamHI restriction site was methylated by Righty cell. In one microcentrifuge tube, 5.8uL of water, 1uL of 10X NEB2+10mM ATP, 0.3uL of each BamHI, BglII, XhoI, and T4 DNA ligase, and 1uL of each Lefty and Righty metyhlated plasmids were added. It was incubated at 37C for 1hr, and 30min at room temperature. It was then introduced into LL and LR by transformation, plated on LB agar plate with CmR and KanR, and grown overnight at 37C. As a control, we also introduced the same reaction cocktail into regular Lefty and Righty cells by transformation. A lot more colonies were growing when they were transformed into LL and LR. About 90% of the LL and LR were glowing green which meant the ligase strains are working well. Some of the colonies from the other 10% of the population that were not glowing green were sequenced, and deletion of DNA was observed which suggests that ligases are mutagenic and the expression of ligase must be regulated. <br />
<br />
[[Image:LLLR.jpg|800px|]]<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T06:40:39Z<p>Jinism83: /* D. Testing the viability of enzymes produced by the cells */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
<br />
1) Ligase strain – The gene for ligase has been cloned and integrated into the genome of lefty and righty cells, and they were named as Ligase Lefty (LL) and Ligase Righty (LR). These strains have successfully been used to simplify the cloning procedure. <br />
<br />
To test these strains, we put tet promoter in pBjh1601CA plasmid and methylated BglII restriction site by passaging it through Lefty cells by transformation and plasmid DNA purification. Similarly the GFP with RBS was put in pBjh1601AK plasmid and BamHI restriction site was methylated by Righty cell. In one microcentrifuge tube, 5.8uL of water, 1uL of 10X NEB2+10mM ATP, 0.3uL of each BamHI, BglII, XhoI, and T4 DNA ligase, and 1uL of each Lefty and Righty metyhlated plasmids were added. It was incubated at 37C for 1hr, and 30min at room temperature. It was then introduced into LL and LR by transformation, plated on LB agar plate with CmR and KanR, and grown overnight at 37C. As a control, we also introduced the same reaction cocktail into regular Lefty and Righty cells by transformation. A lot more colonies were growing when they were transformed into LL and LR. About 90% of the LL and LR were glowing green which meant the ligase strains are working well. Some of the colonies from the other 10% of the population that were not glowing green were sequenced, and deletion of DNA was observed which suggests that ligases are mutagenic and the expression of ligase must be regulated. <br />
<br />
[[Image:LLLR.jpg|600px|]]<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T06:40:25Z<p>Jinism83: /* D. Testing the viability of enzymes produced by the cells */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
<br />
1) Ligase strain – The gene for ligase has been cloned and integrated into the genome of lefty and righty cells, and they were named as Ligase Lefty (LL) and Ligase Righty (LR). These strains have successfully been used to simplify the cloning procedure. <br />
<br />
To test these strains, we put tet promoter in pBjh1601CA plasmid and methylated BglII restriction site by passaging it through Lefty cells by transformation and plasmid DNA purification. Similarly the GFP with RBS was put in pBjh1601AK plasmid and BamHI restriction site was methylated by Righty cell. In one microcentrifuge tube, 5.8uL of water, 1uL of 10X NEB2+10mM ATP, 0.3uL of each BamHI, BglII, XhoI, and T4 DNA ligase, and 1uL of each Lefty and Righty metyhlated plasmids were added. It was incubated at 37C for 1hr, and 30min at room temperature. It was then introduced into LL and LR by transformation, plated on LB agar plate with CmR and KanR, and grown overnight at 37C. As a control, we also introduced the same reaction cocktail into regular Lefty and Righty cells by transformation. A lot more colonies were growing when they were transformed into LL and LR. About 90% of the LL and LR were glowing green which meant the ligase strains are working well. Some of the colonies from the other 10% of the population that were not glowing green were sequenced, and deletion of DNA was observed which suggests that ligases are mutagenic and the expression of ligase must be regulated. <br />
<br />
[[Image:LLLR.jpg|300px|]]<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T06:39:13Z<p>Jinism83: /* D. Testing the viability of enzymes produced by the cells */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
<br />
1) Ligase strain – The gene for ligase has been cloned and integrated into the genome of lefty and righty cells, and they were named as Ligase Lefty (LL) and Ligase Righty (LR). These strains have successfully been used to simplify the cloning procedure. <br />
<br />
To test these strains, we put tet promoter in pBjh1601CA plasmid and methylated BglII restriction site by passaging it through Lefty cells by transformation and plasmid DNA purification. Similarly the GFP with RBS was put in pBjh1601AK plasmid and BamHI restriction site was methylated by Righty cell. In one microcentrifuge tube, 5.8uL of water, 1uL of 10X NEB2+10mM ATP, 0.3uL of each BamHI, BglII, XhoI, and T4 DNA ligase, and 1uL of each Lefty and Righty metyhlated plasmids were added. It was incubated at 37C for 1hr, and 30min at room temperature. It was then introduced into LL and LR by transformation, plated on LB agar plate with CmR and KanR, and grown overnight at 37C. As a control, we also introduced the same reaction cocktail into regular Lefty and Righty cells by transformation. A lot more colonies were growing when they were transformed into LL and LR. About 90% of the LL and LR were glowing green which meant the ligase strains are working well. Some of the colonies from the other 10% of the population that were not glowing green were sequenced, and deletion of DNA was observed which suggests that ligases are mutagenic and the expression of ligase must be regulated. <br />
<br />
[[Image:LLLR.jpg]]<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/File:LLLR.jpgFile:LLLR.jpg2008-10-30T06:35:40Z<p>Jinism83: </p>
<hr />
<div></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-30T06:35:15Z<p>Jinism83: </p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify 2ab assembly reactions by replacing the mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, [[Team:UC_Berkeley/LayeredAssembly#Assembly_Layer | click here]].<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII restriction enzyme genes into the ''E. coli'' genome. In this scheme, lefty cells methylate BglII recognition sites and will stably express T4 DNA ligase and BglII restriction enzyme. Righty cells methylate BamHI recognition sites and will be engineered to stably express Cre recombinase and BamHI restriction enzyme. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device and the BamHI/BglII/Cre/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform new cells and the transformed cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment produced many colonies when the cells were plated.<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competent cells. The transformed cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer and lysed using our lysis device. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated to allow time for assembly. The lysate was used then used to transform competent cells. <br />
<br />
The exact conditions required to make this experiment successful are difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, we have not found the correct conditions to make this scheme viable.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
<br />
1) Ligase strain – The gene for ligase has been cloned and integrated into the genome of lefty and righty cells and they were named as Ligase Lefty (LL) and Ligase Righty (LR). These strains have successfully been used to simplify the cloning procedure. <br />
<br />
To test efficiency of these strains, we put tet promoter in pBjh1601CA plasmid and methylated BglII restriction site by introducing it to Lefty cells by transformation. Similarly the GFP with RBS was put in pBjh1601AK plasmid and BamHI restriction site was methylated by Righty cell. In one microcentrifuge tube, 5.8uL of water, 1uL of 10X NEB2+10mM ATP, 0.3uL of each BamHI, BglII, XhoI, and T4 DNA ligase, and 1uL of each Lefty and Righty metyhlated plasmids were added. It was incubated at 37C for 1hr and 30min at room temperature. It was then introduced into Ligase Lefty (LL) and Ligase Righty (LR) by transformation, plated on LB agar plate with CmR and KanR, and grown overnight at 37C. As a control, we also introduced the same reaction cocktail into regular Lefty and Righty cells by transformation. When they were transformed into LL and LR, a lot more colonies were growing. About 90% of the LL and LR were glowing green which meant the ligase strains are working well. Some of the colonies from the other 10% that were not glowing green were sequenced, and deletion of DNA was observed which suggests that ligases are mutagenic and the expression of ligase must be regulated. <br />
<br />
[[Image:LLLR.jpg]]<br />
<br />
===='''E. Future Work'''====<br />
<br />
The genes for BglII, BamHI and Cre will be integrated into the ''E. coli'' genome and tested for viability.<br />
<br />
The conditions needed for successful assembly in lysate must be determined through experimentation. <br />
<br />
=='''Assembly ''in vivo'' using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that stably express BamHI methylase and BglII methylase, as well as BamHI, BglII, Cre and ligase. The assembler cell will also contain all of the genes needed for phage replication. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages to produce lefty and righty phagemids.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells will produce the restriction enzymes and ligase necessary to complete an in-vivo assembly with the basic parts contained within the phage. <br />
<br />
Once assembly is complete, the lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells. The cells can be screened for the correct product by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly.jpg]]<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/ProteinPurificationTeam:UC Berkeley/ProteinPurification2008-10-30T03:52:25Z<p>Jinism83: /* Proof of Concept Experiment */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Protein Purification'''</font></div><br><br />
<br />
=='''Introduction'''==<br />
Protein purification involves a series of step to isolate the protein of interest. Purifying a protein from E.coli first includes an extraction step, which brings the protein into solution. There are many physical or chemical methods from which to select for extraction. However, many times the protein of interest may be too fragile such that putting the protein through harsh extractions will permanently damage the protein, resulting in low yield. The proposed solution for this is to transform an inducible λ phage lysis device. This allows complete control over lysis rate. In addition, using a natural form of lysis is much gentler on the cells and proteins, which will lead to greater success of protein extraction and purifcation.<br />
<br />
Additional steps can be taken to lower the background that comes from genomic DNA and RNA that flow into solution from extraction. Engineering the ability to make the restriction enzymes BamHI and BgIII and ribonuclease barnase will greatly reduce background.<br />
<br />
To identify the protein in the large soup of protein, the four protein tags AP, HA, myc and flag were made. These tags can be attached at the terminus of the protein strands and their selective interactions between antibodies and themselves will make the tagged proteins easier to isolate.<br />
<br />
=='''Devices'''==<br />
'''Expression Cell'''<br />
<br />
The expression cell, containing the plasmid coding for the protein of interest, features BgIII restriction enzyme and BgIII methyltransferase parts engineered into the genome. BgIII, integrated at the HK022 site, is used to cut up the genome of the helper cell. BgIII methyltransferase, integrated at φ80 site, prevents BgIII from cutting up the cell's own genome. The expression cell also contains an inducible lysis device that lyses the cell upon induction.<br />
<br />
<br />
[[Image:ucbigemppexpression.png|300 px]]<br />
<br />
<br />
'''Helper Cell'''<br />
<br />
The helper cell contains parts the serve to reduce background during protein purification. The cell has BamHI methyltransferse engineered into its genome at the φ80 site. The plasmid in this cell contains BamHI, barnase and barstar. BamHI is used to degrade the genomic DNA from the expression cell. Barnase is used to degrade RNA of the expression cell and other helper cells when lysed. Barstar prevents barnase from destroying the cell's RNA. Like the expression cell, the helper cells contains the same inducible lysis device.<br />
<br />
<br />
[[Image:ucbigempphelper.png|300 px]]<br />
<br />
<br />
'''Protein of Interest'''<br />
<br />
The protein of interest is on a plasmid that is transformed into the expression cell. The protein will have a protein tag.<br />
<br />
<br />
[[Image:ucbproteinofinterestplasmid.png]]<br />
<br />
<br />
'''Tags'''<br />
<br />
Four tags were made: AP, HA, myc and FLAG. AP binds to streptavidin, Ha binds to hemagglutinin, myc binds to c-myc and FLAG binds to anti-DDK antibodies. To test the tags, composite parts of the following construction Pbad.rbs_pelB.phoA.tag.b1006 were made. rbs_pelB is one of the four [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/prepro prepro sequences] that sends a protein to the periplasm. Additional information on how the the tags is in the [https://2008.igem.org/Team:UC_Berkeley/ProteinPurification#Tags_and_Testing experimental section].<br />
<br />
<br />
[[Image:ucbigemtag.png]]<br />
<br />
=='''Strategy'''==<br />
<br />
The protein purification strategy involves growing up cultures of expression cells and helper cells. Combining the two cultures and lysing them will result in a solution of proteins, among which contains the protein of interest and cellular junk minus the RNA (degraded by barnase) and DNA (degraded by one of the two restriction enzymes). At this point, using the tag on the protein, the protein will be taken out of solution by taking advantage of the selective interaction between the tag and the antibody that binds to it.<br />
<br />
<br />
<br />
<br />
=='''Tags and Testing'''==<br />
To test the tags, an ELISA was performed. First, the antibodies were diluted to a final concentration of 20 μg/ml in PBS. 50 ul of this antibody solution is added to a NUNC maxisorp plate and incubated for an hour at 37 degree C. After an hour, the plate was washed with [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Wash_Solution.281L.29 wash solution] using a plate washer. 200ul of [https://2008.igem.org/Team:UC_Berkeley/Notebook/Aron_Lau/material#Blocking_Solution.28500_mL.29 blocking solution] was added to the plate and incubated for an hour at 37 degree C. Meanwhile, because the phoA.tag complex is sent to the periplasm with the pelB sequence, a [https://2008.igem.org/Team:UC_Berkeley/Protocols#Periplasmic_Prep periplasmic prep] was performed to get a solution of the phoA.tag complex and was subsequently diluted down to the working concentration with PBS. After an hour of blocking, the plate was again washed with wash buffer using the plate washer. The 200ul of phoA.tag dilution was added to the plate and was incubated at 37 degree C for an hour. The plate was washed afterward and 100ul of PNP was then added to the wells, observing for a yellow color.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Template:Team:UC_Berkeley/Notebook/MT_anthropological_narrative" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayPlasmidTeam:UC Berkeley/GatewayPlasmid2008-10-30T03:33:10Z<p>Jinism83: /* Gateway Device in Assembly Vector: Plasmid Details */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Plasmid Based Gateway'''</font></div><br><br />
<br />
== '''Introduction''' ==<br />
<br />
The current ''in vitro'' LR Gateway procedure for transferring one piece of DNA into another vector without restriction enzymes involves an expensive cocktail of purified plasmids, excisionase, integrase, ihfα and ihfβ. Both an assembly vector (containing the ccdB gene flanked by attR1 and attR2 sites for negative selection) and an entry vector (containing the part(s) desired to be transferred, flanked by attL1 and attL2 sites) are used as the substrates to which the reactants are added. <br><br />
<br />
Inspired by such innovation, we seek to perform this task ''in vivo'' using E. coli to express the reactants necessary. Since E. coli naturally express ihfα/β in their genome, we first tried to integrate excisionase and integrase genes into the genomic DNA as well. However, this proved to be toxic to the cells, making them relatively unstable. Therefore, our next approach was to introduce the reagents into the substrate plasmids. In one case, the the assembly vectors received the Gateway device of the enzymes excisionase and integrase preceded by a temperature sensitive promoter, while in the other case it was introduced into the entry vectors. In both cases, we also explored the effects of additionally introducing the ihfα and ihfβ genes behind the Gateway device. <br><br />
<br />
After careful analysis of our data, we introduced our Lysis device in order to eliminate the mini-prepping procedures and to thus make the entire process cheaper and more efficient.<br><br />
<br />
== '''Gateway Device in Assembly Vector: Plasmid Details '''==<br />
<br />
'''Assembly Vectors:'''Two different variations of the pK112128 assembly vector were created: one with {promoter.xis.int!} and one with {promoter.xis.int!}{rbs.ihfα!}{rbs.ihfβ!} between the ccdB site and the attR2 site. These plasmids are named [https://static.igem.org/mediawiki/2008/b/b3/PK112245.png pK112245] and [https://static.igem.org/mediawiki/2008/f/f3/PK112246.png pK112246] respectively. A simplified version of the two variants along with the Lysis Device is shown below. <br><br><br />
[[Image:simpof245or246.png]] <br><br />
<br><br />
<br />
'''Entry Vector:'''The entry vector used in both cases was [https://static.igem.org/mediawiki/2008/8/85/PBca_1256.png pBca1256].<br><br />
<br><br />
[[Image:simpof1256.png]] <br><br />
<br><br />
<br />
== '''Gateway Device in Entry Vector: Plasmid Details'''==<br />
<br />
'''Assembly Vector:'''The assembly vector used for each of the following entry vector variations is [https://static.igem.org/mediawiki/2008/7/76/PK112128.png pK112128]. <br> <br />
<br />
[[Image:simpof128.png]] <br><br />
<br><br />
<br />
'''Entry Vectors:''' Two different variations of the pBca1256 entry vector were created: one with {promoter.xis.int!} and one with {promoter.xis.int!}{rbs.ihfα!}{rbs.ihfβ!} just before the attL1 site. These plasmids are named [https://static.igem.org/mediawiki/2008/2/2d/PK112247.png pK112247] and [https://static.igem.org/mediawiki/2008/a/ae/PK112248.png pK112248] respectively.<br><br />
[[Image:simpof247or248.png]] <br><br />
<br><br />
<br><br />
<br />
== '''General Procedure''' ==<br />
<br />
Below is a flowchart of the general plasmid based Gateway procedure. Due to various combinations of assembly and entry vectors explored, the "Gateway Device" was created to represent the {promoter.xis.int!} sequence with or without the adjoining {rbs.ihfα!}{rbs.ihfβ!} sequence. The "Lysis Device" sequence (which was only tested in the pK112245 assembly vector) was similarly simplified. <br><br />
<br />
The major combinations of assembly + entry vectors are: pK112245 + pBca1256, pK112246 + pBca1256, pK112128 + pK112247, and pK112128 + pK112248. Additionally, pBca1256 with five different sized parts replacing the original mRFP part was also tested with each assembly vector to show the Gateway reaction can be done with parts of all sizes, although this is not shown in the diagram below. <br><br />
<br />
[[Image:generalprocedureGDinAssemblyVector.png|center|650 px]]<br><br />
<br><br />
[[Image:generalprocedureGDinEntryVector.png|center|650 px]] <br><br />
<br><br />
<br><br />
<br />
== '''Results''' ==<br />
<br />
=== '''Gateway Device in Assembly Vector''' ===<br />
[[Image:plate3.png]] <br><br />
<br><br />
* Control done at 30°C.<br />
[[Image:plate4.png]] <br><br />
<br><br />
* As can be seen above, there is a relatively high rate of cotransformation as seen by the growth of colonies on the Spec plates. The trials done at 30°C had a higher rate of cotransformation likely because there were fewer plasmids resulting from the Gateway reaction.<br />
* In an attempt to reduce cotransformation rates in those grown normally at 37°C, we repeated these experiments, picking more colonies and diluting the purified protein mixture 20x before transformation into MG1061 cells. The results are shown below.<br />
[[Image:plate11d-f.png]] <br><br />
<br><br />
[[Image:plate19d-f.png]] <br><br />
<br><br />
* Although these plates have not been allowed to grow as long and thus are not as bright in color, it can clearly be seen that cotransformation has been successfully eliminated.<br />
<br><br />
'''The Lysis Device'''<br><br />
* The lysis device was inserted into the pK112245, and the experiment repeated. However, only 2 colonies grew, although both were free of cotransformation. <br />
[[Image:plate245lysis.png]] <br><br />
<br><br />
<br><br />
=== '''Gateway Device in Entry Vector''' ===<br />
[[Image:plate1.png]] <br><br />
<br><br />
[[Image:plate02.png]] <br><br />
* As can been seen above, the Gateway reaction worked with much more efficiency as evidenced by the low rates of cotransformation.<br />
<br><br />
<br />
== '''Materials & Methods''' ==<br />
<br />
We first prepared competent TG1 cells (resistant to ccdB) with the given assembly vector. The assembly vector was transformed into competent TG1 cells and were grown in liquid LB media with Cam/Amp antibiotics (and 50mM Mg<sup>+2</sup> if the lysis device is included) at 30°C overnight. The following day, 20 ul of the saturated culture was taken out, and was grown under the same conditions to mid-log. About 1 ml of culture was pelleted, the supernatant was discarded and the cells were resuspended in 10 ul KCM plus 90 ul TSS on ice. <br><br />
<br />
<br />
Using these new competent cells, the given entry vector was tranformed into them. They were grown in liquid LB media with Cam/Amp/Spec antibiotics (and 50mM Mg<sup>+2</sup> if the lysis device is included) at 37°C overnight to ensure the cells contain both plasmids and that the temperature sensitive promoter of the gateway device would turn on. A control in which the cells were instead kept at 30°C was conducted to compare our results with those in which the gateway device was theoretically off. <br><br />
<br />
<br />
The following day, the plasmid from about 2 ml of saturated culture was purified. When there was no lysis device in the assembly vector, plasmid purification was achieved with the QIAprep Spin Miniprep Kit. In the case where the lysis device is integrated into the assembly plasmid, the culture was pelleted, the supernatant removed, resuspended in 1 ml PBS, pelleted, the supernatant removed, and finally resuspended again in 100 ul PBS. <br><br />
<br />
<br />
The purified plasmids were next transformed into MG1061 cells (sensitive to ccdB). These were plated on LB agar plates with Cam/Amp antibiotics and grown overnight at 37°C. The next day, 16 colonies were picked from each plate, spotted on a Cam/Amp antibiotic plate, as well as Spec antibiotic plate to test for cotransformance of the entry vector with the desired product. <br><br />
<br />
<br />
The above procedure were conducted in parallel with different combinations of assembly and entry vectors. The following combinations of assembly and entry vectors were done: pK112245 + pBca1256, pK112246 + pBca1256, pK112128 + pK112247, and pK112128 + pK112248. Each combination included a control in which the Gateway device was not turned on during the allotted time for the reaction to occur (i.e. they were grown at 30°C, when the temperature sensitive promoter is off). In addition to this, three trials of each were conducted. Finally, in order to see if gateway could be performed on parts of different sizes, five different parts in pBca1256 were chosen (Bca1117, Bca1133, Bca1270, Bca1252, and Bca1168) and tested with the assembly vector pK112245, as well as with pK112245. One colony from each was sequenced to ensure gateway had occurred by identification of attB1 and attB2 sites as well as the parts in the assembly vectors. <br><br />
<br />
<br />
After data analysis, we suspected that higher efficiency could be achieved for the schemes in which the Gateway Device was in the assembly vector if less plasmid was used to transform into MG1061 cells. Therefore, we took the post-reaction purified plasmid mixtures from the trials involving pK112245 + pBca1256 and pK112246 + pBca1256 and diluted each 20 times. Three trials for each in which the 20x dilution of the purified plasmid was transformed into MG1061 cells was performed under the same conditions, and 32 colonies from each plate were picked the following day. <br><br />
<br />
<br />
Other controls were also performed. Each assembly vector used was also transformed into into MG1061 cells which were put on Cam/Amp antibiotic LB agar plates to make sure ccdB was sufficient for negative selection. Only a very few number of white colonies grew for each, which was expected since it is known that ccdB is prone to mutation and weakening. The entry vectors were also each individually transformed into MC1061 cells and plated on Cam/Amp antibiotic plates. No colonies appeared, proving that the entry vector did not contain Cam/Amp resistance. <br><br />
<br />
== '''Discussion''' ==<br />
<br />
* Our desired product is a reacted assembly vector with the entry vector mRFP (or part) between attB1 and attB2 sites. Since the origin of replication in the assembly vectors is low-copy, the cells should appear light pink in color.<br />
<br />
* Colonies that are bright pink, which grow on both Cam/Amp and Spec antibiotic plates, are cotransformed. This means that in addition to our desired assembly vector-with-part plasmid, one of the original, unreacted entry vectors has entered into the cell. These appear as bright pink because the origin of replication in the entry vector is high-copy.<br />
<br />
* White colonies first appeared to be evidence of a mutation in the ccdB gene such that it inhibits its toxicity. Since ccdB is used to negatively select against the original, unreacted assembly vector containing ccdB flanked by attR1 and attR2, a mutation which weakens ccdB such that a strain sensitive to normal ccdB can grow in spite of the gene's presence and gives undesirable background products. However, after sequencing 4 different white colonies, we discovered that in each case the mRFP gene was indeed inserted into the assembly vector and was flanked by attB1 and attB2 sites (our desired product); the only problem was that there were deletions (24 or 25 bp in length) in the promoter of the part which was driving the expression of mRFP! Thus, the few white colonies seen are likely due to mutations in the original part rather than a mutation in ccdB.<br />
<br />
* There are also some colonies that are very slightly pink. We predict that these are cells which contain the desired assembly vector-with-part plasmid, but that the part itself has sustained some sort of mutation (perhaps again in the promoter) that slightly weakens the expression of mRFP.<br />
<br />
* Proportionally, the less background we receive at the end of the experiment, the more efficient the plasmid based Gateway reaction is.<br />
<br />
* From our experimental results comparing the "Gateway Device" with and without ihfα/β, we conclude that the additional expression of ihfα/β is unnecessary and makes no difference in the plasmid based gateway reactions. However, based on the difficulty of previous attempts to join and clone ihfα and ihfβ, it has been concluded that these parts are unnecessary or even hazardous to cells, and thus will not be explored further in other Gateway schemes.<br />
<br />
* Our data suggests that our procedure was most efficient when the Gateway Device was located in the entry vectors as opposed to the assembly vectors. This makes sense since the entry vector origin of replication is high copy, meaning the reagents necessary for the reaction to occur (excisionase, integrase, ihfα and ihfβ) will be expressed at much higher levels when the temperature sensitive promoter is turned on. More reagents produced increases the probability that the Gateway reaction will occur within a given cell, and that we will get our desired product with the greatest efficiency. However, from experience in creating and cloning the Gateway Device, we know that this composite part is somewhat toxic to the cell since there are att sites in the genomic DNA of E. coli. Thus, it is necessary to carefully control this device with, in this case, a temperature sensitive promoter. This also means that if the "part" in your entry vector is also somewhat toxic, the additional toxicity of the Gateway Device may make the entry vector difficult or even impossible to make in the first place.<br />
<br />
* Therefore, it is most beneficial to put the Gateway Device into the assembly vector. In order to improve the efficiency and reduce the background in these cases, we diluted the post-reaction purified plasmid mixtures from the trials involving pK112245 + pBca1256 and pK112246 + pBca1256. Our results show a significant reduction in cotransformation and thus a higher rate of efficiency.<br />
<br />
* The entry vectors with the various part lengths replacing mRFP in pBca1256 all sequenced correctly; the attB1 and attB2 sites were confirmed for all experiments. This suggests that the plasmid based gateway reaction with pK112245 and pK112246 assembly vectors works for parts as short as 250bp and as long as 3078bp.<br />
<br />
* All in all, we were able to successfully conduct the Gateway reaction ''in vivo'' using assembly and entry plasmids with relatively high efficiency. Our problems with cotransformation seem to largely reduced upon diluting the purified plasmid before transformation. The white colony background due to mutated, weakened ccdB may be solved by replacing it with or adding on another more robust toxic protein, such as barnase, to aid in negative selection. Another possibility would be to use positive selection, for example by using conditional replication of an origin.<br />
<br />
* Although the plasmid based Gateway scheme has proven to be successful, we have also tried other methods to achieve the Gateway reaction: see Phagemid Based Gateway and Genomic Based Gateway.<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayGenomic" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayGenomicTeam:UC Berkeley/GatewayGenomic2008-10-30T03:28:17Z<p>Jinism83: </p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Genomic Based Gateway'''</font></div><br><br />
<br />
==Introduction==<br />
The ''in vivo'' plasmid based gateway scheme was successful and produced the desired product, but it also yielded a considerable amount of background. Closer analysis of the side products revealed that the background resulted from ''ccdB'' mutations that arose when the gene replicated and recombined ''in vivo''. In an effort to circumvent background resulting from mutations in a negative selection gene, we decided to use positive selection. This way, we would be able to select for the desired products rather than selecting against unwanted side products and unreacted starting materials.<br />
<br />
In order to implement positive selection, we used conditional origins of replication on our plasmids. These origins of replication will only be functional and allow plasmid replication if a specific protein is expressed in the cell. In our design, the assembly vector with an ''oriR6K'' origin (requires the protein Pi) is integrated into the genome. The gene of interest alongside an ''oriV'' origin (requires the protein TrfA) can then recombine with the genome. In this manner, the gene of interest can be moved to an assembly vector by inserting the entry vector into the genome. We could allow selective replication of the plasmids in our scheme by performing the reaction in a cell expressing TrfA and then transforming the resulting mixture of plasmids into a cell expressing ‘’pir’’.<br />
<br />
We also incorporated our lysis device into our new entry vector in order to simplify the experimental protocol for this scheme by eliminating mini-preps.<br />
<br />
==Details about Plasmids and Strains==<br />
<br />
===Plasmids===<br />
The entry plasmid in this scheme contains both the part of interest and an ''oriV'' origin of replication within the attL recombination sites, thereby allowing this origin to be transferred to the desired product. Since the entry plasmid has no constitutive origin of replication, it can only replicate in the presence of the protein TrfA. With the exception of the change in type and placement of the origin of replication, the entry plasmid maintains the same features as the traditional entry plasmid, pBca1256.<br />
<br />
[[Image:OriV entry vector.jpg]]<br />
<br />
In variations on this scheme where Xis and Int are not integrated into the genome, they are placed prior to the'' attL1'' site under the control of a temperature sensitive promoter. In an effort to streamline this method, we also considered a variation where the lysis device was placed before Xis and Int in the entry plasmid.<br />
<br />
===Strains===<br />
This scheme utilizes strains that include the assembly vector in the genome. The traditional double-antibiotic assembly vector has been modified to include an ''oriR6K'' origin of replication (which can be induced by the Pi protein) in place of a constitutively active replication origin. Since the integrated vector includes the ''attR2'' sites that usually flank the vector region of the assembly plasmid, the ''attL1'' sites in the entry plasmid can recombine with the genome to produce the desired product. <br />
<br />
In addition to the integrated assembly vector, the strains also include TrfA in the genome to allow the replication of the entry vector containing an ''oriV'' origin. Additionally, one variation on this scheme has ''xis'' and ''int'' placed in the the genome to catalyze the recombination reaction.<br />
<br />
[[Image:Genomic Gateway Overview.jpg]]<br />
<br />
==General Procedure==<br />
In this scheme, the ''oriV'' version of the entry plasmid can simply be transformed into the integrated strain containing the desired assembly vector and TrfA. In order to catalyze the reaction, Xis and Int must be present either on the plasmid or in the genome. <br />
<br />
Once the entry plasmid has been transformed and the reaction has been catalyzed, the desired product will be able to replicate in the cytoplasm of the cell using the ''oriV'' origin that was transferred with the part from the entry vector to the assembly vector. The product can be released from the cell by inducing our self-lysis device (which can be installed in the entry vector) or by doing a mini-prep.<br />
<br />
Once the plasmids in the cell's cytoplasm have been obtained, they need to be transformed into cells that express the Pi protein. This will allow for the selective replication of the desired product, which contains an ''oriR6K'' origin obtained from the assembly vector that was originally in the genome. <br />
<br />
The potential source of background in this scheme is the unreacted entry plasmid. However, this plasmid does not have an ''oriR6K'' origin (it only contains an ''oriV'' origin), so it is unable to replicate in cells that express Pi instead of TrfA. Differential antibiotic markers would assist in screening against the bleed-through of the starting plasmid, but only positive selection can eliminate the need to screen for contransformants (which contain both the starting plasmid in addition to the desired product).<br />
<br />
==Conclusion==<br />
With the incorporation of the lysis device, the genomic Gateway scheme promises to be an improvement to the plasmid based Gateway scheme because it eliminates unwanted background by using positive selection. However, the protocol for this scheme still requires that the plasmid mixture is transformed into another cell strain to select for the desired product. We sought to further streamline this scheme by utilizing phagemids, which can lyse the cell and infect other cells without the need for either mini-preps or transformation.<br />
<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPhagemid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayGenomicTeam:UC Berkeley/GatewayGenomic2008-10-30T03:27:22Z<p>Jinism83: /* General Procedure */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Genomic Based Gateway'''</font></div><br><br />
<br />
==Introduction==<br />
The ''in vivo'' plasmid based gateway scheme was successful and produced the desired product, but it also yielded a considerable amount of background. Closer analysis of the side products revealed that the background resulted from ''ccdB'' mutations that arose when the gene replicated and recombined ''in vivo''. In an effort to circumvent background resulting from mutations in a negative selection gene, we decided to use positive selection. This way, we would be able to select for the desired products rather than selecting against unwanted side products and unreacted starting materials.<br />
<br />
In order to implement positive selection, we used conditional origins of replication on our plasmids. These origins of replication will only be functional and allow plasmid replication if a specific protein is expressed in the cell. In our design, the assembly vector with an ''oriR6K'' origin (requires the protein Pi) is integrated into the genome. The gene of interest alongside an ''oriV'' origin (requires the protein TrfA) can then recombine with the genome. In this manner, the gene of interest can be moved to an assembly vector by inserting the entry vector into the genome. We could allow selective replication of the plasmids in our scheme by performing the reaction in a cell expressing TrfA and then transforming the resulting mixture of plasmids into a cell expressing Pir.<br />
<br />
We also incorporated our lysis device into our new entry vector in order to simplify the experimental protocol for this scheme by eliminating mini-preps.<br />
<br />
==Details about Plasmids and Strains==<br />
<br />
===Plasmids===<br />
The entry plasmid in this scheme contains both the part of interest and an ''oriV'' origin of replication within the attL recombination sites, thereby allowing this origin to be transferred to the desired product. Since the entry plasmid has no constitutive origin of replication, it can only replicate in the presence of the protein TrfA. With the exception of the change in type and placement of the origin of replication, the entry plasmid maintains the same features as the traditional entry plasmid, pBca1256.<br />
<br />
[[Image:OriV entry vector.jpg]]<br />
<br />
In variations on this scheme where Xis and Int are not integrated into the genome, they are placed prior to the'' attL1'' site under the control of a temperature sensitive promoter. In an effort to streamline this method, we also considered a variation where the lysis device was placed before Xis and Int in the entry plasmid.<br />
<br />
===Strains===<br />
This scheme utilizes strains that include the assembly vector in the genome. The traditional double-antibiotic assembly vector has been modified to include an ''oriR6K'' origin of replication (which can be induced by the Pir protein) in place of a constitutively active replication origin. Since the integrated vector includes the ''attR2'' sites that usually flank the vector region of the assembly plasmid, the ''attL1'' sites in the entry plasmid can recombine with the genome to produce the desired product.<br />
<br />
In addition to the integrated assembly vector, the strains also include TrfA in the genome to allow the replication of the entry vector containing an ''oriV'' origin. Additionally, one variation on this scheme has ''xis'' and ''int'' placed in the the genome to catalyze the recombination reaction.<br />
<br />
[[Image:Genomic Gateway Overview.jpg]]<br />
<br />
==General Procedure==<br />
In this scheme, the ''oriV'' version of the entry plasmid can simply be transformed into the integrated strain containing the desired assembly vector and TrfA. In order to catalyze the reaction, Xis and Int must be present either on the plasmid or in the genome. <br />
<br />
Once the entry plasmid has been transformed and the reaction has been catalyzed, the desired product will be able to replicate in the cytoplasm of the cell using the ''oriV'' origin that was transferred with the part from the entry vector to the assembly vector. The product can be released from the cell by inducing our self-lysis device (which can be installed in the entry vector) or by doing a mini-prep.<br />
<br />
Once the plasmids in the cell's cytoplasm have been obtained, they need to be transformed into cells that express the Pi protein. This will allow for the selective replication of the desired product, which contains an ''oriR6K'' origin obtained from the assembly vector that was originally in the genome. <br />
<br />
The potential source of background in this scheme is the unreacted entry plasmid. However, this plasmid does not have an ''oriR6K'' origin (it only contains an ''oriV'' origin), so it is unable to replicate in cells that express Pi instead of TrfA. Differential antibiotic markers would assist in screening against the bleed-through of the starting plasmid, but only positive selection can eliminate the need to screen for contransformants (which contain both the starting plasmid in addition to the desired product).<br />
<br />
==Conclusion==<br />
With the incorporation of the lysis device, the genomic Gateway scheme promises to be an improvement to the plasmid based Gateway scheme because it eliminates unwanted background by using positive selection. However, the protocol for this scheme still requires that the plasmid mixture is transformed into another cell strain to select for the desired product. We sought to further streamline this scheme by utilizing phagemids, which can lyse the cell and infect other cells without the need for either mini-preps or transformation.<br />
<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPhagemid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayGenomicTeam:UC Berkeley/GatewayGenomic2008-10-30T03:21:44Z<p>Jinism83: /* Introduction */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Genomic Based Gateway'''</font></div><br><br />
<br />
==Introduction==<br />
The ''in vivo'' plasmid based gateway scheme was successful and produced the desired product, but it also yielded a considerable amount of background. Closer analysis of the side products revealed that the background resulted from ''ccdB'' mutations that arose when the gene replicated and recombined ''in vivo''. In an effort to circumvent background resulting from mutations in a negative selection gene, we decided to use positive selection. This way, we would be able to select for the desired products rather than selecting against unwanted side products and unreacted starting materials.<br />
<br />
In order to implement positive selection, we used conditional origins of replication on our plasmids. These origins of replication will only be functional and allow plasmid replication if a specific protein is expressed in the cell. In our design, the assembly vector with an ''oriR6K'' origin (requires the protein Pi) is integrated into the genome. The gene of interest alongside an ''oriV'' origin (requires the protein TrfA) can then recombine with the genome. In this manner, the gene of interest can be moved to an assembly vector by inserting the entry vector into the genome. We could allow selective replication of the plasmids in our scheme by performing the reaction in a cell expressing TrfA and then transforming the resulting mixture of plasmids into a cell expressing Pir.<br />
<br />
We also incorporated our lysis device into our new entry vector in order to simplify the experimental protocol for this scheme by eliminating mini-preps.<br />
<br />
==Details about Plasmids and Strains==<br />
<br />
===Plasmids===<br />
The entry plasmid in this scheme contains both the part of interest and an ''oriV'' origin of replication within the attL recombination sites, thereby allowing this origin to be transferred to the desired product. Since the entry plasmid has no constitutive origin of replication, it can only replicate in the presence of the protein TrfA. With the exception of the change in type and placement of the origin of replication, the entry plasmid maintains the same features as the traditional entry plasmid, pBca1256.<br />
<br />
[[Image:OriV entry vector.jpg]]<br />
<br />
In variations on this scheme where Xis and Int are not integrated into the genome, they are placed prior to the'' attL1'' site under the control of a temperature sensitive promoter. In an effort to streamline this method, we also considered a variation where the lysis device was placed before Xis and Int in the entry plasmid.<br />
<br />
===Strains===<br />
This scheme utilizes strains that include the assembly vector in the genome. The traditional double-antibiotic assembly vector has been modified to include an ''oriR6K'' origin of replication (which can be induced by the Pir protein) in place of a constitutively active replication origin. Since the integrated vector includes the ''attR2'' sites that usually flank the vector region of the assembly plasmid, the ''attL1'' sites in the entry plasmid can recombine with the genome to produce the desired product.<br />
<br />
In addition to the integrated assembly vector, the strains also include TrfA in the genome to allow the replication of the entry vector containing an ''oriV'' origin. Additionally, one variation on this scheme has ''xis'' and ''int'' placed in the the genome to catalyze the recombination reaction.<br />
<br />
[[Image:Genomic Gateway Overview.jpg]]<br />
<br />
==General Procedure==<br />
In this scheme, the ''oriV'' version of the entry plasmid can simply be transformed into the integrated strain containing the desired assembly vector and TrfA. In order to catalyze the reaction, Xis and Int must be present either on the plasmid or in the genome. <br />
<br />
Once the entry plasmid has been transformed and the reaction has been catalyzed, the desired product will be able to replicate in the cytoplasm of the cell using the ''oriV'' origin that was transferred with the part from the entry vector to the assembly vector. The product can be released from the cell by inducing our self-lysis device (which can be installed in the entry vector) or by doing a mini-prep.<br />
<br />
Once the plasmids in the cell's cytoplasm have been obtained, they need to be transformed into cells that express the Pir protein. This will allow for the selective replication of the desired product, which contains an ''oriR6K'' origin obtained from the assembly vector that was originally in the genome. <br />
<br />
The potential source of background in this scheme is the unreacted entry plasmid. However, this plasmid does not have an ''oriR6K'' origin (it only contains an ''oriV'' origin), so it is unable to replicate in cells that express Pir instead of TrfA. Differential antibiotic markers would assist in screening against the bleed-through of the starting plasmid, but only positive selection can eliminate the need to screen for contransformants (which contain both the starting plasmid in addition to the desired product).<br />
<br />
==Conclusion==<br />
With the incorporation of the lysis device, the genomic Gateway scheme promises to be an improvement to the plasmid based Gateway scheme because it eliminates unwanted background by using positive selection. However, the protocol for this scheme still requires that the plasmid mixture is transformed into another cell strain to select for the desired product. We sought to further streamline this scheme by utilizing phagemids, which can lyse the cell and infect other cells without the need for either mini-preps or transformation.<br />
<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPhagemid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:30:42Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|frame|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:28:59Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|frame|center|300px|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:28:36Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|frame|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>|300px|]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:28:09Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|300px|frame|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:27:51Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|300px||frame|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:27:35Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|500px||frame|center|A entry vector generated from any of the methods can be transferred to various different vectors using the Gateway method. <br>]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/File:Gatewayoverview.jpgFile:Gatewayoverview.jpg2008-10-30T00:26:13Z<p>Jinism83: </p>
<hr />
<div></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/GatewayOverviewTeam:UC Berkeley/GatewayOverview2008-10-30T00:25:58Z<p>Jinism83: /* Why Use Gateway? */</p>
<hr />
<div>__NOTOC__<br />
{{UCBmain|cssLink=}}<br />
<div style="text-align: center;"><font size="6">'''Gateway Overview'''</font></div><br><br />
==Why Use Gateway?==<br />
<br />
The first step of the layered assembly scheme involves the transfer of biobrick parts from an entry vector to a double antibiotic assembly vector. Traditionally, this would require a fairly work-intensive protocol requiring digestion, gel purification, ligation, transformation, and plasmid isolation. In addition to being more time-consuming, the aforementioned procedure is also suboptimal because it is difficult to scale-up.<br />
<br />
The Gateway Cloning approach developed by [http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html Invitrogen] offers a more efficient and convenient alternative for parts transfer. Their procedure involves the enzyme-catalyzed exchange of parts flanked by specific recombination sites. Experimentally, it is a one-pot, room-temperature reaction where the plasmids, buffer, water and enzymes are added together. After the addition of another enzyme and a short incubation period to terminate the reaction, the entire mixture can be transformed directly. This one-pot approach with a fewer steps is much more suitable for large-scale experimentation.<br />
<br />
Gateway is commonly used to facilitate the transfer of a single gene of interest from an entry clone to multiple destination vectors, as shown below. The efficiency and robustness of the Gateway mechanism are ideal for this application because once the gene of interest is cloned and confirmed in the entry vector, subsequent transfers using Gateway need not be confirmed again. Thus, it is ideal for use in the first step of layered assembly where a part may be transferred to one or more of the double antibiotic vectors required for the subsequent assembly steps assembly.<br />
<br />
[[Image:gatewayoverview.jpg|frame|center|A entry clone generated from any of the methods in the yellow boxes can be transferred to various different vectors using the Gateway method. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
==Gateway Chemistry==<br />
<br />
===The Natural Lambda Phage Recombination system===<br />
<br />
In general, Gateway reactions in the lab involve the attB, attP, attL, and attR recombination sites and the integrase (Int), excisionase (Xis), and integration host factor (IHF) enzymes. These enzymes were found in nature in the temperate bacteriophage lambda. Like all temperate bacteriophages, lambda utilizes a lysogenic infection life cycle, wherein its genome is incorporated into the genome of the ''E. coli'' host genome, to excise itself at a later time. Integrase (Int), excisionase (Xis), and integration host factor (IHF) are the enzymes that catalyze the integration and excision of the viral genome, at the previously mentioned ''att'' sites of the viral and host genomes. <br />
<br />
Int cooperatively binds with IHF (which is composed of A and B subunits) in order to catalyze both the integration and excision reactions in the natural lambda phage system shown below. Although int can independently catalyze both reactions, IHF greatly improves int's binding affinity for the att recombination sites by bending the DNA [6]. Although int performs both the forward and reverse reactions, the equilibrium heavily favors the reaction of attB and attP to produce attL and attR sites. Xis binds to the attR sire and serves to shift the equilibrium so that it favors the reverse reaction [5].<br />
<br />
<br />
[[Image:LambdaRecombination.jpg|frame|center|Lambda phage recombination in ''E. coli''. Invitrogen adapted these components from this natural system to produce their Gateway cloning scheme. <br> Image source: http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html]]<br />
<br />
===Invitrogen's adaptation===<br />
<br />
In the Invitrogen scheme, the recombination sites are found in pairs flanking sequences that are intended for transfer. The recombination pairs are directional and specificity is given by ten nucleotides in the core region of each site, as shown below. In addition, the lethal gene ''ccdB'' is incorporated in between the recombination sites in the destination vector to ensure that only the desired recombined product can be cloned.<br />
<br />
[[Image:LR recombination.jpg|frame|center|Directional, site-specific recombination between attL and attR sites. <br> Image source:https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC]]<br />
<br />
The schematic below depicts the LR reaction, during which the attL sites recombine with attR to yield attB and attP sites. The BP reaction proceeds in the opposite direction yielding attL and attR sites.<br />
<br />
[[Image:LR reaction.jpg|frame|center|Gateway LR reaction where gene of interest (flanked by attL sites) is transferred to destination vector containing attR sites. <br> Image source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm]]<br />
<br />
====Selection for Correct Clones====<br />
<br />
The above scheme employs both ccdB negative selection and antibiotic selection in order to yield >90% of colonies containing the desired expression clone. The entry and destination vectors contain different antibiotic resistances, so plating on the desired antibiotic (Ampicillin in case shown above) eliminates clones containing the entry vector or the by-product of the reaction. In addition, ''ccdB'' is a lethal gene, thereby eliminating colonies containing the destination vector, which would otherwise survive on the antibiotic plate.<br />
<br />
<html><br />
<p align="center"><!-- URL's used in the movie--> <!-- text used in the movie--> <br />
<object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://active.macromedia.com/flash2/cabs/swflash.cab#version=4,0,0,0" ID="cloning" WIDTH="550" HEIGHT="400"><br />
<param name="movie" value="cloning.swf"><br />
<param name="quality" value="high"><br />
<param name="bgcolor" value="#FFFFFF"><br />
<embed src="http://bxia.awardspace.com/gatewaycloning.swf" quality="high" bgcolor="#FFFFFF" WIDTH="550" HEIGHT="400" TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"><br />
</object><br />
</p><br />
</html><br />
Animation source: http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
<br />
==Gateway ''in vivo''==<br />
<br />
<br />
===Plasmid Based Gateway===<br />
We applied our ideas for facilitating the automation of synthetic biology to the first step of layered assembly--the LR gateway reaction used to move the gene of interest into one or more of the double-antibiotic assembly vectors. We began by attempting to reproduce a plasmid based Gateway reaction, which was similar to that of Invitrogen's Gateway scheme. Although we were successful in having a completely ''in vivo'' version of the Gateway reaction, there were two major drawbacks: we had not eliminated the need for laborious and expensive mini-preps and we had relatively high background from ccdB mutations (the ccdB gene is relatively unstable because of its toxicity).<br />
<br />
We addressed the first drawback by creating a self-lysis device which allows the cell's contents, including the desired product, to be released when arabinose is added. This device was inserted into either the entry or assembly plasmid to facilitate the isolation of the reaction products.<br />
<br />
The second issue was more complex and was resolved by using positive selection methods rather than ccdB negative selection. Efforts to incorporate positive selection for Gateway led to the development of the Genomic Based Gateway scheme.<br />
<br />
===Genomic Based Gateway===<br />
The Genomic Based Gateway scheme involves placement of the assembly vector in the genome. The gene of interest from the entry vector can recombine with the genome to yield the desired product. Both the entry vector and assembly vector have conditional origins of replication which serve as mechanisms for positive selection. Although this is a viable scheme for Gateway and can readily incorporate the lysis device in place of mini-preps, it still requires transformation of the lysate in order to select for the desired product. In an effort to further optimize our Gateway scheme by eliminating the need for transformation, we developed a Phagemid Based Gateway scheme.<br />
<br />
===Phagemid Based Gateway===<br />
The Phagemid Based Gateway utilizes a plasmid that can be packaged in a phage when a lysogenic cell is induced with arabinose. The assembly vector in this scheme contains a phagemid device, which allows the product to be packaged and transferred to another cell without mini-preps or transformation. In addition to simplifying the transfer of the product, the phagemid device serves as a positive selection mechanism and can isolate the desired product when paired with another positive selector, such as an inducible origin of replication.<br />
<br />
==References==<br />
# http://www.bio.davidson.edu/courses/Molbio/MolStudents/spring2000/patton/gateway.htm<br />
# http://tools.invitrogen.com/downloads/gateway-the-basics-seminar.html<br />
# http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html|Gateway<br />
# https://commerce.invitrogen.com/index.cfm?fuseaction=iProtocol.unitSectionTree&treeNodeId=290D0521B5FFA1B782C62C0AB62FD7BC<br />
# Cho, E et al. Interactions between Integrase and Excisionase in the Phage Lambda Excisive Nucleoprotein Complex. ''Journal of Bacteriology''. September 2002; 184(18): 5200–5203. Available Online: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=135313 (Accessed: 28 October 2008).<br />
# Frumerie, C et al. Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. ''Virology''. 5 February 2005; 232(1):284-294. Available Online: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4F29SN2-1&_user=4420&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_version=1&_urlVersion=0&_userid=4420&md5=0f9e41ba422140f157a2b1f1fb60b140 (Accessed: 28 October 2008).<br />
<br />
<html><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid" class="titleIcon"><br />
<img align=right src="https://static.igem.org/mediawiki/2008/9/9a/GreyNext.png"><br />
</a><br />
</html></div>Jinism83http://2008.igem.org/File:Ligasestrain.pngFile:Ligasestrain.png2008-10-29T21:27:20Z<p>Jinism83: </p>
<hr />
<div></div>Jinism83http://2008.igem.org/Team:UC_Berkeley/AssemblyTeam:UC Berkeley/Assembly2008-10-29T21:27:03Z<p>Jinism83: </p>
<hr />
<div>{{UCBmain}}<br />
<div style="text-align: center;"><font size="6">'''Assembly'''</font></div><br><br />
<br />
Our goal is to simplify two antibiotic assembly eliminating the replace mini-prep steps and making the protocol reagent-free. This will be accomplished by using our lysis device to lyse cells and extract DNA and engineering cells to produce their own restriction enzymes and ligase.<br />
<br />
For a general overview of two antibiotic assembly, click here [[https://2008.igem.org/Team:UC_Berkeley/LayeredAssembly#Assembly_Layer]]<br />
<br />
=='''Assembly in Cell Lysate'''==<br />
<br />
Our lab currently uses cells that are engineered to methylate either BamHI or BglII restriction sites. Part A is transformed into a "lefty" cell that is methylated on BglII restriction sites while Part B is transformed into a "righty" cell that is methylated on BamHI restriction sites. <br />
<br />
We propose to integrate the BamHI and BglII genes into the ''E. coli'' genome. In this scheme, lefty cells that are methylated on BglII cut sites, will stably express ligase and BglII. Righty cells that are methylated on BamHI cut sites, will be engineered to stably express XhoI and BamHI. Since restriction enzymes will not cut methylated DNA, the BglII restriction site in the lefty cell and the BamHI restriction site in the righty cell are blocked from digestion. The methylation also protects the cellular DNA from being cut when these genes are expressed.<br />
<br />
We propose to eliminate the need for mini-prep by using our lysis device [[https://2008.igem.org/Team:UC_Berkeley/LysisDevice]] and the BamHI/BglII/XhoI/ligase cells to lyse the cells and release the restriction enzymes and ligase into the lysate. The lysate mixture is incubated to allow time for assembly (digestion and ligation). The lysate is then used to transform cells and cells are plated on the appropriate antibiotic. <br />
<br />
[[Image:cdb6.jpg]]<br />
<br />
==='''Testing and Experimentation'''===<br />
<br />
===='''A. To test the viablity of the plasmid released by the lysis device'''====<br />
<br />
Cells containing basic part plasmid DNA were lysed with the lysis device. The lysate was used to transform another batch of cells. This experiment was produced many colonies.<br />
<br />
[[Image:lysed_cells.jpg]]<br />
<br />
===='''B. To test the viability of enzymes in the lysate'''====<br />
<br />
Lefty and righty cells were combined in a single eppendorf tube and lysed with our lysis device. Commercial restriction enzymes and ligase were added to the lysate along with plasmid DNA. The mixture was incubated. The lysate was used to transform competant cells. The comp cells were plated on the appropriate antibiotic, but failed to produce colonies.<br />
<br />
The experiment was repeated with lysed cells that were centrifuged and re-suspended in Buffer NEB2. This experiment produced the colonies with the correct composite part when plated on the appropriate antibiotic.<br />
<br />
===='''C. Testing digestion in lysate'''====<br />
<br />
Lefty and righty cells containing plasmid DNA were lysed with our lysis device. Lysed cells were centrifuged and the supernatant was discarded. Cells were re-suspended in NEB2 Buffer. Commercial restriction enzymes and ligase were added to the lysate and the lysate was incubated. The lysate was used then used to transform competant cells. <br />
<br />
The exact conditions required to make this experiment successful is difficult to determine. Since the lysis device results in successful release of plasmid DNA and assembly works in NEB2 buffered lysate, digestion of plasmid DNA in the lysate should work under the appropriate conditions. However, at the present, this experiment does not produce the correct colonies.<br />
<br />
===='''D. Testing the viability of enzymes produced by the cells'''====<br />
<br />
1) Ligase strain – The gene for ligase has been cloned into the genome of lefty and righty cells. These strains have successfully been used to optimize the effectiveness of the ligation reaction.<br />
<br />
2) Bam strain - The gene for the BamHI restriction enzyme has been cloned into cells [[insert data here]]<br />
<br />
[[Image:ligasestrain.png]]<br />
<br />
=='''Assembly in-Vivo using Phagemid'''==<br />
<br />
We propose to engineer assembler cells that are express BamHI methylase and BglII methylase and stably express BamHI, BglII, Cre and ligase. The assembler cell contains all of the genes needed for the lytic cycle of the phage. The three genes necessary to induce the lytic cycle of the phage are initially repressed.<br />
<br />
Bacteriophages with phagemids containing a basic part flanked by BglII and BamHI restriction sites and two antibiotic resistance genes separated by a XhoI restriction site are created. To methylate phagemid DNA, lefty and righty cells will be infected with these phages.<br />
<br />
Assembler cells will be infected with both lefty and righty phagemids. The cells produce the restriction enzymes and ligase necessary to complete an in-vivo assembly. The lytic cycle of the phage is induced by removing the repressor on the lytic genes. The cells are lysed and phagemids are released into solution. The lysate is used to infect new cells and screened by plating on the appropriate antibiotic. <br />
<br />
[[Image:Phagemid_assembly]]</div>Jinism83http://2008.igem.org/Team:UC_BerkeleyTeam:UC Berkeley2008-10-17T06:27:47Z<p>Jinism83: </p>
<hr />
<div><html><br />
<link rel="stylesheet" href="http://andersonlab.qb3.berkeley.edu/home.css" type="text/css"><br />
<div class="menu"><br />
<ul><br />
<li><br />
<a title="Home" href="https://2008.igem.org/Team:UC_Berkeley" class="menu">Home</a><br />
</li><br />
</ul><br />
<br />
<ul><br />
<li><br />
<a class="menu">Project Overview</a><br />
<ul class="skinny"><br />
<li><br />
<a href="."><br />
<span class="drop"><br />
<span>Gateway</span><br />
>><br />
</span><br />
</a><br />
<ul><br />
<li><br />
<a title="Gateway Overview" href="https://2008.igem.org/Team:UC_Berkeley/GatewayOverview">Gateway Overview</a><br />
</li><br />
<li><br />
<a title="Plasmid Gateway" href="https://2008.igem.org/Team:UC_Berkeley/GatewayPlasmid">Plasmid Based Gateway</a><br />
</li><br />
<li><br />
<a title="Phagemid Gateway" href="https://2008.igem.org/Team:UC_Berkeley/GatewayPhagemid">Phagemid Based Gateway</a><br />
</li><br />
<li><br />
<a title="Genomic Gateway" href="https://2008.igem.org/Team:UC_Berkeley/GatewayGenomic">Genomic Based Gateway</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<li><br />
<a title="Protein Purification" href="https://2008.igem.org/Team:UC_Berkeley/ProteinPurification">Protein Purification</a><br />
</li><br />
<br />
<li><br />
<a title="Assembly" href="https://2008.igem.org/Team:UC_Berkeley/Assembly">Assembly</a><br />
</li><br />
<br />
<li><br />
<a title="Self Lysis Device" href="https://2008.igem.org/Team:UC_Berkeley/LysisDevice">Lysis Device</a><br />
</li><br />
<br />
<li><br />
<a href="https://2008.igem.org/Team:UC_Berkeley/Modeling" title="Modeling of the lysis device">Modeling</a><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<ul><br />
<li><br />
<a class="menu">Resources</a><br />
<ul><br />
<li><br />
<a title="Our Team" href="https://2008.igem.org/Team:UC_Berkeley/Team">Our Team</a><br />
</li><br />
<li><br />
<a title="Notebook" href="https://2008.igem.org/Team:UC_Berkeley/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9Tu4QZmdP-lKw&hl=en" title="Our Parts">Parts</a><br />
</li><br />
<li><br />
<a href="http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9S0htjL2N6qGA&hl=en" title="Our Oligos">Oligos</a><br />
</li><br />
<li><br />
<a href="http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9RBprtVgCq7Lg&hl=en" title="Our Stocks">Stocks</a><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<ul><br />
<li><br />
<a class="menu">External Links</a><br />
<ul><br />
<li><br />
<a title="UCB Computational team" href="https://2008.igem.org/Team:UC_Berkeley_Tools">UCB Computational Team</a><br />
</li><br />
<li><br />
<a title="Picture Slideshow" href="http://www.vuvox.com/collage/detail/08a9f807d">Picture Slideshow</a><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
</div><br />
</html><br />
<br />
[[Image:UCB_title3.jpg|400 px|center]]<br />
<br />
{|<br />
|-<br />
|valign="top"| '''In an effort to optimize the manufacture of parts, we have designed Clonebots - a collection of devices and strains that aid in the synthesis and analysis of new parts. Our team has programmed Clonebots to perform processes critical for efficient manufacture of biological products. We created systems capable of in vivo genetic manipulations and constructed an inducible self-lysis device designed to reclaim a variety of products without the need for conventional methods of lysis. By replacing traditional mechanical operations with biologically encoded alternatives, Clonebots are capable of accomplishing many operations with a single automated liquid handling unit - a cost-effective, BioCAD-friendly approach to large-scale projects.'''<br />
|}<br />
<br><br />
{|<br />
|-<br />
|valign="top"| '''The promise of synthetic biology is that we can convert genetic engineering from a technically-intensive artform into an information-based technology. In essence, the biochemical behavior of a cell can be reduced to codes of A, T, C, and G. Nevertheless, the construction and analysis of engineered biological systems requires cumbersome laboratory protocols that provide a significant impediment to the advancement of our field. However, there are some unit operations that can be cost effectively automated at scale in the laboratory such as small volume liquid transfers, fluorescence measurements, and heating/cooling steps. If we can reduce all synthesis and analysis methodology to these simple operations, it will be readily possible to automate all aspects of synthetic biology research. The Clonebots project is an effort to solve these basic technical problems of synthetic biology with the substrate of our own medium—a live cell. We have attempted to construct genetic devices that perform common operations used in the manufacture of synthetic organisms. We initiated a variety of projects including BioBrick standard assembly, Gateway recombination, self-lysis for protein and plasmid purification, and the analysis of protein expression levels. Some of these devices were completed, and others are under continued development. We have described the full scope of our efforts here on the wiki. We will focus on 2 of the devices that we successfully constructed on our poster and presentation: a genetic self-lysis device and a Gateway cloning device.'''<br />
|}<br />
<br><br />
----<br />
We would like to thank our generous sponsors.<br />
<br />
[[Image:ucb_genentech.jpeg|Genentech|200 px]]<br />
[[Image:ucb_nsfe.jpeg|The National Science Foundation|100px]]</div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/CC_constructionTemplate:Team:UC Berkeley/Notebook/CC construction2008-07-02T23:17:16Z<p>Jinism83: /* K112504 */</p>
<hr />
<div>__TOC__<br />
<br />
==K112500==<br />
<pre><br />
Construction of {<HA>} basic part K112501<br />
<br />
Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112500<br />
--------------------------------------------<br />
cc001 Forward Biobricking of {<HA>} <br />
CgATAgaattcATGagatcttacccatacgacgtcccagac<br />
<br />
cc002 Reverse biobricking of {<HA>} <br />
ccagtggatccccagcgtagtctgggacgtcgtatggg<br />
</pre><br />
<br />
==K112501==<br />
<pre><br />
Construction of {<HA!} basic part K112502<br />
<br />
Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112501<br />
--------------------------------------------<br />
cc001 Forward Biobricking of {<HA>} <br />
CgATAgaattcATGagatcttacccatacgacgtcccagac<br />
<br />
cc003 Reverse biobricking of {<HA!}<br />
ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag<br />
</pre><br />
<br />
==K112502==<br />
<pre><br />
Construction of {<myc>} basic part K112503<br />
<br />
Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112502<br />
--------------------------------------------<br />
cc004 Forward Biobricking of {<myc>}<br />
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG<br />
cc005 Reverse Biobricking of {<myc>}<br />
ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG <br />
</pre><br />
<br />
==K112503==<br />
<pre><br />
Construction of {<myc!} basic part K112503<br />
<br />
Wobble PCR of cc004/cc006 ( 54 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI,2227+ 910,L)<br />
Product is pBca1256-K112503<br />
--------------------------------------------<br />
cc004 Forward Biobricking of {<myc>}<br />
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG<br />
cc006 Reverse Biobricking of {<myc!}<br />
ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC <br />
</pre><br />
<br />
==K112504==<br />
<pre><br />
Construction of {<barnase>} basic part K112504<br />
<br />
PCR CC007/CC008 on barnase gene ( 361 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112504<br />
--------------------------------------------<br />
cc007 Forward Biobricking of {<barnase>}<br />
CGATAgaattcATGaGATCTGCACAGG<br />
CC008 Reverse Biobricking of {<barnase>}<br />
CCAGTggatccTCTGATTTTTGTAAAGGTCTG<br />
<br />
==K112505==<br />
<pre><br />
Construction of {<barnase!} basic part K112505<br />
<br />
PCR CC007/CC009 on barnase gene ( 364 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112505<br />
--------------------------------------------<br />
cc007 Forward Biobricking of {<barnase!} <br />
CGATAgaattcATGaGATCTGCACAGG<br />
CC009 Reverse Biobricking of {<barnase!} <br />
CCAGTggatcCTTATCTGATTTTTG<br />
</pre><br />
<br />
==K112232 (Molly's)==<br />
<pre><br />
Construction of {rbs.barstar!} Biobrick Part K112232<br />
PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112232<br />
----------------------------------------<br />
mea035 Forward Biobricking of {rbs.barstar!} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg<br />
mea034 Reverse Biobricking of {rbs.barstar!} <br />
cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc<br />
</pre></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/CC_constructionTemplate:Team:UC Berkeley/Notebook/CC construction2008-07-02T23:13:31Z<p>Jinism83: /* K112232 (Molly's) */</p>
<hr />
<div>__TOC__<br />
<br />
==K112500==<br />
<pre><br />
Construction of {<HA>} basic part K112501<br />
<br />
Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112500<br />
--------------------------------------------<br />
cc001 Forward Biobricking of {<HA>} <br />
CgATAgaattcATGagatcttacccatacgacgtcccagac<br />
<br />
cc002 Reverse biobricking of {<HA>} <br />
ccagtggatccccagcgtagtctgggacgtcgtatggg<br />
</pre><br />
<br />
==K112501==<br />
<pre><br />
Construction of {<HA!} basic part K112502<br />
<br />
Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112501<br />
--------------------------------------------<br />
cc001 Forward Biobricking of {<HA>} <br />
CgATAgaattcATGagatcttacccatacgacgtcccagac<br />
<br />
cc003 Reverse biobricking of {<HA!}<br />
ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag<br />
</pre><br />
<br />
==K112502==<br />
<pre><br />
Construction of {<myc>} basic part K112503<br />
<br />
Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112502<br />
--------------------------------------------<br />
cc004 Forward Biobricking of {<myc>}<br />
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG<br />
cc005 Reverse Biobricking of {<myc>}<br />
ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG <br />
</pre><br />
<br />
==K112503==<br />
<pre><br />
Construction of {<myc!} basic part K112503<br />
<br />
Wobble PCR of cc004/cc006 ( 54 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI,2227+ 910,L)<br />
Product is pBca1256-K112503<br />
--------------------------------------------<br />
cc004 Forward Biobricking of {<myc>}<br />
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG<br />
cc006 Reverse Biobricking of {<myc!}<br />
ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC <br />
</pre><br />
<br />
==K112504==<br />
<pre><br />
Construction of {<barnase>} basic part K112504<br />
<br />
PCR CC007/CC008 on barnase gene ( 361 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112504<br />
--------------------------------------------<br />
cc007 Forward Biobricking of {<barnase>}<br />
CGATAgaattcATGaGATCTGCACAGG<br />
CC008 Reverse Biobricking of {<barnase>}<br />
CCAGTggatcCTCTGATTTTTGTAAAGGTC<br />
</pre><br />
<br />
==K112505==<br />
<pre><br />
Construction of {<barnase!} basic part K112505<br />
<br />
PCR CC007/CC009 on barnase gene ( 364 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)<br />
Product is pBca1256-K112505<br />
--------------------------------------------<br />
cc007 Forward Biobricking of {<barnase!} <br />
CGATAgaattcATGaGATCTGCACAGG<br />
CC009 Reverse Biobricking of {<barnase!} <br />
CCAGTggatcCTTATCTGATTTTTG<br />
</pre><br />
<br />
==K112232 (Molly's)==<br />
<pre><br />
Construction of {rbs.barstar!} Biobrick Part K112232<br />
PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112232<br />
----------------------------------------<br />
mea035 Forward Biobricking of {rbs.barstar!} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg<br />
mea034 Reverse Biobricking of {rbs.barstar!} <br />
cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc<br />
</pre></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_constructionTemplate:Team:UC Berkeley/Notebook/SC construction2008-07-02T22:57:58Z<p>Jinism83: /* pBca1256-K112403 */</p>
<hr />
<div>__TOC__<br />
<br />
<br />
== pBca1256-K112600 ==<br />
<pre><br />
Construction of <AP-tag> basic part K112600<br />
<br />
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112600<br />
----------------------------------------------------<br />
SC001F Forward Biobricking of <AP-tag><br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC002R Reverse Biobricking of <AP-tag><br />
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112601 ==<br />
<pre><br />
Construction of <AP-tag! basic part K112601<br />
<br />
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112601<br />
--------------------------------------------------<br />
SC001 Forward Biobricking of <AP-tag!<br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC003 Reverse Biobricking of <AP-tag!<br />
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112602 ==<br />
<pre><br />
Construction of <FLAG-tag> basic part K112602<br />
<br />
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112602<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag><br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC005 Reverse Biobricking of <FLAG-tag><br />
ccagtGGATCCcttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112603 ==<br />
<pre><br />
Construction of <FLAG-tag! basic part K112603<br />
<br />
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112603<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag!<br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC006 Reverse Biobricking of <FLAG-tag!<br />
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112604 ==<br />
<pre><br />
Construction of {rbs_barstar>} basic part K112604<br />
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112604<br />
-------------------------------<br />
mea035 Fwd biobricking of {rbs_barstar>} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg <br />
sc007 Reverse biobricking of {rbs_barstar>}<br />
cgttaGGATCCagaaagtatgatggtgatgtcgc <br />
</pre><br />
<br />
== pBca1256-K112403 ==<br />
<pre><br />
Construction of {prepro>} of PhoA basic part K112403 (114 bp, EcoRI/BamHI)<br />
CR cb10007/cb10008 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112403 <br />
-------------------------------------------------------------<br />
cb10007-phoA-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc<br />
cb10008-phoA-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112404 ==<br />
<pre><br />
Construction of {prepro>} of LamB basic part K112404 (132 bp, EcoRI/BamHI)<br />
PCR cb10009/cb10010 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256 <br />
Product is pBca1256-K112404 <br />
-------------------------------------------------------------<br />
cb10009-lamB-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTatgatgattactctgcgcaaac<br />
cb10010-lamB-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112605 ==<br />
<pre><br />
Construction of {a~prepro>} of PhoA basic part K112605 (100 bp, EcoRI/BamHI)<br />
PCR sc008/cb10008-phoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112605<br />
------------------------------------------------------<br />
sc008 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtaaagtgaaacaaagcactattgcactggc<br />
cb10008-phoA-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112606 ==<br />
<pre><br />
Construction of {a~prepro>} of LamB basic part K112606 (111 bp, EcoRI/BamHI)<br />
PCR 009/cb10010-lamB-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256- K112606<br />
--------------------------------------------------<br />
sc009 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc<br />
cb10010-lamB-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112607 ==<br />
<pre><br />
Construction of {rbs_prepro>} of PhoA basic part K112607 (113 bp, EcoRI/BamHI)<br />
PCR sc010/cb10008-PhoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112607<br />
------------------------------------------------------<br />
sc010 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac<br />
cb10008-phoA-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112608 ==<br />
<pre><br />
Construction of {rbs_prepro>} of LamB basic part K112608 (126 bp, EcoRI/BamHI)<br />
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBjh1601AK<br />
Product is pBca1256-K112608<br />
------------------------------------------------------<br />
sc011 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatgatgattac has little longer annealing region. If you use shorter, GC content goes up little. I would use this:<br />
<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg<br />
<br />
cb10010-lamB-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_constructionTemplate:Team:UC Berkeley/Notebook/SC construction2008-07-02T22:55:38Z<p>Jinism83: /* pBca1256-K112404 */</p>
<hr />
<div>__TOC__<br />
<br />
<br />
== pBca1256-K112600 ==<br />
<pre><br />
Construction of <AP-tag> basic part K112600<br />
<br />
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112600<br />
----------------------------------------------------<br />
SC001F Forward Biobricking of <AP-tag><br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC002R Reverse Biobricking of <AP-tag><br />
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112601 ==<br />
<pre><br />
Construction of <AP-tag! basic part K112601<br />
<br />
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112601<br />
--------------------------------------------------<br />
SC001 Forward Biobricking of <AP-tag!<br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC003 Reverse Biobricking of <AP-tag!<br />
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112602 ==<br />
<pre><br />
Construction of <FLAG-tag> basic part K112602<br />
<br />
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112602<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag><br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC005 Reverse Biobricking of <FLAG-tag><br />
ccagtGGATCCcttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112603 ==<br />
<pre><br />
Construction of <FLAG-tag! basic part K112603<br />
<br />
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112603<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag!<br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC006 Reverse Biobricking of <FLAG-tag!<br />
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112604 ==<br />
<pre><br />
Construction of {rbs_barstar>} basic part K112604<br />
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112604<br />
-------------------------------<br />
mea035 Fwd biobricking of {rbs_barstar>} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg <br />
sc007 Reverse biobricking of {rbs_barstar>}<br />
cgttaGGATCCagaaagtatgatggtgatgtcgc <br />
</pre><br />
<br />
== pBca1256-K112403 ==<br />
<pre><br />
Construction of {prepro>} of PhoA basic part K112403 (114 bp, EcoRI/BamHI)<br />
CR cb10007/cb10008 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112403 <br />
-------------------------------------------------------------<br />
cb10007-phoA-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaatgaaacaaagc<br />
cb10008-phoA-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
<br />
== pBca1256-K112404 ==<br />
<pre><br />
Construction of {prepro>} of LamB basic part K112404 (132 bp, EcoRI/BamHI)<br />
PCR cb10009/cb10010 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256 <br />
Product is pBca1256-K112404 <br />
-------------------------------------------------------------<br />
cb10009-lamB-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTatgatgattactctgcgcaaac<br />
cb10010-lamB-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112605 ==<br />
<pre><br />
Construction of {a~prepro>} of PhoA basic part K112605 (100 bp, EcoRI/BamHI)<br />
PCR sc008/cb10008-phoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112605<br />
------------------------------------------------------<br />
sc008 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtaaagtgaaacaaagcactattgcactggc<br />
cb10008-phoA-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112606 ==<br />
<pre><br />
Construction of {a~prepro>} of LamB basic part K112606 (111 bp, EcoRI/BamHI)<br />
PCR 009/cb10010-lamB-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256- K112606<br />
--------------------------------------------------<br />
sc009 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc<br />
cb10010-lamB-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112607 ==<br />
<pre><br />
Construction of {rbs_prepro>} of PhoA basic part K112607 (113 bp, EcoRI/BamHI)<br />
PCR sc010/cb10008-PhoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112607<br />
------------------------------------------------------<br />
sc010 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac<br />
cb10008-phoA-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112608 ==<br />
<pre><br />
Construction of {rbs_prepro>} of LamB basic part K112608 (126 bp, EcoRI/BamHI)<br />
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBjh1601AK<br />
Product is pBca1256-K112608<br />
------------------------------------------------------<br />
sc011 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatgatgattac has little longer annealing region. If you use shorter, GC content goes up little. I would use this:<br />
<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg<br />
<br />
cb10010-lamB-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_constructionTemplate:Team:UC Berkeley/Notebook/SC construction2008-07-02T22:54:37Z<p>Jinism83: /* pBca1256-K112605 */</p>
<hr />
<div>__TOC__<br />
<br />
<br />
== pBca1256-K112600 ==<br />
<pre><br />
Construction of <AP-tag> basic part K112600<br />
<br />
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112600<br />
----------------------------------------------------<br />
SC001F Forward Biobricking of <AP-tag><br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC002R Reverse Biobricking of <AP-tag><br />
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112601 ==<br />
<pre><br />
Construction of <AP-tag! basic part K112601<br />
<br />
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112601<br />
--------------------------------------------------<br />
SC001 Forward Biobricking of <AP-tag!<br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC003 Reverse Biobricking of <AP-tag!<br />
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112602 ==<br />
<pre><br />
Construction of <FLAG-tag> basic part K112602<br />
<br />
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112602<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag><br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC005 Reverse Biobricking of <FLAG-tag><br />
ccagtGGATCCcttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112603 ==<br />
<pre><br />
Construction of <FLAG-tag! basic part K112603<br />
<br />
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112603<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag!<br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC006 Reverse Biobricking of <FLAG-tag!<br />
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112604 ==<br />
<pre><br />
Construction of {rbs_barstar>} basic part K112604<br />
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112604<br />
-------------------------------<br />
mea035 Fwd biobricking of {rbs_barstar>} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg <br />
sc007 Reverse biobricking of {rbs_barstar>}<br />
cgttaGGATCCagaaagtatgatggtgatgtcgc <br />
</pre><br />
<br />
== pBca1256-K112403 ==<br />
<pre><br />
Construction of {prepro>} of PhoA basic part K112403 (114 bp, EcoRI/BamHI)<br />
CR cb10007/cb10008 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112403 <br />
-------------------------------------------------------------<br />
cb10007-phoA-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaatgaaacaaagc<br />
cb10008-phoA-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
<br />
== pBca1256-K112404 ==<br />
<pre><br />
Construction of {prepro>} of LamB basic part K112404 (132 bp, EcoRI/BamHI)<br />
PCR cb10009/cb10010 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256 <br />
Product is pBca1256-K112404 <br />
-------------------------------------------------------------<br />
cb10009-lamB-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgaaaagcaatgactcaggagatag<br />
cb10010-lamB-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
== pBca1256-K112605 ==<br />
<pre><br />
Construction of {a~prepro>} of PhoA basic part K112605 (100 bp, EcoRI/BamHI)<br />
PCR sc008/cb10008-phoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112605<br />
------------------------------------------------------<br />
sc008 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtaaagtgaaacaaagcactattgcactggc<br />
cb10008-phoA-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112606 ==<br />
<pre><br />
Construction of {a~prepro>} of LamB basic part K112606 (111 bp, EcoRI/BamHI)<br />
PCR 009/cb10010-lamB-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256- K112606<br />
--------------------------------------------------<br />
sc009 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc<br />
cb10010-lamB-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112607 ==<br />
<pre><br />
Construction of {rbs_prepro>} of PhoA basic part K112607 (113 bp, EcoRI/BamHI)<br />
PCR sc010/cb10008-PhoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112607<br />
------------------------------------------------------<br />
sc010 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac<br />
cb10008-phoA-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112608 ==<br />
<pre><br />
Construction of {rbs_prepro>} of LamB basic part K112608 (126 bp, EcoRI/BamHI)<br />
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBjh1601AK<br />
Product is pBca1256-K112608<br />
------------------------------------------------------<br />
sc011 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatgatgattac has little longer annealing region. If you use shorter, GC content goes up little. I would use this:<br />
<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg<br />
<br />
cb10010-lamB-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_constructionTemplate:Team:UC Berkeley/Notebook/SC construction2008-07-02T22:53:14Z<p>Jinism83: /* pBca1256-K112606 */</p>
<hr />
<div>__TOC__<br />
<br />
<br />
== pBca1256-K112600 ==<br />
<pre><br />
Construction of <AP-tag> basic part K112600<br />
<br />
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112600<br />
----------------------------------------------------<br />
SC001F Forward Biobricking of <AP-tag><br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC002R Reverse Biobricking of <AP-tag><br />
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112601 ==<br />
<pre><br />
Construction of <AP-tag! basic part K112601<br />
<br />
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112601<br />
--------------------------------------------------<br />
SC001 Forward Biobricking of <AP-tag!<br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC003 Reverse Biobricking of <AP-tag!<br />
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112602 ==<br />
<pre><br />
Construction of <FLAG-tag> basic part K112602<br />
<br />
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112602<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag><br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC005 Reverse Biobricking of <FLAG-tag><br />
ccagtGGATCCcttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112603 ==<br />
<pre><br />
Construction of <FLAG-tag! basic part K112603<br />
<br />
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112603<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag!<br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC006 Reverse Biobricking of <FLAG-tag!<br />
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112604 ==<br />
<pre><br />
Construction of {rbs_barstar>} basic part K112604<br />
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112604<br />
-------------------------------<br />
mea035 Fwd biobricking of {rbs_barstar>} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg <br />
sc007 Reverse biobricking of {rbs_barstar>}<br />
cgttaGGATCCagaaagtatgatggtgatgtcgc <br />
</pre><br />
<br />
== pBca1256-K112403 ==<br />
<pre><br />
Construction of {prepro>} of PhoA basic part K112403 (114 bp, EcoRI/BamHI)<br />
CR cb10007/cb10008 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112403 <br />
-------------------------------------------------------------<br />
cb10007-phoA-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaatgaaacaaagc<br />
cb10008-phoA-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
<br />
== pBca1256-K112404 ==<br />
<pre><br />
Construction of {prepro>} of LamB basic part K112404 (132 bp, EcoRI/BamHI)<br />
PCR cb10009/cb10010 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256 <br />
Product is pBca1256-K112404 <br />
-------------------------------------------------------------<br />
cb10009-lamB-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgaaaagcaatgactcaggagatag<br />
cb10010-lamB-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
== pBca1256-K112605 ==<br />
<pre><br />
Construction of {a~prepro>} of PhoA basic part K112605 (100 bp, EcoRI/BamHI)<br />
PCR sc008/cb10008-phoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112605<br />
------------------------------------------------------<br />
sc008 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcac<br />
cb10008-phoA-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112606 ==<br />
<pre><br />
Construction of {a~prepro>} of LamB basic part K112606 (111 bp, EcoRI/BamHI)<br />
PCR 009/cb10010-lamB-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256- K112606<br />
--------------------------------------------------<br />
sc009 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc<br />
cb10010-lamB-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112607 ==<br />
<pre><br />
Construction of {rbs_prepro>} of PhoA basic part K112607 (113 bp, EcoRI/BamHI)<br />
PCR sc010/cb10008-PhoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112607<br />
------------------------------------------------------<br />
sc010 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac<br />
cb10008-phoA-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112608 ==<br />
<pre><br />
Construction of {rbs_prepro>} of LamB basic part K112608 (126 bp, EcoRI/BamHI)<br />
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBjh1601AK<br />
Product is pBca1256-K112608<br />
------------------------------------------------------<br />
sc011 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatgatgattac has little longer annealing region. If you use shorter, GC content goes up little. I would use this:<br />
<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg<br />
<br />
cb10010-lamB-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_constructionTemplate:Team:UC Berkeley/Notebook/SC construction2008-07-02T22:52:20Z<p>Jinism83: /* pBca1256-K112607 */</p>
<hr />
<div>__TOC__<br />
<br />
<br />
== pBca1256-K112600 ==<br />
<pre><br />
Construction of <AP-tag> basic part K112600<br />
<br />
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112600<br />
----------------------------------------------------<br />
SC001F Forward Biobricking of <AP-tag><br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC002R Reverse Biobricking of <AP-tag><br />
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112601 ==<br />
<pre><br />
Construction of <AP-tag! basic part K112601<br />
<br />
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112601<br />
--------------------------------------------------<br />
SC001 Forward Biobricking of <AP-tag!<br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC003 Reverse Biobricking of <AP-tag!<br />
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112602 ==<br />
<pre><br />
Construction of <FLAG-tag> basic part K112602<br />
<br />
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112602<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag><br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC005 Reverse Biobricking of <FLAG-tag><br />
ccagtGGATCCcttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112603 ==<br />
<pre><br />
Construction of <FLAG-tag! basic part K112603<br />
<br />
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112603<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag!<br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC006 Reverse Biobricking of <FLAG-tag!<br />
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112604 ==<br />
<pre><br />
Construction of {rbs_barstar>} basic part K112604<br />
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112604<br />
-------------------------------<br />
mea035 Fwd biobricking of {rbs_barstar>} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg <br />
sc007 Reverse biobricking of {rbs_barstar>}<br />
cgttaGGATCCagaaagtatgatggtgatgtcgc <br />
</pre><br />
<br />
== pBca1256-K112403 ==<br />
<pre><br />
Construction of {prepro>} of PhoA basic part K112403 (114 bp, EcoRI/BamHI)<br />
CR cb10007/cb10008 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112403 <br />
-------------------------------------------------------------<br />
cb10007-phoA-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaatgaaacaaagc<br />
cb10008-phoA-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
<br />
== pBca1256-K112404 ==<br />
<pre><br />
Construction of {prepro>} of LamB basic part K112404 (132 bp, EcoRI/BamHI)<br />
PCR cb10009/cb10010 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256 <br />
Product is pBca1256-K112404 <br />
-------------------------------------------------------------<br />
cb10009-lamB-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgaaaagcaatgactcaggagatag<br />
cb10010-lamB-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
== pBca1256-K112605 ==<br />
<pre><br />
Construction of {a~prepro>} of PhoA basic part K112605 (100 bp, EcoRI/BamHI)<br />
PCR sc008/cb10008-phoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112605<br />
------------------------------------------------------<br />
sc008 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcac<br />
cb10008-phoA-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112606 ==<br />
<pre><br />
Construction of {a~prepro>} of LamB basic part K112606 (111 bp, EcoRI/BamHI)<br />
PCR 009/cb10010-lamB-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256- K112606<br />
--------------------------------------------------<br />
sc009 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtagaatgatgattactctgc<br />
cb10010-lamB-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112607 ==<br />
<pre><br />
Construction of {rbs_prepro>} of PhoA basic part K112607 (113 bp, EcoRI/BamHI)<br />
PCR sc010/cb10008-PhoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112607<br />
------------------------------------------------------<br />
sc010 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac<br />
cb10008-phoA-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112608 ==<br />
<pre><br />
Construction of {rbs_prepro>} of LamB basic part K112608 (126 bp, EcoRI/BamHI)<br />
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBjh1601AK<br />
Product is pBca1256-K112608<br />
------------------------------------------------------<br />
sc011 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatgatgattac has little longer annealing region. If you use shorter, GC content goes up little. I would use this:<br />
<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg<br />
<br />
cb10010-lamB-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_constructionTemplate:Team:UC Berkeley/Notebook/SC construction2008-07-02T22:49:11Z<p>Jinism83: /* pBca1256-K112608 */</p>
<hr />
<div>__TOC__<br />
<br />
<br />
== pBca1256-K112600 ==<br />
<pre><br />
Construction of <AP-tag> basic part K112600<br />
<br />
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112600<br />
----------------------------------------------------<br />
SC001F Forward Biobricking of <AP-tag><br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC002R Reverse Biobricking of <AP-tag><br />
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112601 ==<br />
<pre><br />
Construction of <AP-tag! basic part K112601<br />
<br />
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112601<br />
--------------------------------------------------<br />
SC001 Forward Biobricking of <AP-tag!<br />
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag<br />
SC003 Reverse Biobricking of <AP-tag!<br />
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg<br />
</pre><br />
<br />
== pBca1256-K112602 ==<br />
<pre><br />
Construction of <FLAG-tag> basic part K112602<br />
<br />
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112602<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag><br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC005 Reverse Biobricking of <FLAG-tag><br />
ccagtGGATCCcttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112603 ==<br />
<pre><br />
Construction of <FLAG-tag! basic part K112603<br />
<br />
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910)<br />
Product is pBca1256-K112603<br />
-------------------------------------------------------------<br />
SC004 Forward Biobricking of <FLAG-tag!<br />
cgataGAATTCatgAGATCTgactacaaggatgacgacg<br />
SC006 Reverse Biobricking of <FLAG-tag!<br />
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc<br />
</pre><br />
<br />
== pBca1256-K112604 ==<br />
<pre><br />
Construction of {rbs_barstar>} basic part K112604<br />
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112604<br />
-------------------------------<br />
mea035 Fwd biobricking of {rbs_barstar>} <br />
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg <br />
sc007 Reverse biobricking of {rbs_barstar>}<br />
cgttaGGATCCagaaagtatgatggtgatgtcgc <br />
</pre><br />
<br />
== pBca1256-K112403 ==<br />
<pre><br />
Construction of {prepro>} of PhoA basic part K112403 (114 bp, EcoRI/BamHI)<br />
CR cb10007/cb10008 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112403 <br />
-------------------------------------------------------------<br />
cb10007-phoA-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaatgaaacaaagc<br />
cb10008-phoA-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
<br />
== pBca1256-K112404 ==<br />
<pre><br />
Construction of {prepro>} of LamB basic part K112404 (132 bp, EcoRI/BamHI)<br />
PCR cb10009/cb10010 on MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256 <br />
Product is pBca1256-K112404 <br />
-------------------------------------------------------------<br />
cb10009-lamB-F Fwd biobricking of {prepro>}<br />
cgataGAATTCatgAGATCTgaaaagcaatgactcaggagatag<br />
cb10010-lamB-R Reverse biobricking of {prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
== pBca1256-K112605 ==<br />
<pre><br />
Construction of {a~prepro>} of PhoA basic part K112605 (100 bp, EcoRI/BamHI)<br />
PCR sc008/cb10008-phoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112605<br />
------------------------------------------------------<br />
sc008 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcac<br />
cb10008-phoA-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112606 ==<br />
<pre><br />
Construction of {a~prepro>} of LamB basic part K112606 (111 bp, EcoRI/BamHI)<br />
PCR 009/cb10010-lamB-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256- K112606<br />
--------------------------------------------------<br />
sc009 Fwd biobricking of {a~prepro>}<br />
cgataGAATTCatgAGATCTtagaatgatgattactctgc<br />
cb10010-lamB-R Reverse biobricking of {a~prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
== pBca1256-K112607 ==<br />
<pre><br />
Construction of {rbs_prepro>} of PhoA basic part K112607 (113 bp, EcoRI/BamHI)<br />
PCR sc010/cb10008-PhoA-R (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBca1256<br />
Product is pBca1256-K112607<br />
------------------------------------------------------<br />
sc010 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaag<br />
cb10008-phoA-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCgggcttttgtcacaggggtaaac<br />
</pre><br />
<br />
== pBca1256-K112608 ==<br />
<pre><br />
Construction of {rbs_prepro>} of LamB basic part K112608 (126 bp, EcoRI/BamHI)<br />
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (EcoRI/BamHI, 2472+910, L)<br />
Sub into pBjh1601AK<br />
Product is pBca1256-K112608<br />
------------------------------------------------------<br />
sc011 Fwd biobricking of {rbs_prepro>}<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatgatgattac has little longer annealing region. If you use shorter, GC content goes up little. I would use this:<br />
<br />
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg<br />
<br />
cb10010-lamB-R Reverse biobricking of {rbs_prepro>}<br />
cgtagGGATCCcagccattgcctgagcagacattac<br />
</pre><br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/DV_sequencingTemplate:Team:UC Berkeley/Notebook/DV sequencing2008-06-26T22:59:40Z<p>Jinism83: </p>
<hr />
<div>{| class="wikitable" border="1" style="background-color:#FFF;color:black" | <br />
<br />
| Read || Date || Plasmid || Clone # || Oligo || Result || File <br />
|- <br />
| DV4 || 6/19/08 || Bca1256-K112706|| Clone #1|| ca998 ||Bad read|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV001 | DV4]] <br />
|- Bad read <br />
| DV5 || 6/19/08 || Bca1256-K112707 || Clone #1 || ca998 || Point Mutation || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV002 | DJV002]] <br />
|- <br />
| DV6 || 6/19/08 || Bca1256-K112708 || Clone #1 || ca998 || Perfect Read!|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV003 | DJV003]] <br />
|- <br />
| DV8 || 6/19/08 || Bca1256-K112710 || Clone #1 || ca998 || Perfect Read!|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV004 | DJV004]] <br />
|- <br />
| DV11 || 6/19/08 || Bca1256-K112704 || Clone #1 || ca998 || Insertion || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV005 | DJV005]] <br />
|- <br />
| DV13 || 6/19/08 || Bca1256-K112705 || Clone #1|| ca998 || Perfect Read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV006 | DJV006]] <br />
|- <br />
| DV21 || 6/19/08 || Bca1256-K112709 || Clone #1 || ca998 || Perfect Read|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV007 | DJV007]] <br />
|- <br />
| DV009/010 ||6/19/08|| Bca1256-K112703 || Clone #1 || ca998 ||Bad read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV008 | DJV008]] <br />
|- <br />
| ig10 || 6/22/08 || Bca1256-K112705 || Clone #2|| ca998 || Bad read|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV009 | DJV009]] <br />
|- <br />
| ig11 || 6/22/08|| Bca1256-K112706 || Clone #2|| ca998 || Perfect read|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV010 | DJV010]] <br />
|- <br />
| ig12 || 6/22/08 || Bca1256-K112707 || Clone #2|| ca998 || Bad read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV011 | DJV011]] <br />
|- <br />
| ig13 || 6/22/08 || Bca1256-K112709 || Clone #2|| ca998 || Bad read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV012 | DJV012]] <br />
|- <br />
| ig14 || 6/22/08 || Bca1256-K112711 || Clone #1 || ca998 || Close, shows correct sequence until end- attempt reverse read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV013 | DJV013]] <br />
|- <br />
| ig15 || 6/22/08 || Bca1256-K112701 || Clone #2 || ca998 || Several mutations || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV014 | DJV014]] <br />
|- <br />
| ig14 || 6/24/08 || Bca1256-K112711|| Clone #1 || g00101|| Shows good sequence from end|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV015 | DJV015]] <br />
|- <br />
| DJV016 || 6/25/08 || Bca1256-K112701 || Clone #2 || ca998 || Perfect read, eliminating EcoRI restr. sites|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV016 | DJV016]] <br />
|- <br />
| DJV017 || 6/25/08 || Bca1256-K112701 || Clone #3 || ca998 || Perfect read, homology w/ DJV016 || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV017 | DJV017]] <br />
|- <br />
| DJV018 || 6/25/08 || Bca1256-K112704 || Clone #3 || ca998 ||Perfect read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV018 | DJV018]] <br />
|- <br />
| DJV019 || 6/25/08 || Bca1256-K112704 || Clone #4 || ca998 || Perfect read || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV019 | DJV019]] <br />
|- <br />
| DJV020 ||6/25/08|| Bca1256-K112707 || Clone #3 || ca998 || Good read for 900bp, then a couple insertions/dels || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV020 | DJV020]] <br />
|- <br />
| DJV021 || 6/25/08 || Bca1256-K112707 || Clone #4 || ca998 ||att-site Dimerization prevents a complete read|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV021 | DJV021]] <br />
|- <br />
| DJV020alfwd || 6/26/08 || Bca1256-K112707|| Clone #3 || al027 ||Perfect read when combined w/ ca998 and g00101|| [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV022 | DJV022]] <br />
|- <br />
| DJV020 || 6/26/08 || Bca1256-K112707 || Clone #3 || g00101 || See above || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV023 | DJV023]] <br />
|- <br />
| DJV024 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV024 | DJV024]] <br />
|- <br />
| DJV025 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV025 | DJV025]] <br />
|- <br />
| DJV026 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV026 | DJV026]] <br />
|- <br />
| DJV027 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV027 | DJV027]] <br />
|- <br />
| DJV028 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV028 | DJV028]] <br />
|- <br />
| DJV029 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV029 | DJV029]] <br />
|- <br />
| DJV030 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV030 | DJV030]] <br />
|- <br />
| DJV031 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV031 | DJV031]] <br />
|- <br />
| DJV032 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV032 | DJV032]] <br />
|- <br />
| DJV033 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV033 | DJV033]] <br />
|- <br />
| DJV034 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV034 | DJV034]] <br />
|- <br />
| DJV035 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV035 | DJV035]] <br />
|- <br />
| DJV036 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV036 | DJV036]] <br />
|- <br />
| DJV037 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV037 | DJV037]] <br />
|- <br />
| DJV038 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV038 | DJV038]] <br />
|- <br />
| DJV039 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV039 | DJV039]] <br />
|- <br />
| DJV040 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV040 | DJV040]] <br />
|- <br />
| DJV041 || Date || Plasmid || Clone # || Oligo || Result || [[Team:UC Berkeley/Notebook/DV_sequencingDJV/DJV041 | DJV041]] <br />
|-</div>Jinism83http://2008.igem.org/Team:UC_Berkeley/ProjectOverviewTeam:UC Berkeley/ProjectOverview2008-06-25T01:03:46Z<p>Jinism83: </p>
<hr />
<div><!--- The Mission, Experiments ---><br />
<br />
{|<br />
|-<br />
|valign="top"|<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="2" cellspacing="2" border="3" bordercolor="grey" width="150 px"<br />
|- align="center"<br />
|[[Team:UC_Berkeley|Home]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Team|The Team]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/ProjectOverview|Project Overview]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/LysisSystem|Sound Induced Lysis]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/GatewaySystem|Gateway Reaction]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/AssemblySystem|Assembly Reaction]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/ProteinPureSystem|Protein Purification]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Parts|Parts Submitted]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Modeling|Modeling]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Notebook|Notebook]]<br />
|}<br />
|valign="top"| __TOC__<br />
|}<br />
<br />
== '''Overall project''' ==<br />
<br />
''Our project is centered around the creation of E. coli that lyse in response to a sound stimulus. We hope to demonstrate the utility of this sound lysis device in three distinct applications: protein purification, the Gateway reaction, and composite part assembly. Current methods of protein purification abrasively disrupt the bacterial membrane, often damaging or destroying the protein of interest. We seek to show that our device can be used as a gentler alternative to release proteins from the E. coli cytoplasm. The other two applications, the Gateway and Assembly reactions, involve passing a specific genetic sequence, often called a "part," from one plasmid to another. These processes generally require the isolation of both plasmids of interest from the E. coli in which they are amplified and the addition of somewhat costly reagents. In each case, we propose bringing together two bacterial cultures, each containing our sound lysis device and one of the necessary plasmids, that produce the reagents required for the reaction. When a sound stimulus is applied, the bacteria release the plasmids and reagents into the surrounding solution and the desired reaction ensues. This promises to both simplify and reduce the costs for Gateway and Assembly reactions.''<br />
<br />
=== Experiments ===<br />
<br />
[[Image:phoA_plate.jpg|E. coli plates]]<br />
<br />
==== '''1: Testing Individual Composite Parts''' ====<br />
<br />
===== '''1.1: Prepro Parts''' =====<br />
<pre><br />
{promoter}{rbs}{prepro}{phoA}{term}<br />
</pre><br />
We made parts of the format {promoter}{rbs}{prepro}{phoA}{term}. The promoter we used was {pBad}, and we tried 3 different ribosome binding sites with each prepro. We plated the bacteria we transformed on two plates, both with p-nitrophenyl phosphate, but one had arabinose and one did not. We screened successful rbs/prepro combinations by looking for combinations which caused blue colonies on the plate with arabinose and white colonies on the plate without arabinose. In preparation for later composite parts, we made sure that the {rbs}{prepro} part was an intermediate when making our construction tree.<br />
<br />
===== '''1.2: Promoters''' =====<br />
'''1.2.1 Growth-dependent Promoter''' <br><br />
<pre><br />
{promoter}{rbs}{GFP}{term}<br />
intermediate: {rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {promoter}{rbs}{GFP}{term}, where we want to make the last three, {rbs}{GFP}{term}, into one part and test the different OD dependent promoters: hns, spv, bolA, ftsAZ, ftsQ, rrnB P1, and Ptet (as a positive control, which we already have). As a negative control, we will have no promoter. <br><br />
<br />
The experiment involves diluting saturated cultures and growing them at 37 C, take out at the different time points and test the fluorescence to determine at what OD they start to turn on. <br><br />
<br />
'''1.2.2 Sound-dependent Promoter''' <br><br />
<pre><br />
{Psound}{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Psound}{rbs}{GFP}{term}. Grow in culture and apply sound for 30 min. Then measure fluorescence.<br />
<br />
===== '''1.3: Amplifier''' =====<br />
<pre><br />
{Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}<br />
{Pbad}{rbs}{GFP}{term}<br />
intermediates: {spvR}{Pspv2}<br />
{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}, where {spvR}{Pspv2} is a composite part, and {rbs}{GFP}{term} is a composite part. For the control, we will have {Pbad}{rbs}{GFP}{term}. We will grow the culture to mid-log, induce w/0.2x arabinose and measure the fluorescence after 1 hour. From this, we will determine how many folds the signal was amplified.<br />
<br />
===== '''1.4: Ligase''' =====<br />
<pre><br />
{Ptet}{rbs}{ligase}{term}<br />
{Ptet}{rbs.ligase}{term}<br />
</pre><br />
Make parts of the format {Ptet}{rbs}{ligase}{term}, where {Ptet}{rbs} is a composite part(which we already have). We will also make {Ptet}{rbs.ligase}. Over-express ligase, lyse cell, and use 1 ul of cell lysate to ligate 2 purified DNA fragments.<br />
<br />
===== '''1.5: Lysozyme, holin, antiholin''' =====<br />
<pre><br />
{promoter}{part}{S-tag}{term}<br />
</pre><br />
Assay for expression of lysozyme, holin, and antiholin. We will want to make measurements of expression levels to collect data for the modeling component, so we will want to use a variety of promoters. Assay will be done using the S-tag.<br />
<br />
==== '''2: Testing if Protein can be Transported to the Periplasm''' ====<br />
<br />
===== '''2.1: PhoA''' =====<br />
<pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}<br />
</pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}. The {rbs}{prepro>} composite part will have the following varients: {rbs}{prepro>}, {rbs~}{a~prepro>}, and {rbs.prepro>}. Note that we will already have the {<phoA!}{term} from the testing of individual prepro parts. The parts that we want to test in this system are: xis, int, ihfA, ihfB, Cre, ligase, BamHI, BglII. See if bugs turn yellow(?) when you induce Pbad. Similar to prepro testing experiments. We may need a {GS linker} between the part and PhoA to have a higher chance of correct folding occurring.<br />
<br />
===== '''2.2: Deoxycholic Acid to Remove Outer Membrane''' =====<br />
<pre><br />
{pBad}{rbs}{prepro}{part}{term}<br />
{pBad}{rbs}{prepro}{part}{S-tag}{term}<br />
</pre><br />
If the PhoA experiment to test protein transport to the periplasm gives a negative, that does not mean the protein was not transported - the protein may have had side reactions with the PhoA protein. At that point, we will split the parts we are trying to assay into two groups. BamHI, BglII, ligase, and cre can be linking directly to the prepro and assayed for after dissolving the outer membrane, giving parts of the format {pBad}{rbs}{prepro}{part}{term}. xis, int, ihfA, and ihfB will be linked with an S-tag we will by tagging the protein with the S-tag, giving {pBad}{rbs}{prepro}{part}{S-tag}{term}. After inducing our bacteria with arabinose, we remove the outer membrane with deoxycholic acid, and then assay for actvity of the S-tag.<br />
<br />
==== '''3: Expression of proteins in cytoplasm''' ====<br />
{promoter}{rbs}{part>}{<S-tag!}{term}<br />
== Results ==<br />
<br />
''Results to come sometime''</div>Jinism83http://2008.igem.org/Team:UC_Berkeley/ProjectOverviewTeam:UC Berkeley/ProjectOverview2008-06-24T23:08:26Z<p>Jinism83: /* 1.4: Ligase */</p>
<hr />
<div><!--- The Mission, Experiments ---><br />
<br />
{|<br />
|-<br />
|valign="top"|<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="2" cellspacing="2" border="3" bordercolor="grey" width="150 px"<br />
|- align="center"<br />
|[[Team:UC_Berkeley|Home]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Team|The Team]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/ProjectOverview|Project Overview]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/LysisSystem|Sound Induced Lysis]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/GatewaySystem|Gateway Reaction]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/AssemblySystem|Assembly Reaction]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/ProteinPureSystem|Protein Purification]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Parts|Parts Submitted]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Modeling|Modeling]]<br />
|- align="center"<br />
|[[Team:UC_Berkeley/Notebook|Notebook]]<br />
|}<br />
|valign="top"| __TOC__<br />
|}<br />
<br />
== '''Overall project''' ==<br />
<br />
''Our project is centered around the creation of E. coli that lyse in response to a sound stimulus. We hope to demonstrate the utility of this sound lysis device in three distinct applications: protein purification, the Gateway reaction, and composite part assembly. Current methods of protein purification abrasively disrupt the bacterial membrane, often damaging or destroying the protein of interest. We seek to show that our device can be used as a gentler alternative to release proteins from the E. coli cytoplasm. The other two applications, the Gateway and Assembly reactions, involve passing a specific genetic sequence, often called a "part," from one plasmid to another. These processes generally require the isolation of both plasmids of interest from the E. coli in which they are amplified and the addition of somewhat costly reagents. In each case, we propose bringing together two bacterial cultures, each containing our sound lysis device and one of the necessary plasmids, that produce the reagents required for the reaction. When a sound stimulus is applied, the bacteria release the plasmids and reagents into the surrounding solution and the desired reaction ensues. This promises to both simplify and reduce the costs for Gateway and Assembly reactions.''<br />
<br />
=== Experiments ===<br />
<br />
[[Image:phoA_plate.jpg|E. coli plates]]<br />
<br />
==== '''1: Testing Individual Composite Parts''' ====<br />
<br />
===== '''1.1: Prepro Parts''' =====<br />
<pre><br />
{promoter}{rbs}{prepro}{phoA}{term}<br />
</pre><br />
We made parts of the format {promoter}{rbs}{prepro}{phoA}{term}. The promoter we used was {pBad}, and we tried 3 different ribosome binding sites with each prepro. We plated the bacteria we transformed on two plates, both with p-nitrophenyl phosphate, but one had arabinose and one did not. We screened successful rbs/prepro combinations by looking for combinations which caused blue colonies on the plate with arabinose and white colonies on the plate without arabinose. In preparation for later composite parts, we made sure that the {rbs}{prepro} part was an intermediate when making our construction tree.<br />
<br />
===== '''1.2: Promoters''' =====<br />
'''1.2.1 Growth-dependent Promoter''' <br><br />
<pre><br />
{promoter}{rbs}{GFP}{term}<br />
intermediate: {rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {promoter}{rbs}{GFP}{term}, where we want to make the last three, {rbs}{GFP}{term}, into one part and test the different OD dependent promoters: hns, spv, bolA, ftsAZ, ftsQ, rrnB P1, and Ptet (as a positive control, which we already have). As a negative control, we will have no promoter. <br><br />
<br />
The experiment involves diluting saturated cultures and growing them at 37 C, take out at the different time points and test the fluorescence to determine at what OD they start to turn on. <br><br />
<br />
'''1.2.2 Sound-dependent Promoter''' <br><br />
<pre><br />
{Psound}{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Psound}{rbs}{GFP}{term}. Grow in culture and apply sound for 30 min. Then measure fluorescence.<br />
<br />
===== '''1.3: Amplifier''' =====<br />
<pre><br />
{Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}<br />
{Pbad}{rbs}{GFP}{term}<br />
intermediates: {spvR}{Pspv2}<br />
{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}, where {spvR}{Pspv2} is a composite part, and {rbs}{GFP}{term} is a composite part. For the control, we will have {Pbad}{rbs}{GFP}{term}. We will grow the culture to mid-log, induce w/0.2x arabinose and measure the fluorescence after 1 hour. From this, we will determine how many folds the signal was amplified.<br />
<br />
===== '''1.4: Ligase''' =====<br />
<pre><br />
{Ptet}{rbs}{ligase}{term}<br />
{Ptet}{rbs.ligase}{term}<br />
</pre><br />
Make parts of the format {Ptet}{rbs}{ligase}{term}, where {Ptet}{rbs} is a composite part(which we already have). We will also make {Ptet}{rbs.ligase}. Over-express ligase, lyse cell, and use 1 ul of cell lysate to ligate 2 purified DNA fragments.<br />
<br />
===== '''1.5: Lysozyme, holin, antiholin''' =====<br />
<pre><br />
{promoter}{part}{S-tag}{term}<br />
</pre><br />
Assay for expression of lysozyme, holin, and antiholin. We will want to make measurements of expression levels to collect data for the modeling component, so we will want to use a variety of promoters. Assay will be done using the S-tag.<br />
<br />
==== '''2: Testing if Protein can be Transported to the Periplasm''' ====<br />
<br />
===== '''2.1: PhoA''' =====<br />
<pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}<br />
</pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}. The {rbs}{prepro>} composite part will have the following varients: {rbs}{prepro>}, {rbs~}{a~prepro>}, and {rbs.prepro>}. Note that we will already have the {<phoA!}{term} from the testing of individual prepro parts. The parts that we want to test in this system are: xis, int, ihfA, ihfB, Cre, ligase, BamHI, BglII. See if bugs turn yellow(?) when you induce Pbad. Similar to prepro testing experiments. We may need a {GS linker} between the part and PhoA to have a higher chance of correct folding occurring.<br />
<br />
===== '''2.2: Deoxycholic Acid to Remove Outer Membrane''' =====<br />
<pre><br />
{pBad}{rbs}{prepro}{part}{term}<br />
{pBad}{rbs}{prepro}{part}{S-tag}{term}<br />
</pre><br />
If the PhoA experiment to test protein transport to the periplasm gives a negative, that does not mean the protein was not transported - the protein may have had side reactions with the PhoA protein. At that point, we will split the parts we are trying to assay into two groups. BamHI, BglII, ligase, and cre can be linking directly to the prepro and assayed for after dissolving the outer membrane, giving parts of the format {pBad}{rbs}{prepro}{part}{term}. xis, int, ihfA, and ihfB will be linked with an S-tag we will by tagging the protein with the S-tag, giving {pBad}{rbs}{prepro}{part}{S-tag}{term}. After inducing our bacteria with arabinose, we remove the outer membrane with deoxycholic acid, and then assay for actvity of the S-tag.<br />
<br />
== Results ==<br />
<br />
''Results to come sometime''</div>Jinism83http://2008.igem.org/UC_Berkeley/24_June_2008UC Berkeley/24 June 20082008-06-24T18:52:12Z<p>Jinism83: New page: the assembly tree generator is ready to go. We've almost got the most of the basic parts. We will start transfer them into appropriate assembly vectors.</p>
<hr />
<div>the assembly tree generator is ready to go. <br />
We've almost got the most of the basic parts. We will start transfer them into appropriate assembly vectors.</div>Jinism83http://2008.igem.org/Team:UC_Berkeley/ProjectOverviewTeam:UC Berkeley/ProjectOverview2008-06-19T19:46:45Z<p>Jinism83: /* 2.2: Dicholic Acid to Remove Outer Membrane */</p>
<hr />
<div>__TOC__<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:UC_Berkeley | Team Example 2]]<br />
|}<br />
<br />
<!--- The Mission, Experiments ---><br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:UC_Berkeley|Home]]<br />
!align="center"|[[Team:UC_Berkeley/Team|The Team]]<br />
!align="center"|[[Team:UC_Berkeley/Project|The Project]]<br />
!align="center"|[[Team:UC_Berkeley/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:UC_Berkeley/Modeling|Modeling]]<br />
!align="center"|[[Team:UC_Berkeley/Notebook|Notebook]]<br />
|}<br />
(''Or you can choose different headings. But you must have a team page, a project page, and a notebook page.'')<br />
<br />
<br />
<br />
== '''Overall project''' ==<br />
<br />
Our project is centered around a system that will allow sound-induced lysis o E. coli.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Project Details==<br />
<br />
=== Part 2 ===<br />
<br />
=== The Experiments ===<br />
<br />
[[Image:phoA_plate.jpg]]<br />
<br />
==== '''1: Testing Individual Composite Parts''' ====<br />
<br />
===== '''1.1: Prepro Parts''' =====<br />
<pre><br />
{promoter}{rbs}{prepro}{phoA}{term}<br />
</pre><br />
We made parts of the format {promoter}{rbs}{prepro}{phoA}{term}. The promoter we used was {pBad}, and we tried 3 different ribosome binding sites with each prepro. We plated the bacteria we transformed on two plates, both with p-nitrophenyl phosphate, but one had arabinose and one did not. We screened successful rbs/prepro combinations by looking for combinations which caused blue colonies on the plate with arabinose and white colonies on the plate without arabinose. In preparation for later composite parts, we made sure that the {rbs}{prepro} part was an intermediate when making our construction tree.<br />
<br />
===== '''1.2: Promoters''' =====<br />
'''1.2.1 Growth-dependent Promoter''' <br><br />
<pre><br />
{promoter}{rbs}{GFP}{term}<br />
intermediate: {rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {promoter}{rbs}{GFP}{term}, where we want to make the last three, {rbs}{GFP}{term}, into one part and test the different OD dependent promoters: hns, spv, bolA, ftsAZ, ftsQ, rrnB P1, and Ptet (as a positive control, which we already have). As a negative control, we will have no promoter. <br><br />
<br />
The experiment involves diluting saturated cultures and growing them at 37 C, take out at the different time points and test the fluorescence to determine at what OD they start to turn on. <br><br />
<br />
'''1.2.2 Sound-dependent Promoter''' <br><br />
<pre><br />
{Psound}{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Psound}{rbs}{GFP}{term}. Grow in culture and apply sound for 30 min. Then measure fluorescence.<br />
<br />
===== '''1.3: Amplifier''' =====<br />
<pre><br />
{Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}<br />
{Pbad}{rbs}{GFP}{term}<br />
intermediates: {spvR}{Pspv2}<br />
{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}, where {spvR}{Pspv2} is a composite part, and {rbs}{GFP}{term} is a composite part. For the control, we will have {Pbad}{rbs}{GFP}{term}. We will grow the culture to mid-log, induce w/0.2x arabinose and measure the fluorescence after 1 hour. From this, we will determine how many folds the signal was amplified.<br />
<br />
===== '''1.4: Ligase''' =====<br />
<pre><br />
{Ptet}{rbs}{ligase}{term}<br />
{Ptet}{rbs.ligase}{term}<br />
{Ptet}{ligase!}{term}<br />
</pre><br />
Make parts of the format {Ptet}{rbs}{ligase}{term}, where {Ptet}{rbs} is a composite part(which we already have). We will also make {Ptet}{rbs.ligase} and {Ptet}{ligase!}. Over-express ligase, lyse cell, and use 1 ul of cell lysate to ligate 2 purified DNA fragments.<br />
<br />
===== '''1.5: Lysozyme, holin, antiholin''' =====<br />
<pre><br />
{promoter}{part}{S-tag}{term}<br />
</pre><br />
Assay for expression of lysozyme, holin, and antiholin. We will want to make measurements of expression levels to collect data for the modeling component, so we will want to use a variety of promoters. Assay will be done using the S-tag.<br />
<br />
==== '''2: Testing if Protein can be Transported to the Periplasm''' ====<br />
<br />
===== '''2.1: PhoA''' =====<br />
<pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}<br />
</pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}. The {rbs}{prepro>} composite part will have the following varients: {rbs}{prepro>}, {rbs~}{a~prepro>}, and {rbs.prepro>}. Note that we will already have the {<phoA!}{term} from the testing of individual prepro parts. The parts that we want to test in this system are: xis, int, ihfA, ihfB, Cre, ligase, BamHI, BglII. See if bugs turn yellow(?) when you induce Pbad. Similar to prepro testing experiments. We may need a {GS linker} between the part and PhoA to have a higher chance of correct folding occurring.<br />
<br />
===== '''2.2: Deoxycholic Acid to Remove Outer Membrane''' =====<br />
<pre><br />
{pBad}{rbs}{prepro}{part}{term}<br />
{pBad}{rbs}{prepro}{part}{S-tag}{term}<br />
</pre><br />
If the PhoA experiment to test protein transport to the periplasm gives a negative, that does not mean the protein was not transported - the protein may have had side reactions with the PhoA protein. At that point, we will split the parts we are trying to assay into two groups. BamHI, BglII, ligase, and cre can be linking directly to the prepro and assayed for after dissolving the outer membrane, giving parts of the format {pBad}{rbs}{prepro}{part}{term}. xis, int, ihfA, and ihfB will be linked with an S-tag we will by tagging the protein with the S-tag, giving {pBad}{rbs}{prepro}{part}{S-tag}{term}. After inducing our bacteria with arabinose, we remove the outer membrane with deoxycholic acid, and then assay for actvity of the S-tag.<br />
<br />
=== Part 3 ===<br />
<br />
== Results ==</div>Jinism83http://2008.igem.org/Team:UC_Berkeley/ProjectOverviewTeam:UC Berkeley/ProjectOverview2008-06-19T19:13:09Z<p>Jinism83: /* 1.2: Promoters */</p>
<hr />
<div>__TOC__<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:UC_Berkeley | Team Example 2]]<br />
|}<br />
<br />
<!--- The Mission, Experiments ---><br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:UC_Berkeley|Home]]<br />
!align="center"|[[Team:UC_Berkeley/Team|The Team]]<br />
!align="center"|[[Team:UC_Berkeley/Project|The Project]]<br />
!align="center"|[[Team:UC_Berkeley/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:UC_Berkeley/Modeling|Modeling]]<br />
!align="center"|[[Team:UC_Berkeley/Notebook|Notebook]]<br />
|}<br />
(''Or you can choose different headings. But you must have a team page, a project page, and a notebook page.'')<br />
<br />
<br />
<br />
== '''Overall project''' ==<br />
<br />
Our project is centered around a system that will allow sound-induced lysis o E. coli.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Project Details==<br />
<br />
=== Part 2 ===<br />
<br />
=== The Experiments ===<br />
<br />
[[Image:phoA_plate.jpg]]<br />
<br />
==== '''1: Testing Individual Composite Parts''' ====<br />
<br />
===== '''1.1: Prepro Parts''' =====<br />
<pre><br />
{promoter}{rbs}{prepro}{phoA}{term}<br />
</pre><br />
We made parts of the format {promoter}{rbs}{prepro}{phoA}{term}. The promoter we used was {pBad}, and we tried 3 different ribosome binding sites with each prepro. We plated the bacteria we transformed on two plates, both with p-nitrophenyl phosphate, but one had arabinose and one did not. We screened successful rbs/prepro combinations by looking for combinations which caused blue colonies on the plate with arabinose and white colonies on the plate without arabinose. In preparation for later composite parts, we made sure that the {rbs}{prepro} part was an intermediate when making our construction tree.<br />
<br />
===== '''1.2: Promoters''' =====<br />
'''1.2.1 Growth-dependent Promoter''' <br><br />
<pre><br />
{promoter}{rbs}{GFP}{term}<br />
intermediate: {rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {promoter}{rbs}{GFP}{term}, where we want to make the last three, {rbs}{GFP}{term}, into one part and test the different OD dependent promoters: hns, spv, bolA, ftsAZ, ftsQ, rrnB P1, and Ptet (as a positive control, which we already have). As a negative control, we will have no promoter. <br><br />
<br />
The experiment involves diluting saturated cultures and growing them at 37 C, take out at the different time points and test the fluorescence to determine at what OD they start to turn on. <br><br />
<br />
'''1.2.2 Sound-dependent Promoter''' <br><br />
<pre><br />
{Psound}{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Psound}{rbs}{GFP}{term}. Grow in culture and apply sound for 30 min. Then measure fluorescence.<br />
<br />
===== '''1.3: Amplifier''' =====<br />
<pre><br />
{Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}<br />
{Pbad}{rbs}{GFP}{term}<br />
intermediates: {spvR}{Pspv2}<br />
{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}, where {spvR}{Pspv2} is a composite part, and {rbs}{GFP}{term} is a composite part. For the control, we will have {Pbad}{rbs}{GFP}{term}. We will grow the culture to mid-log, induce w/0.2x arabinose and measure the fluorescence after 1 hour. From this, we will determine how many folds the signal was amplified.<br />
<br />
===== '''1.4: Ligase''' =====<br />
<pre><br />
{Ptet}{rbs}{ligase}{term}<br />
{Ptet}{rbs.ligase}{term}<br />
{Ptet}{ligase!}{term}<br />
</pre><br />
Make parts of the format {Ptet}{rbs}{ligase}{term}, where {Ptet}{rbs} is a composite part(which we already have). We will also make {Ptet}{rbs.ligase} and {Ptet}{ligase!}. Over-express ligase, lyse cell, and use 1 ul of cell lysate to ligate 2 purified DNA fragments.<br />
<br />
===== '''1.5: Lysozyme, holin, antiholin''' =====<br />
<pre><br />
{promoter}{part}{S-tag}{term}<br />
</pre><br />
Assay for expression of lysozyme, holin, and antiholin. We will want to make measurements of expression levels to collect data for the modeling component, so we will want to use a variety of promoters. Assay will be done using the S-tag.<br />
<br />
==== '''2: Testing if Protein can be Transported to the Periplasm''' ====<br />
<br />
===== '''2.1: PhoA''' =====<br />
<pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}<br />
</pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}. The {rbs}{prepro>} composite part will have the following varients: {rbs}{prepro>}, {rbs~}{a~prepro>}, and {rbs.prepro>}. Note that we will already have the {<phoA!}{term} from the testing of individual prepro parts. The parts that we want to test in this system are: xis, int, ihfA, ihfB, Cre, ligase, BamHI, BglII. See if bugs turn yellow(?) when you induce Pbad. Similar to prepro testing experiments. We may need a {GS linker} between the part and PhoA to have a higher chance of correct folding occurring.<br />
<br />
===== '''2.2: Dicholic Acid to Remove Outer Membrane''' =====<br />
<pre><br />
{pBad}{rbs}{prepro}{part}{term}<br />
{pBad}{rbs}{prepro}{part}{S-tag}{term}<br />
</pre><br />
If the PhoA experiment to test protein transport to the periplasm gives a negative, that does not mean the protein was not transported - the protein may have had side reactions with the PhoA protein. At that point, we will split the parts we are trying to assay into two groups. BamHI, BglII, ligase, and cre can be linking directly to the prepro and assayed for after dissolving the outer membrane, giving parts of the format {pBad}{rbs}{prepro}{part}{term}. xis, int, ihfA, and ihfB will be linked with an S-tag we will by tagging the protein with the S-tag, giving {pBad}{rbs}{prepro}{part}{S-tag}{term}. After inducing our bacteria with arabinose, we remove the outer membrane with dicholic acid, and then assay for actvity of the S-tag.<br />
<br />
=== Part 3 ===<br />
<br />
== Results ==</div>Jinism83http://2008.igem.org/Team:UC_Berkeley/ProjectOverviewTeam:UC Berkeley/ProjectOverview2008-06-19T19:11:39Z<p>Jinism83: /* 1.1: Prepro Parts */</p>
<hr />
<div>__TOC__<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Example_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:UC_Berkeley | Team Example 2]]<br />
|}<br />
<br />
<!--- The Mission, Experiments ---><br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:UC_Berkeley|Home]]<br />
!align="center"|[[Team:UC_Berkeley/Team|The Team]]<br />
!align="center"|[[Team:UC_Berkeley/Project|The Project]]<br />
!align="center"|[[Team:UC_Berkeley/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:UC_Berkeley/Modeling|Modeling]]<br />
!align="center"|[[Team:UC_Berkeley/Notebook|Notebook]]<br />
|}<br />
(''Or you can choose different headings. But you must have a team page, a project page, and a notebook page.'')<br />
<br />
<br />
<br />
== '''Overall project''' ==<br />
<br />
Our project is centered around a system that will allow sound-induced lysis o E. coli.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Project Details==<br />
<br />
=== Part 2 ===<br />
<br />
=== The Experiments ===<br />
<br />
[[Image:phoA_plate.jpg]]<br />
<br />
==== '''1: Testing Individual Composite Parts''' ====<br />
<br />
===== '''1.1: Prepro Parts''' =====<br />
<pre><br />
{promoter}{rbs}{prepro}{phoA}{term}<br />
</pre><br />
We made parts of the format {promoter}{rbs}{prepro}{phoA}{term}. The promoter we used was {pBad}, and we tried 3 different ribosome binding sites with each prepro. We plated the bacteria we transformed on two plates, both with p-nitrophenyl phosphate, but one had arabinose and one did not. We screened successful rbs/prepro combinations by looking for combinations which caused blue colonies on the plate with arabinose and white colonies on the plate without arabinose. In preparation for later composite parts, we made sure that the {rbs}{prepro} part was an intermediate when making our construction tree.<br />
<br />
===== '''1.2: Promoters''' =====<br />
<pre><br />
{promoter}{rbs}{GFP}{term}<br />
intermediate: {rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {promoter}{rbs}{GFP}{term}, where we want to make the last three, {rbs}{GFP}{term}, into one part and test the different OD dependent promoters: hns, spv, bolA, ftsAZ, ftsQ, rrnB P1, and Ptet (as a positive control, which we already have). As a negative control, we will have no promoter. <br><br />
<br />
The experiment involves diluting saturated cultures and growing them at 37 C, take out at the different time points and test the fluorescence to determine at what OD they start to turn on. <br><br />
<br />
'''1.2.1 Sound-dependent Promoter''' <br><br />
<pre><br />
{Psound}{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Psound}{rbs}{GFP}{term}. Grow in culture and apply sound for 30 min. Then measure fluorescence.<br />
<br />
===== '''1.3: Amplifier''' =====<br />
<pre><br />
{Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}<br />
{Pbad}{rbs}{GFP}{term}<br />
intermediates: {spvR}{Pspv2}<br />
{rbs}{GFP}{term}<br />
</pre><br />
Make parts of the format {Pbad}{spvR}{Pspv2}{rbs}{GFP}{term}, where {spvR}{Pspv2} is a composite part, and {rbs}{GFP}{term} is a composite part. For the control, we will have {Pbad}{rbs}{GFP}{term}. We will grow the culture to mid-log, induce w/0.2x arabinose and measure the fluorescence after 1 hour. From this, we will determine how many folds the signal was amplified.<br />
<br />
===== '''1.4: Ligase''' =====<br />
<pre><br />
{Ptet}{rbs}{ligase}{term}<br />
{Ptet}{rbs.ligase}{term}<br />
{Ptet}{ligase!}{term}<br />
</pre><br />
Make parts of the format {Ptet}{rbs}{ligase}{term}, where {Ptet}{rbs} is a composite part(which we already have). We will also make {Ptet}{rbs.ligase} and {Ptet}{ligase!}. Over-express ligase, lyse cell, and use 1 ul of cell lysate to ligate 2 purified DNA fragments.<br />
<br />
===== '''1.5: Lysozyme, holin, antiholin''' =====<br />
<pre><br />
{promoter}{part}{S-tag}{term}<br />
</pre><br />
Assay for expression of lysozyme, holin, and antiholin. We will want to make measurements of expression levels to collect data for the modeling component, so we will want to use a variety of promoters. Assay will be done using the S-tag.<br />
<br />
==== '''2: Testing if Protein can be Transported to the Periplasm''' ====<br />
<br />
===== '''2.1: PhoA''' =====<br />
<pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}<br />
</pre><br />
{Pbad}{rbs}{prepro>}{<part>}{<phoA!}{term}. The {rbs}{prepro>} composite part will have the following varients: {rbs}{prepro>}, {rbs~}{a~prepro>}, and {rbs.prepro>}. Note that we will already have the {<phoA!}{term} from the testing of individual prepro parts. The parts that we want to test in this system are: xis, int, ihfA, ihfB, Cre, ligase, BamHI, BglII. See if bugs turn yellow(?) when you induce Pbad. Similar to prepro testing experiments. We may need a {GS linker} between the part and PhoA to have a higher chance of correct folding occurring.<br />
<br />
===== '''2.2: Dicholic Acid to Remove Outer Membrane''' =====<br />
<pre><br />
{pBad}{rbs}{prepro}{part}{term}<br />
{pBad}{rbs}{prepro}{part}{S-tag}{term}<br />
</pre><br />
If the PhoA experiment to test protein transport to the periplasm gives a negative, that does not mean the protein was not transported - the protein may have had side reactions with the PhoA protein. At that point, we will split the parts we are trying to assay into two groups. BamHI, BglII, ligase, and cre can be linking directly to the prepro and assayed for after dissolving the outer membrane, giving parts of the format {pBad}{rbs}{prepro}{part}{term}. xis, int, ihfA, and ihfB will be linked with an S-tag we will by tagging the protein with the S-tag, giving {pBad}{rbs}{prepro}{part}{S-tag}{term}. After inducing our bacteria with arabinose, we remove the outer membrane with dicholic acid, and then assay for actvity of the S-tag.<br />
<br />
=== Part 3 ===<br />
<br />
== Results ==</div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/Molly_constructionTemplate:Team:UC Berkeley/Notebook/Molly construction2008-06-13T19:32:41Z<p>Jinism83: </p>
<hr />
<div>== Molly's Construction Files ==<br />
<br />
<pre><br />
Construction of {xis!} Biobrick Part K112200<br />
PCR mea001/mea002 on pAH57 (230 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112200<br />
----------------------------------------<br />
mea001 Forward Biobricking of {xis!} ccataGAATTCatgAGATCTatgtacttgacacttcaggag<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {<xis!} Biobrick Part K112201<br />
PCR mea003/mea002 on pAH57 (227 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112201<br />
----------------------------------------<br />
mea003 Forward Biobricking of {<xis!} ccataGAATTCatgAGATCTtacttgacacttcaggagtg<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {xis>} Biobrick Part K112202<br />
PCR mea001/mea004 on pAH57 (227 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112202<br />
----------------------------------------<br />
mea001 Forward Biobricking of {xis!} ccataGAATTCatgAGATCTatgtacttgacacttcaggag<br />
mea004 Reverse Biobricking of {xis>} cgttaGGATCCtgacttcgccttcttcccatttc<br />
</pre><br />
<br />
<pre><br />
Construction of {<xis>} Biobrick Part K112203<br />
PCR mea003/mea004 on pAH57 (224 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112203<br />
----------------------------------------<br />
mea003 Forward Biobricking of {<xis!} ccataGAATTCatgAGATCTtacttgacacttcaggagtg<br />
mea004 Reverse Biobricking of {xis>} cgttaGGATCCtgacttcgccttcttcccatttc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~xis!} Biobrick Part K112204<br />
PCR mea017/mea002 on pAH57 (234 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112204<br />
----------------------------------------<br />
mea017 Forward Biobricking of {a~xis!}ccagtGAATTCatgAGATCTtgcgatgtacttgacacttcagg<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.xis!} Biobrick Part K112205<br />
PCR mea018/mea002 on pAH57 (249 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112205<br />
----------------------------------------<br />
mea018 Forward Biobricking of {rbs.xis!}ccagtGAATTCatgAGATCTtaattgcggagactttgcgatg<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {int!} Biobrick Part K112207<br />
PCR mea005/mea006 on pAH57 (1102 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112207<br />
----------------------------------------<br />
mea005 Forward Biobricking of {int!} ccataGAATTCatgAGATCTatgggaagaaggcgaagtcatg<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {<int!} Biobrick Part K112208<br />
PCR mea007/mea006 on pAH57 (1099 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112208<br />
----------------------------------------<br />
mea007 Forward Biobricking of {<int!} ccataGAATTCatgAGATCTggaagaaggcgaagtcatgagc<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {int>} Biobrick Part K112209<br />
PCR mea005/mea008 on pAH57 (1099 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112209<br />
----------------------------------------<br />
mea005 Forward Biobricking of {int!} ccataGAATTCatgAGATCTatgggaagaaggcgaagtcatg<br />
mea008 Reverse Biobricking of {int>} cgttaGGATCCtttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {<int>} Biobrick Part K112210<br />
PCR mea007/mea008 on pAH57 (1096 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112210<br />
----------------------------------------<br />
mea007 Forward Biobricking of {<int!} ccataGAATTCatgAGATCTggaagaaggcgaagtcatgagc<br />
mea008 Reverse Biobricking of {int>} cgttaGGATCCtttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~int!} Biobrick Part K112211<br />
PCR mea019/mea006 on pAH57 (1106 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112211<br />
----------------------------------------<br />
mea019 Forward Biobricking of {a~int!}ccataGAATTCatgAGATCTagaaatgggaagaaggcgaag<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.int!} Biobrick Part K112212<br />
PCR mea020/mea006 on pAH57 (1120 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112212<br />
----------------------------------------<br />
mea020 Forward Biobricking of {rbs.int!}ccataGAATTCatgAGATCTttttgaagaggatcagaaatggg<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfA!} Biobrick Part K112213<br />
PCR mea009/mea010 on MG1655 (331 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112213<br />
----------------------------------------<br />
mea009 Forward Biobricking of {ihfA!}ccataGAATTCatgAGATCTatggcgcttacaaaagctgaaatg<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfA!} Biobrick Part K112214<br />
PCR mea011/mea010 on MG1655 (328 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112214<br />
----------------------------------------<br />
mea011 Forward Biobricking of {<ihfA!}ccataGAATTCatgAGATCTgcgcttacaaaagctgaaatgtc<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfA>} Biobrick Part K112215<br />
PCR mea009/mea012 on MG1655 (328 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112215<br />
----------------------------------------<br />
mea009 Forward Biobricking of {ihfA!}ccataGAATTCatgAGATCTatggcgcttacaaaagctgaaatg<br />
mea012 Reverse Biobricking of {ihfA>} cgttaGGATCCctcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfA>} Biobrick Part K112216<br />
PCR mea011/mea012 on MG1655 (325 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112216<br />
----------------------------------------<br />
mea011 Forward Biobricking of {<ihfA!}ccataGAATTCatgAGATCTgcgcttacaaaagctgaaatgtc<br />
mea012 Reverse Biobricking of {ihfA>} cgttaGGATCCctcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {a~ihfA!} Biobrick Part K112217<br />
PCR mea021/mea010 on MG1655 (335 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112217<br />
----------------------------------------<br />
mea021 Forward Biobricking of {a~ihfA!}ccataGAATTCatgAGATCTacctatggcgcttacaaaagc<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.ihfA!} Biobrick Part K112218<br />
PCR mea022/mea010 on MG1655 (350 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112218<br />
----------------------------------------<br />
mea022 Forward Biobricking of {rbs.ihfA!}ccataGAATTCatgAGATCTtcattgagggattgaacctatggcgc<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfB!} Biobrick Part K112219<br />
PCR mea013/mea014 on MG1655 (316 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112219<br />
----------------------------------------<br />
mea013 Forward Biobricking of {ihfB!} ccataGAATTCatgAGATCTatgaccaagtcagaattgatagaaagacttgccaccc<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfB!} Biobrick Part K112220<br />
PCR mea015/mea014 on MG1655 (313 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112220<br />
----------------------------------------<br />
mea015 Forward Biobricking of {<ihfB!} ccataGAATTCatgAGATCTaccaagtcagaattgatagaaagacttgccaccc<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfB>} Biobrick Part K112221<br />
PCR mea013/mea016 on MG1655 (313 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112221<br />
----------------------------------------<br />
mea013 Forward Biobricking of {ihfB!} ccataGAATTCatgAGATCTatgaccaagtcagaattgatagaaagacttgccaccc<br />
mea016 Reverse Biobricking of {ihfB>} cgttaGGATCCaccgtaaatattggcgcgatc<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfB>} Biobrick Part K112222<br />
PCR mea015/mea016 on MG1655 (310 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112222<br />
----------------------------------------<br />
mea015 Forward Biobricking of {<ihfB!} ccataGAATTCatgAGATCTaccaagtcagaattgatagaaagacttgccaccc<br />
mea016 Reverse Biobricking of {ihfB>} cgttaGGATCCaccgtaaatattggcgcgatc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~ihfB!} Biobrick Part K112223<br />
PCR mea023/mea014 on MG1655 (320 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112223<br />
----------------------------------------<br />
mea023 Forward Biobricking of {a~ihfB!}ccataGAATTCatgAGATCTaatcatgaccaagtcagaattgatag<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.ihfB!} Biobrick Part K112224<br />
PCR mea024/mea014 on MG1655 (337 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112224<br />
----------------------------------------<br />
mea024 Forward Biobricking of {rbs.ihfB!}ccataGAATTCatgAGATCTctttaaggaaccggaggaatcatg<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ompT>} Biobrick Part K112225<br />
Wobble PCR mea025/mea026 (97 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112225<br />
----------------------------------------<br />
mea025 Forward Biobricking of {ompT>} cgataGAATTCatgAGATCTatgcgggcgaaactcctaggaatagtcctgacaacccctatcg<br />
mea026 Reverse Biobricking of {ompT>} cgttaGGATCCcgtcgacgcaaaagagctgatcgcgataggggttgtcaggactattc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~ompT} Biobrick Part K112226<br />
Wobble PCR mea027/mea026 (101 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112226<br />
----------------------------------------<br />
mea027 Forward Biobricking of {a~ompT} cgataGAATTCatgAGATCTacatatgcgggcgaaactcctaggaatagtcctgacaacccctatc<br />
mea026 Reverse Biobricking of {ompT>} cgttaGGATCCcgtcgacgcaaaagagctgatcgcgataggggttgtcaggactattc<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.ompT} Biobrick Part K112227<br />
Wobble PCR mea028/mea026 (114 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112227<br />
----------------------------------------<br />
mea028 Forward Biobricking of {rbs.ompT}cgataGAATTCatgAGATCTaagaaggagatatacatatgcgggcgaaactcctaggaatagtcctgacaacccc<br />
mea026 Reverse Biobricking of {ompT>} cgttaGGATCCcgtcgacgcaaaagagctgatcgcgataggggttgtcaggactattc<br />
</pre><br />
<br />
<pre><br />
Construction of {pelB>} Biobrick Part K112228<br />
Wobble PCR mea029/mea030 (97 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112228<br />
----------------------------------------<br />
mea029 Forward Biobricking of {pelB>} cgataGAATTCatgAGATCTatgaaatacctgctgccgaccgctgctgctggtctgctgctcc<br />
mea030 Reverse Biobricking of {pelB>} cgttaGGATCCggccatcgccggctgggcagcgaggagcagcagaccagcagcagcgg<br />
</pre><br />
<br />
<pre><br />
Construction of {a~pelB} Biobrick Part K112229<br />
Wobble PCR mea031/mea030 (101 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112229<br />
----------------------------------------<br />
mea031 Forward Biobricking of {a~pelB} cgataGAATTCatgAGATCTacatatgaaatacctgctgccgaccgctgctgctggtctgctg<br />
mea030 Reverse Biobricking of {pelB>} cgttaGGATCCggccatcgccggctgggcagcgaggagcagcagaccagcagcagcgg<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.pelB} Biobrick Part K112230<br />
Wobble PCR mea032/mea030 (116 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112230<br />
----------------------------------------<br />
mea032 Forward Biobricking of {rbs.pelB} cgataGAATTCatgAGATCTttaagaaggagatatacatatgaaatacctgctgccgaccgctgctgctggtctgctg<br />
mea030 Reverse Biobricking of {pelB>} cgttaGGATCCggccatcgccggctgggcagcgaggagcagcagaccagcagcagcgg<br />
</pre><br />
<br />
[[Team:UC_Berkeley/Notebook/Molly_Allen|Molly's Notebook]]<br></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/Molly_constructionTemplate:Team:UC Berkeley/Notebook/Molly construction2008-06-13T19:32:09Z<p>Jinism83: </p>
<hr />
<div>== Molly's Construction Files ==<br />
<br />
<pre><br />
Construction of {xis!} Biobrick Part K112200<br />
PCR mea001/mea002 on pAH57 (230 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112200<br />
----------------------------------------<br />
mea001 Forward Biobricking of {xis!} ccataGAATTCatgAGATCTatgtacttgacacttcaggag<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {<xis!} Biobrick Part K112201<br />
PCR mea003/mea002 on pAH57 (227 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112201<br />
----------------------------------------<br />
mea003 Forward Biobricking of {<xis!} ccataGAATTCatgAGATCTtacttgacacttcaggagtg<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {xis>} Biobrick Part K112202<br />
PCR mea001/mea004 on pAH57 (227 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112202<br />
----------------------------------------<br />
mea001 Forward Biobricking of {xis!} ccataGAATTCatgAGATCTatgtacttgacacttcaggag<br />
mea004 Reverse Biobricking of {xis>} cgttaGGATCCtgacttcgccttcttcccatttc<br />
</pre><br />
<br />
<pre><br />
Construction of {<xis>} Biobrick Part K112203<br />
PCR mea003/mea004 on pAH57 (224 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112203<br />
----------------------------------------<br />
mea003 Forward Biobricking of {<xis!} ccataGAATTCatgAGATCTtacttgacacttcaggagtg<br />
mea004 Reverse Biobricking of {xis>} cgttaGGATCCtgacttcgccttcttcccatttc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~xis!} Biobrick Part K112204<br />
PCR mea017/mea002 on pAH57 (234 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112204<br />
----------------------------------------<br />
mea017 Forward Biobricking of {a~xis!}ccagtGAATTCatgAGATCTtgcgatgtacttgacacttcagg<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.xis!} Biobrick Part K112205<br />
PCR mea018/mea002 on pAH57 (249 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112205<br />
----------------------------------------<br />
mea018 Forward Biobricking of {rbs.xis!}ccataGAATTCatgAGATCTtaattgcggagactttgcgatg<br />
mea002 Reverse Biobricking of {xis!} cgttaGGATCCtcatgacttcgccttcttcccc<br />
</pre><br />
<br />
<pre><br />
Construction of {int!} Biobrick Part K112207<br />
PCR mea005/mea006 on pAH57 (1102 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112207<br />
----------------------------------------<br />
mea005 Forward Biobricking of {int!} ccataGAATTCatgAGATCTatgggaagaaggcgaagtcatg<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {<int!} Biobrick Part K112208<br />
PCR mea007/mea006 on pAH57 (1099 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112208<br />
----------------------------------------<br />
mea007 Forward Biobricking of {<int!} ccataGAATTCatgAGATCTggaagaaggcgaagtcatgagc<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {int>} Biobrick Part K112209<br />
PCR mea005/mea008 on pAH57 (1099 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112209<br />
----------------------------------------<br />
mea005 Forward Biobricking of {int!} ccataGAATTCatgAGATCTatgggaagaaggcgaagtcatg<br />
mea008 Reverse Biobricking of {int>} cgttaGGATCCtttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {<int>} Biobrick Part K112210<br />
PCR mea007/mea008 on pAH57 (1096 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112210<br />
----------------------------------------<br />
mea007 Forward Biobricking of {<int!} ccataGAATTCatgAGATCTggaagaaggcgaagtcatgagc<br />
mea008 Reverse Biobricking of {int>} cgttaGGATCCtttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~int!} Biobrick Part K112211<br />
PCR mea019/mea006 on pAH57 (1106 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112211<br />
----------------------------------------<br />
mea019 Forward Biobricking of {a~int!}ccataGAATTCatgAGATCTagaaatgggaagaaggcgaag<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.int!} Biobrick Part K112212<br />
PCR mea020/mea006 on pAH57 (1120 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112212<br />
----------------------------------------<br />
mea020 Forward Biobricking of {rbs.int!}ccataGAATTCatgAGATCTttttgaagaggatcagaaatggg<br />
mea006 Reverse Biobricking of {int!} cgttaGGATCCttatttgatttcaattttgtcccactccc<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfA!} Biobrick Part K112213<br />
PCR mea009/mea010 on MG1655 (331 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112213<br />
----------------------------------------<br />
mea009 Forward Biobricking of {ihfA!}ccataGAATTCatgAGATCTatggcgcttacaaaagctgaaatg<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfA!} Biobrick Part K112214<br />
PCR mea011/mea010 on MG1655 (328 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112214<br />
----------------------------------------<br />
mea011 Forward Biobricking of {<ihfA!}ccataGAATTCatgAGATCTgcgcttacaaaagctgaaatgtc<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfA>} Biobrick Part K112215<br />
PCR mea009/mea012 on MG1655 (328 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112215<br />
----------------------------------------<br />
mea009 Forward Biobricking of {ihfA!}ccataGAATTCatgAGATCTatggcgcttacaaaagctgaaatg<br />
mea012 Reverse Biobricking of {ihfA>} cgttaGGATCCctcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfA>} Biobrick Part K112216<br />
PCR mea011/mea012 on MG1655 (325 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112216<br />
----------------------------------------<br />
mea011 Forward Biobricking of {<ihfA!}ccataGAATTCatgAGATCTgcgcttacaaaagctgaaatgtc<br />
mea012 Reverse Biobricking of {ihfA>} cgttaGGATCCctcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {a~ihfA!} Biobrick Part K112217<br />
PCR mea021/mea010 on MG1655 (335 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112217<br />
----------------------------------------<br />
mea021 Forward Biobricking of {a~ihfA!}ccataGAATTCatgAGATCTacctatggcgcttacaaaagc<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.ihfA!} Biobrick Part K112218<br />
PCR mea022/mea010 on MG1655 (350 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112218<br />
----------------------------------------<br />
mea022 Forward Biobricking of {rbs.ihfA!}ccataGAATTCatgAGATCTtcattgagggattgaacctatggcgc<br />
mea010 Reverse Biobricking of {ihfA!} cgttaGGATCCttactcgtctttgggcgaagcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfB!} Biobrick Part K112219<br />
PCR mea013/mea014 on MG1655 (316 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112219<br />
----------------------------------------<br />
mea013 Forward Biobricking of {ihfB!} ccataGAATTCatgAGATCTatgaccaagtcagaattgatagaaagacttgccaccc<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfB!} Biobrick Part K112220<br />
PCR mea015/mea014 on MG1655 (313 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112220<br />
----------------------------------------<br />
mea015 Forward Biobricking of {<ihfB!} ccataGAATTCatgAGATCTaccaagtcagaattgatagaaagacttgccaccc<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ihfB>} Biobrick Part K112221<br />
PCR mea013/mea016 on MG1655 (313 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112221<br />
----------------------------------------<br />
mea013 Forward Biobricking of {ihfB!} ccataGAATTCatgAGATCTatgaccaagtcagaattgatagaaagacttgccaccc<br />
mea016 Reverse Biobricking of {ihfB>} cgttaGGATCCaccgtaaatattggcgcgatc<br />
</pre><br />
<br />
<pre><br />
Construction of {<ihfB>} Biobrick Part K112222<br />
PCR mea015/mea016 on MG1655 (310 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112222<br />
----------------------------------------<br />
mea015 Forward Biobricking of {<ihfB!} ccataGAATTCatgAGATCTaccaagtcagaattgatagaaagacttgccaccc<br />
mea016 Reverse Biobricking of {ihfB>} cgttaGGATCCaccgtaaatattggcgcgatc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~ihfB!} Biobrick Part K112223<br />
PCR mea023/mea014 on MG1655 (320 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112223<br />
----------------------------------------<br />
mea023 Forward Biobricking of {a~ihfB!}ccataGAATTCatgAGATCTaatcatgaccaagtcagaattgatag<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.ihfB!} Biobrick Part K112224<br />
PCR mea024/mea014 on MG1655 (337 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112224<br />
----------------------------------------<br />
mea024 Forward Biobricking of {rbs.ihfB!}ccataGAATTCatgAGATCTctttaaggaaccggaggaatcatg<br />
mea014 Reverse Biobricking of {ihfB!} cgttaGGATCCttaaccgtaaatattggcgcgatcg<br />
</pre><br />
<br />
<pre><br />
Construction of {ompT>} Biobrick Part K112225<br />
Wobble PCR mea025/mea026 (97 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112225<br />
----------------------------------------<br />
mea025 Forward Biobricking of {ompT>} cgataGAATTCatgAGATCTatgcgggcgaaactcctaggaatagtcctgacaacccctatcg<br />
mea026 Reverse Biobricking of {ompT>} cgttaGGATCCcgtcgacgcaaaagagctgatcgcgataggggttgtcaggactattc<br />
</pre><br />
<br />
<pre><br />
Construction of {a~ompT} Biobrick Part K112226<br />
Wobble PCR mea027/mea026 (101 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112226<br />
----------------------------------------<br />
mea027 Forward Biobricking of {a~ompT} cgataGAATTCatgAGATCTacatatgcgggcgaaactcctaggaatagtcctgacaacccctatc<br />
mea026 Reverse Biobricking of {ompT>} cgttaGGATCCcgtcgacgcaaaagagctgatcgcgataggggttgtcaggactattc<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.ompT} Biobrick Part K112227<br />
Wobble PCR mea028/mea026 (114 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112227<br />
----------------------------------------<br />
mea028 Forward Biobricking of {rbs.ompT}cgataGAATTCatgAGATCTaagaaggagatatacatatgcgggcgaaactcctaggaatagtcctgacaacccc<br />
mea026 Reverse Biobricking of {ompT>} cgttaGGATCCcgtcgacgcaaaagagctgatcgcgataggggttgtcaggactattc<br />
</pre><br />
<br />
<pre><br />
Construction of {pelB>} Biobrick Part K112228<br />
Wobble PCR mea029/mea030 (97 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112228<br />
----------------------------------------<br />
mea029 Forward Biobricking of {pelB>} cgataGAATTCatgAGATCTatgaaatacctgctgccgaccgctgctgctggtctgctgctcc<br />
mea030 Reverse Biobricking of {pelB>} cgttaGGATCCggccatcgccggctgggcagcgaggagcagcagaccagcagcagcgg<br />
</pre><br />
<br />
<pre><br />
Construction of {a~pelB} Biobrick Part K112229<br />
Wobble PCR mea031/mea030 (101 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112229<br />
----------------------------------------<br />
mea031 Forward Biobricking of {a~pelB} cgataGAATTCatgAGATCTacatatgaaatacctgctgccgaccgctgctgctggtctgctg<br />
mea030 Reverse Biobricking of {pelB>} cgttaGGATCCggccatcgccggctgggcagcgaggagcagcagaccagcagcagcgg<br />
</pre><br />
<br />
<pre><br />
Construction of {rbs.pelB} Biobrick Part K112230<br />
Wobble PCR mea032/mea030 (116 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)<br />
Product is pBca1256-K112230<br />
----------------------------------------<br />
mea032 Forward Biobricking of {rbs.pelB} cgataGAATTCatgAGATCTttaagaaggagatatacatatgaaatacctgctgccgaccgctgctgctggtctgctg<br />
mea030 Reverse Biobricking of {pelB>} cgttaGGATCCggccatcgccggctgggcagcgaggagcagcagaccagcagcagcgg<br />
</pre><br />
<br />
[[Team:UC_Berkeley/Notebook/Molly_Allen|Molly's Notebook]]<br></div>Jinism83http://2008.igem.org/Template:Team:UC_Berkeley/Notebook/DV_constructionTemplate:Team:UC Berkeley/Notebook/DV construction2008-06-12T19:18:50Z<p>Jinism83: /* K112710 */</p>
<hr />
<div>__TOC__<br />
<br />
==K112701==<br />
<pre><br />
Construction of [<Phns>] Basic Part K112701<br />
<br />
PCR dv001/dv006 on Phns from E. coli K12 MG1655 (150 bp, gp = A)<br />
PCR dv005/dv003 on Phns from E. coli K12 MG1655 (225 bp, gp = B)<br />
PCR dv004/dv002 on Phns from E. coli K12 MG1655 (342 bp, gp = C)<br />
---------------------------------------------------<br />
PCR dv001/dv003 on A+B (355 bp, gp = D)<br />
---------------------------------------------------<br />
PCR dv001/dv002 on C+D (697bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+697)<br />
Product is pBca1256-K112701<br />
-----------------------------------------------<br />
dv001 Forward Biobricking of [<Phns>] CgATAgaattcATGagatctGAAATATAGCTGTGCCATCAGCC<br />
dv002 Reverse Biobricking of [<Phns>] cagtcggatccGCACGAAGAGTACGGATG<br />
dv003 Removing the 2nd EcoRI site in [<Phns>] (R) GCCAGGAATGTAAGGgATTCAAAATTGTTC<br />
dv004 Removing the 2ND EcoRI site in [<Phns>] (F) GAACAATTTTGAATcCCTTACATTCCTGGC<br />
dv005 Removing the FIRST EcoRI site in [<Phns>] (F)CGCTTAATAGGGgATTCTCGTAAACAC<br />
dv006 Removing the FIRST EcoRI site in [<Phns>] (R)GTGTTTACGAGAATcCCCTATTAAGCG<br />
</pre><br />
<br />
==K112703==<br />
<pre><br />
Construction of His-Tag> basic part K112703<br />
<br />
Mix dv009/dv010 (41bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+41, L)<br />
Product is pBca1256-K112703<br />
-----------------------------------------------<br />
dv009 Forward Biobricking of His-Tag><br />
cgataGAATTCatgAGATCTatgCATCATCATCATCATCATGGATCCtaacg<br />
<br />
dv010 Reverse Biobricking of His-Tag><br />
cgttaGGATCCATGATGATGATGATGATGcatAGATCTcatGAATTCtatgg<br />
</pre><br />
<br />
==K112704==<br />
<pre><br />
Construction of <S-tag! basic part K112704<br />
<br />
Wobble PCR of dv011/dv012 (60 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI)<br />
Product is pBca1256-K112704<br />
----------------------------------------<br />
dv011 Forward Biobricking of <S-Tag!<br />
cgataGAATTCatgAGATCTaaagaaaccgctgctgctaaattcgaacgcc<br />
<br />
dv012 Reverse Biobricking of <S-Tag!<br />
cgttaGGATCCttagctgtccatgtgctggcgttcgaatttagcagc<br />
</pre><br />
<br />
==K112705==<br />
<pre><br />
Construction of S-tag> basic part K112705<br />
<br />
Wobble PCR dv013/dv014 (47 bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+47, L)<br />
Product is pBca1256-K112705<br />
-----------------------------------------------<br />
dv013 Forward Biobricking of S-Tag><br />
cgataGAATTCatgAGATCTatgaaagaaaccgctgctgctaaattcg<br />
dv014 Reverse Biobricking of S-Tag><br />
cgttaGGATCCgctgtccatgtgctggcgttcgaatttagcagcagcgg<br />
</pre><br />
<br />
==K112706==<br />
<pre><br />
Construction of <Pspv2> basic part K112706<br />
<br />
PCR of dv015/dv016 on pBca1037 (500bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+ 500, L)<br />
Product is pBca1256-K112706<br />
-----------------------------------------------<br />
dv015 Forward biobricking of <Pspv2><br />
cgataGAATTCatgAGATCTccttatgcagcgtaagggccgcaac<br />
<br />
dv016 Reverse biobricking of <Pspv2><br />
cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG<br />
</pre><br />
<br />
==K112707==<br />
<pre><br />
Construction of <Pspv> basic part K112707<br />
<br />
PCR of dv017/dv016 on pBca1037 (499bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+499, L)<br />
Product is pBca1256-K112707<br />
-----------------------------------------------<br />
dv017 Forward biobricking of <Pspv><br />
cgataGAATTCatgAGATCTaGATCCTGTGATGTTTGGCG<br />
<br />
dv016 Reverse biobricking of <Pspv><br />
cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG<br />
</pre><br />
<br />
==K112708==<br />
<pre><br />
Construction of <PfhuA> basic part K112708<br />
<br />
PCR of dv019/dv020 on MG1655 (225bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+225, L)<br />
Product is pBca1256-K112708<br />
-----------------------------------------------<br />
dv019 Forward biobricking of <PfhuA> <br />
cgataGAATTCatgAGATCTgctaagcgtgaaataccggatgg<br />
<br />
dv020 Reverse biobricking of <PfhuA><br />
cgttaGGATCCactctgatgtaaagtgaatgataacg<br />
<br />
<br />
</pre><br />
<br />
==K112709==<br />
<pre><br />
Construction of <b1006> basic part K112709<br />
<br />
Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+66, L)<br />
Product is pBca1256-K112709<br />
-----------------------------------------------<br />
dv021 Forward biobricking of b1006<br />
cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg<br />
<br />
dv022 Reverse biobricking of b1006<br />
GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt<br />
</pre><br />
<br />
==K112710==<br />
<pre><br />
Construction of <Bca1041> basic part K112710<br />
<br />
PCR of dv023/dv024 pSB1AG0-Bca1041 (122bp, EcoRI/BamHI/DpnI)<br />
Sub into pBca1256 (EcoRI/BamHI, 2472+122, L)<br />
Product is pBca1256-K112710<br />
-----------------------------------------------<br />
dv023 Forward biobricking of Bca1041<br />
cgataGAATTCatgAGATCTgCcggcttatcGgtcagtttc<br />
<br />
<br />
dv024 Reverse biobricking of Bca1041<br />
cgttaGGATCCatttcttttgggtatagcgtcgtgg<br />
<br />
</pre></div>Jinism83