http://2008.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=500&target=Sstcheung&year=&month=2008.igem.org - User contributions [en]2024-03-29T01:52:08ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/Team:UC_Berkeley/Team/Sherene_CheungTeam:UC Berkeley/Team/Sherene Cheung2008-10-22T06:25:31Z<p>Sstcheung: </p>
<hr />
<div>[[Image:ShereneCheungOfficial.png|250 px]]<br />
<br />
'''MY NAME/NICKNAME'''<br />
<br />
Sherine Cheung; The Purifier (since, purification was my specialty for a while...)<br />
<br />
'''MY STATS'''<br />
<br />
High school senior at Fortress Hill Academy<br />
<br />
'''WHAT LED ME TO SYNTHETIC BIOLOGY'''<br />
<br />
I first heard about synthetic biology at a biotech camp I attended in summer 2007. The creativity and potential of synthetic biology really fascinated me, and since then, I've kept my eyes and ears open on the subject!<br />
<br />
'''SYNTHETIC BIOLOGY: IN MY WORDS'''<br />
<br />
In synthetic biology, one takes a natural, existing organism (yay, E. coli!) and modifies it so that it can perform a non-natural, but useful task at human command.<br />
<br />
In terms of what we do daily in the lab: everyday day in the lab is different; in fact, your plans can change EVERY hour (and you can be accused of being unkind to the planet by wasting a lot of paper scribbling, re-scribbling, and re-re-scribbling plans for the day). It all depends on whether your experiment is in the mood to cooperate with you or not.<br />
The general order of events:<br />
1.) We hope (with good scientific reasoning) that the experiment cooperates.<br />
2.) Then, when it doesn't cooperate, we stop, back-track and try to fix things so that it DOES cooperate – sooner or later.<br />
3.) Sometimes, we get stuck in repeating step 2.<br />
4.) When it works...we're elated!<br />
<br />
Sometimes, it causes one to wonder if we are actually modifying the organism, or if, in actuality, it is more believable to say that the organism is modifying us...<br />
<br />
'''MY POSSIBLE FUTURE WITH SYNTHETIC BIOLOGY'''<br />
<br />
Were I to continue into synthetic biology, I would love to explore synthetic biology's medical uses.<br />
<br />
'''MY GOALS WITH IGEM'''<br />
<br />
After hearing/reading descriptions of synthetic biology projects, I really wanted to see how a project was done in real life. Most often, you hear about the finished product of a research project, and how wonderful it is; but you hardly ever get to see the entire research process from beginning to end. Second hand information about a given project is great, but<br />
the first hand experience I get with iGEM is quite thrilling and altogether, different. It's helped me put the puzzle pieces together -- from planning steps to finished product; and, of course everything exciting in between!<br />
<br />
'''MY FAVORITE DNA SEQUENCE'''<br />
<br />
The phoA prepros are my all-time favorite. I've gotten quite acquainted with them, having made/remade them 3 or 4 times. Even one base pairs' worth of imperfection in any of my prepros will have me on edge -- such is the strength of my emotional attachment to said prepros.<br />
<br />
'''MY DUMBEST LAB MISTAKE/COMPUTATIONAL ERROR'''<br />
<br />
When I was flaming the foil covering a set of PCR tubes to sterilize it, the tip of the bunsen burner flame touched a nearby stash of Kimwipes, setting them ablaze.<br />
But, I believe my mistake is totally justified, since fire makes everything better.<br />
<br />
'''MY FAVORITE CHILDHOOD CARTOON'''<br />
<br />
Tom and Jerry!!<br />
<br />
'''MY FAVORITE FOOD'''<br />
<br />
Sushi and any type of soup-noodle!</div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/Notebook/Sherine_CheungTeam:UC Berkeley/Notebook/Sherine Cheung2008-10-19T04:10:13Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:blue;font-size:15.0pt' align="center"><br />
<div style="text-align: center;"> <u>Welcome to Sherine's iGEM Notebook!</u></div><br />
</span><br />
<br />
<span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
[[Template:Team:UC Berkeley/Notebook/SC_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_Asequencing | Sherine/Cici's Assemblies Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_construction | My Construction Files]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_notes| My Notes (6/23/08 to 7/31/08)]]<br><br />
[[My Notes II | My Notes (8/01/08 to 8/24/08)]]<br />
<br />
[[Methods and Materials]]<br />
<br />
[[Assembly Related Protocols]]<br />
<br />
<br />
----<br />
<br />
<div style="text-align: center;"> [[Team:UC_Berkeley|UC Berkeley Team Homepage]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/Notebook/Sherine_CheungTeam:UC Berkeley/Notebook/Sherine Cheung2008-10-19T04:09:55Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:blue;font-size:15.0pt' align="center"><br />
<div style="text-align: center;"> <u>Welcome to Sherine's iGEM Notebook!</u></div><br />
</span><br />
<br />
<span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
[[Template:Team:UC Berkeley/Notebook/SC_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_Asequencing | Sherine/Cici's Assemblies Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_construction | My Construction Files]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_notes| My Notes (6/23/08 to 7/31/08)]]<br><br />
[[My Notes II | My Notes (8/01/08 to 8/24/08)]]<br />
[[Methods and Materials]]<br />
[[Assembly Related Protocols]]<br />
<br />
<br />
----<br />
<br />
<div style="text-align: center;"> [[Team:UC_Berkeley|UC Berkeley Team Homepage]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Methods_and_MaterialsMethods and Materials2008-10-19T04:09:08Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century Gothic; font-size: 10pt"><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
<br />
<br />
== Making Parts Sca40-Sca43 ==<br />
<br />
For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
* Sca22: {<AP!}.{b1006}<br />
* Sca23: {<HA!}.{b1006}<br />
* Sca24: {<myc!}.{b1006}<br />
* Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
'''1. Modifying AKL41'''<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
<br />
'''2. Assembling Sca parts with the PCR product'''<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Methods_and_MaterialsMethods and Materials2008-10-19T04:08:35Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century Gothic; font-size: 10pt"><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== Making Parts Sca40-Sca43 ==<br />
<br />
For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
* Sca22: {<AP!}.{b1006}<br />
* Sca23: {<HA!}.{b1006}<br />
* Sca24: {<myc!}.{b1006}<br />
* Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
'''1. Modifying AKL41'''<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
<br />
'''2. Assembling Sca parts with the PCR product'''<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Methods_and_MaterialsMethods and Materials2008-10-19T04:06:59Z<p>Sstcheung: </p>
<hr />
<div>== Making Parts Sca40-Sca43 ==<br />
<br />
For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
* Sca22: {<AP!}.{b1006}<br />
* Sca23: {<HA!}.{b1006}<br />
* Sca24: {<myc!}.{b1006}<br />
* Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
'''1. Modifying AKL41'''<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
<br />
'''2. Assembling Sca parts with the PCR product'''<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Methods_and_MaterialsMethods and Materials2008-10-19T04:06:38Z<p>Sstcheung: New page: == Making Parts Sca40-Sca43 == For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. ...</p>
<hr />
<div><br />
== Making Parts Sca40-Sca43 ==<br />
<br />
For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
* Sca22: {<AP!}.{b1006}<br />
* Sca23: {<HA!}.{b1006}<br />
* Sca24: {<myc!}.{b1006}<br />
* Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
'''1. Modifying AKL41'''<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
'''2. Assembling Sca parts with the PCR product'''<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/Notebook/Sherine_CheungTeam:UC Berkeley/Notebook/Sherine Cheung2008-10-19T04:05:03Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:blue;font-size:15.0pt' align="center"><br />
<div style="text-align: center;"> <u>Welcome to Sherine's iGEM Notebook!</u></div><br />
</span><br />
<br />
<span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
[[Template:Team:UC Berkeley/Notebook/SC_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_Asequencing | Sherine/Cici's Assemblies Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_construction | My Construction Files]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_notes| My Notes (6/23/08 to 7/31/08)]]<br><br />
[[My Notes II | My Notes (8/01/08 to 8/24/08)]]<br />
<br />
[[Methods and Materials - Making Parts Sca40-Sca43]]<br />
<br />
[[Methods and Materials]]<br />
<br />
[[Assembly Related Protocols]]<br />
<br />
<br />
----<br />
<br />
<div style="text-align: center;"> [[Team:UC_Berkeley|UC Berkeley Team Homepage]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Methods_and_Materials_-_Making_Parts_Sca40-Sca43Methods and Materials - Making Parts Sca40-Sca432008-10-19T04:02:10Z<p>Sstcheung: </p>
<hr />
<div>For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
* Sca22: {<AP!}.{b1006}<br />
* Sca23: {<HA!}.{b1006}<br />
* Sca24: {<myc!}.{b1006}<br />
* Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
'''1. Modifying AKL41'''<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
'''2. Assembling Sca parts with the PCR product'''<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Methods_and_Materials_-_Making_Parts_Sca40-Sca43Methods and Materials - Making Parts Sca40-Sca432008-10-19T04:01:19Z<p>Sstcheung: </p>
<hr />
<div>For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
* Sca22: {<AP!}.{b1006}<br />
* Sca23: {<HA!}.{b1006}<br />
* Sca24: {<myc!}.{b1006}<br />
* Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
''1. Modifying AKL41''<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
''2. Assembling Sca parts with the PCR product''<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Methods_and_Materials_-_Making_Parts_Sca40-Sca43Methods and Materials - Making Parts Sca40-Sca432008-10-19T03:58:42Z<p>Sstcheung: </p>
<hr />
<div>For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
*Sca22: {<AP!}.{b1006}<br />
*Sca23: {<HA!}.{b1006}<br />
*Sca24: {<myc!}.{b1006}<br />
*Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
1. Modifying AKL41<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
2. Assembling Sca parts with the PCR product<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
References:<br />
<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
<br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Methods_and_Materials_-_Making_Parts_Sca40-Sca43Methods and Materials - Making Parts Sca40-Sca432008-10-19T03:57:13Z<p>Sstcheung: New page: For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the ...</p>
<hr />
<div>For the formation of Sca40-Sca43, five separate composite parts were prepared beforehand. Of these, four were {<tag!}.{b1006} parts - labeled Sca22-Sca25. The labels correspond with the “tag” parts as follows:<br />
<br />
Sca22: {<AP!}.{b1006}<br />
Sca23: {<HA!}.{b1006}<br />
Sca24: {<myc!}.{b1006}<br />
Sca25: {<FLAG!}.{b1006}<br />
<br />
All of the parts were in Cam/Kan (antibiotic) assembly vectors.<br />
Additionally, a part consisting of {Pbad}{rbs_pelB>}{<phoA!}{<b1006>} was necessary for the Sca parts to join to. This part was labeled AKL41. Both AKL41 and Sca22-Sca25 were the result of composite parts assembly using 1-2-3 Assembly method.<br />
<br />
Parts Sca40-Sca43 are composed of the four different {<tag!}.{b1006} parts, each assembled with AKL41 to create final, composite parts consisting of {Pbad}.{rbs_pelB>}.{<phoA>}.{<tag!}.{<b1006>}. Four such goal parts were created, each for one of the following tags: AP, HA, myc, and FLAG. <br />
<br />
<br />
<br />
1. Modifying AKL41<br />
<br />
In order to assemble AKL41 with other parts, it was necessary first to remove everything south of the phoA stop codon on AKL41. This was accomplished by doing a PCR using ca998 forward oligo and reverse oligo for <phoA> Mea37. The PCR was done on a 25 uL scale, as specified elsewhere (1). The 2K55 PCR machine program was used. Once the PCR was completed, the PCR product was run on a gel to check for correct sizing - which was expected to be around 2850 bp long. Simultaneously, the product was purified: the band was cut from the gel, dissolved in 3 volumes of ADB buffer at 55C for 5-10 minutes.<br />
<br />
2. Assembling Sca parts with the PCR product<br />
<br />
Both the PCR product and the Sca parts were digested. The PCR product was digested using 1ul each of EcoRI, BglII, and DpnI. This was done on a 50 uL scale (2). Simultaneously, the 4uL of the Sca parts were combined with 4uL H2O, 1uL NEB2 buffer, and 0.5 uL each of EcoRI and BglII. Both the product and the Sca parts were digested for a period of 1 hour at 37C. Once digestion was completed, the product and the parts were purified using Zymo cleanup method (3). The cleanup from the PCR product was eluted with 10uL H2O, while each of the four Sca parts were eluted with 6uL of H2O. Following purification, ligation of the PCR product and an Sca part was done on a 10uL scale. Each Sca part - 1uL each - was combined with 1uL of the PCR product, 1uL of ligase buffer, 1uL of H2O, and 0.5 uL of ligase into a 0.5mL Eppendorf tube. The ligations were allowed to sit at room temperature for 30 minutes. Following this procedure, transformation was done using the protocol indicated elsewhere (4). <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
------------------------------<br />
(1.) Section entitled “PCR (25uL)” on the UC Berkeley “Protocols” page. <br />
(2.) Section entitled “Digestion” on the UC Berkeley “Protocols” page. <br />
<br />
(3.) Section entitled “Cleanup with Zymo Columns” on the UC Berkeley “Protocols” page. <br />
<br />
(4.) Section entitled “Transformation from Ligation Reaction” on the UC Berkeley “Protocols” page.</div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/Notebook/Sherine_CheungTeam:UC Berkeley/Notebook/Sherine Cheung2008-10-19T03:43:18Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:blue;font-size:15.0pt' align="center"><br />
<div style="text-align: center;"> <u>Welcome to Sherine's iGEM Notebook!</u></div><br />
</span><br />
<br />
<span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
[[Template:Team:UC Berkeley/Notebook/SC_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_Asequencing | Sherine/Cici's Assemblies Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_construction | My Construction Files]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_notes| My Notes (6/23/08 to 7/31/08)]]<br><br />
[[My Notes II | My Notes (8/01/08 to 8/24/08)]]<br />
<br />
[[Methods and Materials - Making Parts Sca40-Sca43]]<br />
<br />
[[Assembly Related Protocols]]<br />
<br />
<br />
----<br />
<br />
<div style="text-align: center;"> [[Team:UC_Berkeley|UC Berkeley Team Homepage]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/Notebook/Sherine_CheungTeam:UC Berkeley/Notebook/Sherine Cheung2008-10-19T02:33:35Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:blue;font-size:15.0pt' align="center"><br />
<div style="text-align: center;"> <u>Welcome to Sherine's iGEM Notebook!</u></div><br />
</span><br />
<br />
<span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
[[Template:Team:UC Berkeley/Notebook/SC_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_Asequencing | Sherine/Cici's Assemblies Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_construction | My Construction Files]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_notes| My Notes (6/23/08 to 7/31/08)]]<br><br />
[[My Notes II | My Notes (8/01/08 to 8/24/08)]]<br />
<br />
[[Assembly Related Protocols]]<br />
<br />
<br />
----<br />
<br />
<div style="text-align: center;"> [[Team:UC_Berkeley|UC Berkeley Team Homepage]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/Notebook/Sherine_CheungTeam:UC Berkeley/Notebook/Sherine Cheung2008-10-11T23:23:33Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:blue;font-size:15.0pt' align="center"><br />
<div style="text-align: center;"> <u>Welcome to Sherine's iGEM Notebook!</u></div><br />
</span><br />
<br />
<span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
[[Template:Team:UC Berkeley/Notebook/SC_sequencing | My Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_Asequencing | Sherine/Cici's Assemblies Sequencing Log]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_construction | My Construction Files]]<br><br />
[[Template:Team:UC Berkeley/Notebook/SC_notes| My Notes (6/23/08 to 7/31/08)]]<br><br />
[[My Notes II]]<br />
<br />
[[Assembly Related Protocols]]<br />
<br />
<br />
----<br />
<br />
<div style="text-align: center;"> [[Team:UC_Berkeley|UC Berkeley Team Homepage]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Team:UC_Berkeley/TeamTeam:UC Berkeley/Team2008-09-09T21:51:22Z<p>Sstcheung: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
.teamTable td{<br />
align:left<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
<br />
<!--- The Mission, Experiments ---><br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:UC_Berkeley|Home]]<br />
!align="center"|[[Team:UC_Berkeley/Team|The Team]]<br />
!align="center"|[[Team:UC_Berkeley/Project|The Project]]<br />
!align="center"|[[Team:UC_Berkeley/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:UC_Berkeley/Modeling|Modeling]]<br />
!align="center"|[[Team:UC_Berkeley/Notebook|Notebook]]<br />
|}<br />
<br />
<br />
== '''Who we are''' ==<br />
<br />
{| border="3" cellpadding="20" cellspacing="0"<br />
|colspan="3"|<br />
===Advisers:===<br />
|-<br />
|[[Image:ChrisAndersonOfficial.png|100 px]][[Team:UC_Berkeley/Team/Chris_Anderson|J. Christopher Anderson]]<br><br />
|[[Team:UC_Berkeley/Team/Terry_Johnson|Terry Johnson]]<br><br />
|[[Image:MeganDueck.jpg|100 px]][[Team:UC_Berkeley/Team/Megan_Dueck|Megan Dueck]]<br><br />
|-<br />
|[[Image:JinHuhOfficial.png|100 px]][[Team:UC_Berkeley/Team/Jin_Huh|Jin Huh]]<br><br />
|[[Image:DirkVandePolOfficial.png|100 px]][[Team:UC_Berkeley/Team/Dirk_VandePol|Dirk VandePol]]<br><br />
|<br />
|}<br />
<br />
{| border="3" cellpadding="20" cellspacing="0"<br />
|colspan="3"|<br />
<br />
===Team Members:===<br />
|-<br />
|[[Image:MollyAllen.jpg|200 px]][[Team:UC_Berkeley/Team/Molly_Allen|Molly Allen]]<br><br />
|[[Image:ChristieBrownOfficial.png|100 px]][[Team:UC_Berkeley/Team/Christie_Brown|Christie Brown]]<br><br />
|[[Image:CiciChenOfficial.png|100 px]][[Team:UC_Berkeley/Team/Cici_Chen|Cici Chen]]<br><br />
|-<br />
|[[Image:ShereneCheungOfficial.png|100 px]][[Team:UC_Berkeley/Team/Sherene_Cheung|Sherine Cheung]]<br><br />
|[[Image:AronLauOfficial.png|200 px]][[Team:UC_Berkeley/Team/Aron_Lau|Aron Lau]]<br><br />
|[[Image:MarleeTichenorOfficial.png|200 px]][[Team:UC_Berkeley/Team/Marlee_Tichenor|Marlee Tichenor]]<br><br />
|-<br />
|[[Image:MadhviVenkatest.jpg|100 px]][[Team:UC_Berkeley/Team/Madhvi_Venkatesh|Madhvi Venkatesh]]<br><br />
|[[Image:BingXiaOfficial.png|100 px]][[Team:UC_Berkeley/Team/Bing_Xia|Bing Xia]]<br><br />
|}<br />
<br />
{| border="3" cellpadding="20" cellspacing="0"<br />
|colspan="3"|<br />
<br />
===Administrative Support:===<br />
|[[Image:KateSpohrOfficial.png|100 px]][[Team:UC_Berkeley/Team/Kate_Spohr|Kate Spohr]]<br><br />
|[[Team:UC_Berkeley/Team/Susanna_Spiro|Susanna Spiro]]<br><br />
|}<br />
<br />
== '''What we did''' ==<br />
<br />
(Provide proper attribution for all work)</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:56:25Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || '''antibody'''||sca40 (AP)||sca41 (HA)||sca42 (myc)||sca43 (FLAG)||sca40 10xD ||sca41 10xD||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP || L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
Conclusion:<br />
*sca40 (AP tag) consistently bound with '''AP''' and '''HA''' antibody<br />
*sca41 (HA tag) consistently bound with '''HA''' antibody<br />
*sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
*sca43 (FLAG tag) consistently bound with '''FLAG''' antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy to have completed 2 ELISAs in time...<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:55:32Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || '''antibody'''||sca40 (AP)||sca41 (HA)||sca42 (myc)||sca43 (FLAG)||sca40 10xD ||sca41 10xD||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP || L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
Conclusion:<br />
*sca40 (AP tag) consistently bound with '''AP''' and '''HA''' antibody<br />
*sca41 (HA tag) consistently bound with '''HA''' antibody<br />
*sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
*sca43 (FLAG tag) consistently bound with '''FLAG''' antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy.<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:54:50Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || '''antibody'''||sca40 (AP)||sca41 (HA)||sca42 (myc)||sca43 (FLAG)||sca40 10xD ||sca41 10xD||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP || L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
Conclusion:<br />
*sca40 (AP tag) consistently bound with AP and HA antibody<br />
*sca41 (HA tag) consistently bound with HA antibody<br />
*sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
*sca43 (FLAG tag) consistently bound with FLAG antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy.<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:54:17Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || antibody||sca40 (AP)||sca41 (HA)||sca42 (myc)||sca43 (FLAG)||sca40 10xD ||sca41 10xD||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP || L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
Conclusion:<br />
*sca40 (AP tag) consistently bound with AP and HA antibody<br />
*sca41 (HA tag) consistently bound with HA antibody<br />
*sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
*sca43 (FLAG tag) consistently bound with FLAG antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy.<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:52:47Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP || style="color:Blue;background-color:#ffffcc;" L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
Conclusion:<br />
*sca40 (AP tag) consistently bound with AP and HA antibody<br />
*sca41 (HA tag) consistently bound with HA antibody<br />
*sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
*sca43 (FLAG tag) consistently bound with FLAG antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy.<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:51:25Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP ||L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
Conclusion:<br />
*sca40 (AP tag) consistently bound with AP and HA antibody<br />
*sca41 (HA tag) consistently bound with HA antibody<br />
*sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
*sca43 (FLAG tag) consistently bound with FLAG antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy.<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:50:36Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
*IT WORKED. (partially)<br />
*Results:<br />
**C = clear<br />
**L = light yellow<br />
**M = medium yellow<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP ||L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
*Conclusion:<br />
sca40 (AP tag) consistently bound with AP and HA antibody<br />
sca41 (HA tag) consistently bound with HA antibody<br />
sca42 (myc tag) was inconclusive, since there was no myc antibody as a positive control<br />
sca43 (FLAG tag) consistently bound with FLAG antibody; but also displayed binding with AP and HA antibodies<br />
<br />
Next, hopefully someone will run another ELISA with more concentrated cultures, since the 10x diluted cultures did not turn yellow as expected. We assume that the washes might have lowered the concentration of either tags or culture. Hopefully, increasing the initial concentration will counteract the washes.<br />
<br />
As for me, my last day at lab is complete. =) I am happy.<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures (added arabinose)and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:40:44Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
|-<br />
| A || AP ||L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:40:16Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| X || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
| A || AP ||L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:38:44Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
| A || AP ||L || C || / || C || / || / || / || /<br />
|-<br />
| B || HA || M || L || / || C || / || / || / || /<br />
|-<br />
| C ||FLAG || C || C || / || L || / || / || / || /<br />
|-<br />
| D || AP || L || L || / || Bright?|| / || / || / ||/<br />
|-<br />
| E || HA || M || L || / || M || / || / || / || / <br />
|-<br />
| F || FLAG|| C || C || / || M || / || / || / || /<br />
|-<br />
|}<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:37:28Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
| A || AP ||L || C || / || C || CLEAR<br />
|-<br />
| B || HA || M || L || / || C || || || || <br />
|-<br />
| C ||FLAG || C || C || / || L || || || || <br />
|-<br />
| D || AP || L || L || / || Bright?|| || || ||<br />
|-<br />
| E || HA || M || L || / || M || || || || <br />
|-<br />
| F || FLAG|| C || C || / || M || || || || <br />
|-<br />
|}<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-09-06T07:36:26Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43. (only ran with 3 antibodies: AP, HA, and FLAG. -- out of myc antibody)<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| || antibody || sca40 || sca41 || sca42 || sca43 || sca40 10xD ||sca41 10xD ||sca42 10xD ||sca43 10xD <br />
| A || AP ||L || C || / || C || || || || <br />
|-<br />
| B || HA || M || L || / || C || || || || <br />
|-<br />
| C ||FLAG || C || C || / || L || || || || <br />
|-<br />
| D || AP || L || L || / || Bright?|| || || ||<br />
|-<br />
| E || HA || M || L || / || M || || || || <br />
|-<br />
| F || FLAG|| C || C || / || M || || || || <br />
|-<br />
|}<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-25T01:23:50Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43.<br />
<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before! I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
Additionally, I'm feeling a little disoriented, considering that today is my last official day in lab... =(<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-25T01:21:15Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 24 August 2008 (Su) ==<br />
*Ran ELISA for sca40-43.<br />
<br />
<br />
== 23 August 2008 (Sa) ==<br />
I planned to come in to run a 2nd trial ELISA for sca40-43...but apparently, someone forgot to grow up cultures for me to test with the night before; so, I grew up cultures and will use them in ELISA test tomorrow.<br />
<br />
<br />
== 20 August 2008 (W) ==<br />
*Came in at 9:30am -- Set up 3rd time transformation of sca49-sca52<br />
*Jin finished plating later in the day<br />
<br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41. Finished all the way up to ligation. Put ligations in freezer before I left; set up transformation tomorrow.<br />
*Ran an ELISA for sca40-sca43 in MC1061 --- which ended at 11p.m. Results were not good...<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-20T22:56:13Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 19 August 2008 (T) ==<br />
*checked PCR, didn't turn out right -- no band<br />
*reset up PCR of AKL41.<br />
<br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*started to re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; and redone PCR of AKL41<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-20T22:50:09Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 18 August 2008 (M) ==<br />
*didn't get to run an ELISA on sca40-43 (couldn't find all the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; hopefully Jin will get to plating...<br />
<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-19T01:30:51Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 18 August 2008 (M) ==<br />
*possibly run an ELISA on sca40-43 (once we find the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; supposed to be ~3000bp, came out ~1500 (only righty/vector part)<br />
*re-redo sca49-sca52, with newly digested righty/vector parts sca44-sca47; hopefully Jin will get to plating...<br />
<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-18T22:11:08Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 18 August 2008 (M) ==<br />
*possibly run an ELISA on sca40-43 (once we find the antibodies)<br />
*do another phoA assay for sca49-52, pick 2 yellow samples, miniprep, send to seq; and transform into MC1061<br />
**sca49-52 did not turn yellow<br />
**colony pcr with sca49 1-8, run on gel to check size; send one in for sequencing check<br />
<br />
== 17 August 2008 (Su) ==<br />
Wasn't in lab today.<br />
*Jin picked 12 colonies each of sca49-52<br />
*and picked MC1061 colonies of sca40-43<br />
<br />
<br />
== 16 August 2008 (S) ==<br />
*sca40-43 did NOT grow, because I accidently put them on the wrong double-antibiotic plate<br />
*MC1061 tests were good<br />
*phoA assay: sca49-sca52 did not turn yellow when the controls did<br />
*redo sca49-sca52 from PCR product. zymoed, digested, zymoed, ligated with sca44-sca47, transformed, and plated on AK.<br />
<br />
== 15 August 2008 (F) ==<br />
*picked colonies for sca49-52 -- 12 each; I again got to use 2 blocks simultaneously<br />
*also picked colony for positive controls AKL41 and AKL42<br />
*checked on whether MC1061 cells grew in good media...(not contaminated) -- made competent cells.<br />
*transformed sca40-sca43 into MC1061<br />
*test for competence in parallel<br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-16T20:38:19Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
== 15 August 2008 (F) ==<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-16T20:37:49Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 14 August 2008 (Th)==<br />
*1st thing in the morning: aliquot 5 ul of my basic parts and Cici's basic parts to send to the registry.<br />
*got sequencing results for my mislabeled "yellow samples" sca42-5 and 43-2.<br />
**realized that I don't have a good yellow sample of myc! tag<br />
**took 3 remaining yellow samples for sca42 (colonies 7, 8 and 12)<br />
**also picked 3 corresponding colonies off the plate to grow in media, just in case my miniprep samples don't work.<br />
*got sequencing results for sca44-47: there was a slight mix-up of tubes and tube numbers, but the samples themselves all turned out to be perfect. <br />
**Will resequence the mixed-up tubes/numbers for clarification.<br />
**meanwhile, still digested sca44-47 as "righty part + vector", zymoed; then ligated 1ul of sca44-47 with zymoed sca48 part from Tuesday = sca49, sca50, sca51, sca52; transformed<br />
**Jin plated sca49-52<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp;sent for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/Sca47-1Sca47-12008-08-16T20:10:22Z<p>Sstcheung: New page: <pre> AAATCTTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGACTACAAGGATGACGACGACAAGGGATCTGACACCACAACAATATCCGTACTGGAT AATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCG...</p>
<hr />
<div><pre><br />
AAATCTTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGACTACAAGGATGACGACGACAAGGGATCTGACACCACAACAATATCCGTACTGGAT<br />
AATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCGTGAATCGCTAAATGATAAACCGGCGAA<br />
AAATATTATTCTGCTGATCGGCGACGGAATGGGAGATTCTGAAATAACCGCCGCACGAAATTATGCCGAAGGCGCCGGCGGCTTTTTTAAAGGTATTGATGCCC<br />
TGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGG<br />
GTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTC<br />
GACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACG<br />
CGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACC<br />
GCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCA<br />
GACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAAGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTG<br />
TACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGT<br />
GGACGCGCGTCTATCGATAGCAGATCACGCCGCGACCCGTGCGACGATGCGAGACGGTGGATCTGATGAGCGTACAGAGGCGCTGCTTTGCGAAGAAAGACGCA<br />
ATACGCTGGTGATCGTACGCCGATCATGCCTCATGCCAGC<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Sca46-1Sca46-12008-08-16T20:09:21Z<p>Sstcheung: New page: <pre> TAATCCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTGAACAAAAACTCATCTCAGAAGAGGATCTGGGATCTGACACCACAACAATATCCGTAC TGGATAATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGC...</p>
<hr />
<div><pre><br />
TAATCCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTGAACAAAAACTCATCTCAGAAGAGGATCTGGGATCTGACACCACAACAATATCCGTAC<br />
TGGATAATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCGTGAATCGCTAAATGATAAACCGG<br />
CGAAAAATATTATTCTGCTGATCGGCGACGGAATGGGAGATTCTGAAATAACCGCCGCACGAAATTATGCCGAAGGCGCCGGCGGCTTTTTTAAAGGTATTGATG<br />
CCCTGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAG<br />
GGGTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCT<br />
CGACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACG<br />
CGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCG<br />
CCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGA<br />
CAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTAC<br />
GCCAAATCCGAAACGCAATGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGGCTTCTTTTTACAGGTGG<br />
AAGGCGCGTCTATCGATAGGCAGGATCACGCCCGCGACCCGTGCGGACAGATTGGCGGAAGACGGTGGATCTGATGAGCGTACAGAGGGGCGCTGGCCTTGCTAG<br />
AGACGCATACGCTGGGTGATCGTACGGCGATCATGCTCATGCCAGCCAGATCATGCCGC<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Sca45-1Sca45-12008-08-16T20:07:51Z<p>Sstcheung: New page: <pre> AATTCCTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTTACCCATACGACGTCCCAGACTACGCTGGGGGATCTGACACCACAACAATATCCGTACTGG ATAATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCG...</p>
<hr />
<div><pre><br />
AATTCCTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTTACCCATACGACGTCCCAGACTACGCTGGGGGATCTGACACCACAACAATATCCGTACTGG<br />
ATAATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCGTGAATCGCTAAATGATAAACCGGCGAAA<br />
AATATTATTCTGCTGATCGGCGACGGAATGGGAGATTCTGAAATAACCGCCGCACGAAATTATGCCGAAGGCGCCGGCGGCTTTTTTAAAGGTATTGATGCCCTGCC<br />
GCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAA<br />
CCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAG<br />
TTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGG<br />
CGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGG<br />
GGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCACGACAAACCGCTGCTGGGA<br />
CTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAA<br />
TGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGACGGCGCGTCTATCGATAGCA<br />
GGATCACGCCGCGACCCGTGCGGACAGATTGGCGGAGACGGTGGATCTGATGAGCGTAAGAGGGGCGCTGGCTTTGGCGAGAGACGCATACGCTGGGTGATCGTAAC<br />
GTCGATCATGCTCATGCCAGCAAATTCGTGGGCGTCA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_AsequencingTemplate:Team:UC Berkeley/Notebook/SC Asequencing2008-08-16T20:06:00Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| '''''Read''''' || '''''Date''''' || '''''sca #''''' || '''''Clone #''''' || '''''Oligo'''''|| '''''Result''''' || '''''File'''''<br />
|-<br />
| CC09 || 7/18/2008 || SCA15(trial 1)|| Clone #1 || ca998/g00101 || Bad read || [[SCA15]] <br />
|-<br />
| CC10 || 7/18/2008 || SCA17(trial 1)|| Clone #2 || ca998/g00101 || Bad read || [[SCA17]] <br />
|-<br />
| CC11 || 7/22/2008 || SCA18(trial 1) || Clone #4 || ca998 || Low signal || [[SCA18]] <br />
|-<br />
| CC12 || 7/22/2008 || SCA19(trial 1) || Clone #1 || ca998 || Low signal || [[SCA19]] <br />
|-<br />
| CC13 || 7/22/2008 || SCA18(trial 1) || Clone #4 || ca998 || Low signal || [[SCA18-2]]<br />
|-<br />
| CC14 || 7/22/2008 || SCA19(trial 1) || Clone #1 || ca998 || Low signal || [[SCA19-2]] <br />
|-<br />
| SC16 || 7/22/2008 || SCA16 || Clone #3 || ca998 || Bad--mixed inserts || [[SCA16]] <br />
|-<br />
| SC17 || 7/22/2008 || SCA20 || Clone #5 || ca998/G00101 || Bad--mixed inserts || [[SCA20]]<br />
|-<br />
| SC18 || 7/22/2008 || SCA22-1 || Clone #1 || ca998 || Perfect || [[SCA22]] <br />
|-<br />
| SC19 || 7/22/2008 || SCA23-3 || Clone #3 || ca998 || Perfect || [[SCA23]] <br />
|-<br />
| SC20 || 7/22/2008 || SCA24-1 || Clone #1 || ca998 || Perfect || [[SCA24]] <br />
|-<br />
| SC21 || 7/22/2008 || SCA25-1 || Clone #1 || ca998 || Perfect || [[SCA25]] <br />
|-<br />
| SC22 || 7/23/2008 || sca3-2 (fr. SP) || Clone #2 || ca998 || Did not work || [[SCA3-SP2]] <br />
|-<br />
| SC23 || 7/24/2008 || sca3-PR2 || Clone #2 || ca998 || mixed inserts || [[SCA3-PR2]] <br />
|-<br />
| SC24 || 7/24/2008 || sca15-1 (trial 2) || Clone #1 || ca998/g00101 ||ca998 weird;g00101 good || [[SCA15-1]] <br />
|-<br />
| SC25 || 7/30/2008 || sca1 T || Clone # || ca998/g00101 || 2 pt mutations || [[SC25]] <br />
|-<br />
| SC26 || 7/30/2008 || sca2 T || Clone # || ca998 || Bad Read || [[SC26]] <br />
|-<br />
| SC27 || 7/30/2008 || sca3 T || Clone #1 || ca998 || Bad Read || [[SC27]] <br />
|-<br />
| SC28 || 7/30/2008 || sca4 T || Clone # || ca998 || Perfect(missing EcoRI) || [[SC28]] <br />
|-<br />
| SC29 || 7/30/2008 || sca6 T || Clone # || ca998 || Perfect || [[SC29]] <br />
|-<br />
| SC30 || 7/30/2008 || sca7 T || Clone # || ca998 || Perfect || [[SC30]] <br />
|-<br />
| SC31 || 7/30/2008 || sca8 T || Clone # || ca998/g00101 || Perfect || [[SC31]] <br />
|-<br />
| SC32 || 7/30/2008 || sca9 T || Clone # || ca998/g00101 || random sequence || [[SC32]] <br />
|-<br />
| SC33 || 7/30/2008 || sca14 T || Clone # || ca998 || Perfect || [[SC33]] <br />
|-<br />
| CC15 || 7/29/2008 || sca5 (pBca1256) || Clone #1 || ca998 || Perfect || [[SCA5-1]] <br />
|-<br />
| CC16 || 7/29/2008 || sca5 (pBca1256) || Clone #2 || ca998 || Perfect || [[SCA5-2]] <br />
|-<br />
| CC17 || 7/29/2008 || sca11 (pBca1256) || Clone #1 || ca998 || Perfect || [[SCA11-1]] <br />
|-<br />
| CC18 || 7/29/2008 || sca11 (pBca1256)|| Clone #2 || ca998 || Perfect || [[SCA11-2]] <br />
|-<br />
| CC19 || 8/1/2008 || sca5 T || Clone #2 || ca998 || Perfect. no Bam site || [[SCA5 T2]] <br />
|-<br />
| CC20 || 8/1/2008 || sca11 T || Clone #1 || ca998 || Perfect || [[SCA11 T1]] <br />
|-<br />
| CC21 (CC11)|| 8/3/2008 || sca5 T {<HA!} || Clone #2 || G00101 || Perfect || [[sca5 T]] <br />
|-<br />
| CC22 (CC12)|| 8/3/2008 || sca11 T {<HA>}|| Clone #1 || G00101 || Perfect || [[sca11 T]]<br />
|-<br />
| SC42 || 8/4/2008 || sca2-1 || Clone #1 || g00101(try) || no part...wrong || [[sca2-1]]<br />
|-<br />
| SC43 || Date || sca3-9 || Clone #9 || ca998(&RS) || Bad Read || file <br />
|-<br />
| SC44 || 8/5/2008 || sca23-4 || Clone #4 || ca998 || Perfect || [[sca23-4]] <br />
|-<br />
| SC45 || 8//8/2008 ||Stock amplif. fimH || 1 sample || ca998 || mixed inserts || [[Amplif. fimH]] <br />
|-<br />
| <s>SC46</s> || Date || fimH || Clone # || oligo || result || file <br />
|-<br />
| SC47 || 8/13/2008 || sca40-1 || Clone #1 || g00101 || Perfect || [[sca40-1]] <br />
|-<br />
| SC48 || 8/13/2008 || sca40-4 || Clone #4 || g00101 || mixed inserts || [[sca40-4]] <br />
|-<br />
| SC49 || 8/13/2008 || sca41-4 || Clone #4 || g00101 || Perfect || [[sca41-4]] <br />
|-<br />
| SC50 || 8/13/2008 || sca42-2 || Clone #2 || g00101 || short - partial perfect || [[sca42-2]] <br />
|-<br />
| SC51 || 8/13/2008|| sca42-5 (maybe sca43-2)? || Clone #5 || g00101 || Perfect(but contains <FLAG!) || [[sca42-5]]<br />
|-<br />
| SC52 || 8/13/2008 || sca43-4 || Clone #4 || g00101 || short - only b1006 present || [[sca43-4]]<br />
|-<br />
| SC53 || 8/14/2008 || sca42-5 || Clone #5 || g00101 || mixed inserts || [[sca42-5 2nd try]] <br />
|-<br />
| SC54 || 8/14/2008 || sca43-2 || Clone #2 || g00101 || perfect || [[sca43-2]] <br />
|-<br />
| SC55 || 8/14/2008 || sca44 || Clone #1 || ca998 || perfect || [[sca44-1]] <br />
|-<br />
| SC56 || 8/14/2008 || sca45 || Clone #1 || ca998 || perfect || [[sca45-1]]<br />
|-<br />
| SC57 || 8/14/2008 || sca46 || Clone #1 || ca998 || perfect || [[sca46-1]]<br />
|-<br />
| SC58 || 8/14/2008 || sca47 || Clone #1 || ca998 || perfect (2nd try) || [[sca47-1]] <br />
|-<br />
| SC59 || 8/15/2008 || sca42 || Clone #7 || g00101 || short, missing phoA || [[sca42-7]]<br />
|-<br />
| SC60 || 8/15/2008 || sca42 || Clone #8 || g00101 || short, perfect || [[sca42-8]]<br />
|-<br />
| SC61 || 8/15/2008 || sca42 || Clone #12 || g00101 || short, perfect || [[sca42-12]]<br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
|}<br />
<br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-15T22:39:29Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
== 14 August 2008 (Th)==<br />
*<br />
<br />
<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp and send for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-15T22:22:10Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
== 13 August 2008 (W)==<br />
<br />
<br />
<br />
<br />
<br />
== 13 August 2008 (W)==<br />
*got sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp and send for sequencing<br />
*grew up fresh MC1061 to transform sca44-47 into<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/My_Notes_IIMy Notes II2008-08-15T20:40:36Z<p>Sstcheung: </p>
<hr />
<div><span style="font-family: Century gothic; font-size: 10pt"> <br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
== 13 August 2008 (W)==<br />
*got back sequencing results for sca40-43<br />
**seems that I have one good final product for every tag<br />
**possible tube mislabeling: what was labeled sca42-5 came out to be what I expected in sca43(colony 2)<br />
...will send sca42-5 and sca43-2 to seq again.<br />
*Check plate for sca44-47 for co-transformation - I have at least 2 not cotransformed of each part (yessssssss!)<br />
*Ran colony PCR for all 24 samples of sca44-sca47 - it's the first time I've put 24 tubes in the thermocycler!<br />
*Ran a gel for all 24 samples - the longest gel I've ever run. The strange thing is that ALL 24 samples (even the ones that were "supposedly cotransformed" looked "right" on the gel.<br />
*selected 2 colonies for sca44-sca47 each to miniprepp.<br />
<br />
<br />
<br />
== 12 August 2008 (T)==<br />
*sca48 PCR did not work.<br />
**re-diluted 100uM pelB>R oligo<br />
**set up 2nd PCR<br />
**gel check = correct!<br />
**purified (by zymo), digested, and zymo 2nd time<br />
*picked colonies for sca44-47, screen on ACK plate<br />
*sca40-43 (complete final products):<br />
#did phoA assay to check for yellow signal<br />
##three results: clear, light yellow, or REALLY yellow. <br />
##all 4 different products each had at least 2 light/really yellow samples.<br />
Miniprepped:<br />
<pre><br />
sca40-1 -- Really yellow seq<br />
sca40-4 -- light yellow seq<br />
sca41-4 -- really yellow seq<br />
sca41-8 -- Really yellow<br />
sca42-2 -- Really yellow seq<br />
sca42-5 -- Really yellow ?<br />
sca43-2 -- Really yellow ?<br />
sca43-4 -- light yellow seq<br />
</pre><br />
<br />
<br />
<br />
== 11 August 2008 (M)==<br />
<br />
*pick 12 colonies each for sca40-sca43. For the first time, I will simultaneously need two 24-well blocks...<br />
*miniprep sca4-sca7 (no mapping or sequencing necessary)<br />
*Assemble Layer 1 of Branch 2: {<tag>}.{<phoA!}.{b1006}<br />
=sca44. sca45, sca46, sca47<br />
*make sca48 {Pbad}.{rbs_pelB>} from AKL41: set up PCR with pelB> reverse oligo.<br />
<br />
<br />
== 10 August 2008 (Su)==<br />
*Came into lab today!!!<br />
*Moved sca4-sca7 into Lefty cells instead of righty. (already in AC vector, still useful)<br />
*Redid everything from yesterday, only using AKL 41 as the "Aron part" <br />
**PCRed AKL 41 with ca998F and mea37R (phoA> reverse) oligos to make sca39: {pBad}.{rbs_pelB}.{phoA>}<br />
**assembled sca39 with {<tag!}.{b1006} parts sca22, sca23, sca24, sca25.<br />
**completed assemblies = sca40, sca41, sca42, and sca43. <br />
<br />
== 09 August 2008 (S)==<br />
Busy…very busy…<br />
<br />
*Miniprepped 4 colonies of fimH; <br />
*Simultaneously did 3 different types of digestion protocols (with 10 tubes): 1.)mapping 2.)digesting vectors, and 3.)digesting Aron’s parts<br />
*Digestion mapped all 4 miniprepped fimH's. All had different band sizes… sent colony 3 for sequencing.<br />
<br />
*Finished up with 16 and 19, each with my parts sca22-25<br />
= total 8 things.<br />
<br />
*Left before transformation and plating, but found out in evening that 16 and 19 parts were unnecessary, since Aron had an even more complete part (with pBad promoter)… didn’t plate.<br />
<br />
<br />
== 08 August 2008 (F)==<br />
<br />
*Sca2: both diluted colonies co transformed -- no miniprepping...<br />
*FimH (SC43) came back bad read <br />
*Took fimH from Jin’s Amp plate (same day as re-amplified fimH), picked 4 colonies and grew in LB Amp-Checked plate and culture for amplifying Bca9194 - nothing grew.<br />
*Ran a gel in the morning at 9 a.m. -- gel turned out weird: 2 bands - one at 4000 and other at 650-750ish bp both were wrong… (size was supposed to be 1610 bp)<br />
*talked with Chris and Jin. Stopped using questionable Bca9194; used Aron’s parts - AKL16, 17, and 19 - as PCR template instead.<br />
*Ran gel to check Aron’s 16, 17, and 19 -- used PCR product of AKL16 and AKL19 <br />
*Did a zymo for AKL 16 and AKL 19.<br />
<br />
<br />
== 07 August 2008 (Th)==<br />
*Picked colonies for sca2-7; streaked on CK plate, screened on Amp. Growing overnight in CK media<br />
*mini meeting - new methods enforced due to assembly status:<br />
<br />
Assembly Status:<br />
<pre><br />
All transfers completed successfully, EXCEPT sca2 (rbs1-A) and sca3 (fimH)<br />
<br />
Layer one assemblies completed:<br />
sca21-{<phoA!}.{b1006}<br />
sca22-{<AP!}.{b1006}<br />
sca23-{<HA!}.{b1006}<br />
sca24-{<myc!}.{b1006}<br />
sca25-{<FLAG!}.{b1006}<br />
<br />
None of Layer 2 or 3.<br />
</pre><br />
<br />
*Decided to shrink old tree and use new methods to finish the tags: attach my {<tag!}.{b1006} parts to {FimH}.{phoA!}<br />
**Take existing {FimH}.{PhoA!} (aka. pBca1102-Bca9194), set up PCR using ca998 oligo and mea37 (<phoA> reverse oligo) to remove stop codon<br />
**At first, the PCR product came out mysteriously large. We tried 3 times and the same thing occurred.<br />
It was not until 11:00pm, that figured that I was using the wrong oligo ... we set up the 4th PCR then - with the ''correct'' oligo.<br />
*also amplified Bca9194 for personal stock, since we were running low - grew on amp plate AND amp media<br />
<br />
== 06 August 2008 (W)==<br />
Talked to Jin last night about what to do with our non-cooperative sca2 and sca3. Got a new protocol for dealing with cotransformed sca2. Jin amplified fimH while he was still in lab...<br />
<br />
The day - in order of occurence:<br />
*8:45a.m. - miniprepped two of our co-transformed sca2 samples for a new protocol (to rid co-transformation)<br />
*UCSF BBQ<br />
*5:30p.m. - miniprepped the stock fimH that Jin amplified.-- want to send it to seq (check if fimH is ''really'' fimH...)<br />
*diluted miniprepped, co-transformed sca2-7 sample 100x. Re-transformed onto CK plate.<br />
<br />
Protocol for ridding co-transformation:<br />
<br />
<pre><br />
1. miniprep co-transformed sample<br />
2. dilute sample 100x (0.5ul dna + 49.5ul water)<br />
3. transform (with 15 min. rescue) into selected cell strain (as usual)<br />
4. plate on double antibiotic plate<br />
5. pick colonies the next day (maybe 2...)<br />
6. streak on spec or amp plate and double-antibiotic plate to check for co-transformation<br />
7. simultaneously put into media<br />
8. miniprep the next day.<br />
<br />
</pre><br />
<br />
<br />
== 05 August 2008 (T)==<br />
*museum trip!<br />
*came back, found that all 6 colonies of sca2 cotransformed on Amp plate...not good, not good..<br />
*sequencing results: sca23 WORKED!!!! one assembly down! still 6 more (in Layer 1) to go...<br />
sca3-9 is bad<br />
<br />
Conclusion: I really want fimH to work...soon!!!!!<br />
<br />
<br />
== 04 August 2008 (M)==<br />
<br />
Events of the day:<br />
*seq results for sca2: the part was not there -- only the RFP was there!<br />
*repicked 6 colonies for sca2 to check for cotransformation on an Amp plate.<br />
*analyzed the gel that Bing ran yesterday - sca23-1, sca23-3, sca3-1,2,3, and 4.<br />
The bands were kind of faint, and some were wrong, so we ran another gel, after miniprepping all our other sca3 and sca23 samples.<br />
*2nd digestion map: all 3 sca23 colonies looked good; sca3-9 looked best, and sca3-10 is our second choice for sequencing<br />
*sent sca23-4 and sca3-9 for sequencing<br />
*we decided to move everyone upstairs.<br />
<br />
<br />
== 03 August 2008 (S)==<br />
Not in lab today, but Bing miniprepped and digestion mapped some of the samples from The One Block. I was very happy to hear that only one thing (one of the colonies of sca23) cotransformed.<br />
<br />
== 02 August 2008 (Sa)==<br />
<br />
Came in at 11a.m. <br />
<br />
Highlights<br />
*of 5 colonies picked for sca2, none cotransformed, but colony 3 was red. <br />
*Pelleted colony 1, 2, 4, and 5. Miniprepped colony 1 and 2. <br />
*Digestion mapped colony 1 and 2. Bands were correct, but the single cut was really bright, for some unknown reason.<br />
*Sent sca2-1 for sequencing.<br />
*sca3 -- only about 10 colonies. Will pick all 10 -- grow in K/A media<br />
*sca23 -- will pick 6 colonies -- grow in C/K media<br />
*24-well block shared with Bing:<br />
<br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| sca23-1 || sca23-2 || sca23-3 || sca23-4 || sca23-5 || sca23-6 <br />
|-<br />
| sca3-1 || sca3-2 || sca3-3 || sca3-4 || sca3-5 || sca3-6 <br />
|-<br />
| sca3-7 || sca3-8 || sca3-9 || sca3-10 || bx || bx <br />
|-<br />
| bx || bx || bx || bx || bx || bx <br />
|-<br />
|}<br />
<br />
Someone shall have the honor of miniprepping this block tomorrow...<br />
<br />
== 01 August 2008 (F) ==<br />
There was a lot more activity going today in the lab:<br />
<br />
Statuses of our most recent endeavors:<br />
<br />
'''Sca9:'''<br />
*the two sca9 colonies that I picked yesterday were miniprepped<br />
*digestion mapped, but looked really strange the first time (but Jin was still ''very'' positive about it...)<br />
*digestion mapped 2nd time (using 2ul DNA) -- this time 4 bands showed up. Still not good<br />
*We decided that we would use Aron's equivalent of sca9 (phoA!), which apparently worked perfectly fine for him.<br />
<br />
'''HA tags'''<br />
*Cici's sequenced <HA> and <HA! tags came relatively well...but are getting resequenced using g00101<br />
*We went ahead and assembled sca23 (HA! + b1006)<br />
<br />
'''Other sequencing news'''<br />
*sca4 worked!!!<br />
*but sca3 (our fimH that EVERYTHING needs to be assembled with) did not. Grrrrrrrrr...<br />
*asked to have sca3 T1 resequenced using g00101 (we were worried there may be a mutation with ca998 -- many chromatagrams have come back with bases 70-80 very low signal...)<br />
*Digestion mapped remaining sca3 colonies 2,3, and 4, hoping to send them to sequence.<br />
*Digestion map for sca3-2,3, and 4 was WRONG... '''very wrong'''. We were expecting bands 1133 and 2362 bp: what we thought was the 1133 band was questionable, and there was no 2362 band!<br />
*At 6:30p.m. we decided to re-re-transfer sca3, using Jin's incredibly awesome fimH (hopefully). <br />
<br />
<br />
The world might as well come to an end if fimH doesn't work this time...<br />
<br />
--------</div>Sstcheunghttp://2008.igem.org/Sca44-1Sca44-12008-08-15T20:19:57Z<p>Sstcheung: </p>
<hr />
<div>ca998 fwd read<br />
<pre><br />
GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAAGGATCTGACACCACAACAATATCCGTACTGGATAATCGTGCGGCGCAGGGCGATAT<br />
TACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCGTGAATCGCTAAATGATAAACCGGCGAAAAATATTATTCTGCTGATCG<br />
GCGACGGAATGGGAGATTCTGAAATAACCGCCGCACGAAATTATGCCGAAGGCGCCGGCGGCTTTTTTAAAGGTATTGATGCCCTGCCGCTGACCGGACAA<br />
TATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAACCTACAA<br />
CGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAGT<br />
TGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAA<br />
AAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGG<br />
CGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGG<br />
ACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACC<br />
TGTACGCCAAATCCGAAACGCA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Sca44-1Sca44-12008-08-15T20:19:18Z<p>Sstcheung: New page: ca998 fwd read <pre> GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAAGGATCTGACACCACAACAATATCCGTACTGGATAATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCGTGAATCGCTAAA...</p>
<hr />
<div>ca998 fwd read<br />
<pre><br />
GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAAGGATCTGACACCACAACAATATCCGTACTGGATAATCGTGCGGCGCAGGGCGATATTACTACGCCCGGCGGCGCGCGCCGATTAACCGGCGATCAAACGGCGGCGCTGCGTGAATCGCTAAATGATAAACCGGCGAAAAATATTATTCTGCTGATCGGCGACGGAATGGGAGATTCTGAAATAACCGCCGCACGAAATTATGCCGAAGGCGCCGGCGGCTTTTTTAAAGGTATTGATGCCCTGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCA<br />
</pre></div>Sstcheunghttp://2008.igem.org/Sca42-12Sca42-122008-08-15T20:16:17Z<p>Sstcheung: New page: <pre> TTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCGCGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTAC AGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCG...</p>
<hr />
<div><pre><br />
TTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCGCGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTAC<br />
AGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGC<br />
GCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAG<br />
CTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCGATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGG<br />
GATCTGAACAAAAACTCATCTCAGAAGAGGATCTGTAAGGATCTAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Sca42-8Sca42-82008-08-15T20:13:44Z<p>Sstcheung: New page: g00101 reverse complement read <pre> CGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAG GCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTC...</p>
<hr />
<div>g00101 reverse complement read <br />
<br />
<pre><br />
CGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAG<br />
GCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGC<br />
TTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCGATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGGGATCTGAACAAA<br />
AACTCATCTCAGAAGAGGATCTGTAAGGATCTAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Sca42-7Sca42-72008-08-15T20:11:24Z<p>Sstcheung: New page: g00101 reverse complement read <pre> AAAGGATCATTAAGCAACTGTAATGAAATGCGTCAAAATGTTGAAGAGATGCCATTGGGATATATCAACGATGGTATATCCAGTGATTCTTTTCTCC ATGATAGCTTCGTCAGAACCGAAAAATCCCGATAAGTCAAAAAATACGACCG...</p>
<hr />
<div>g00101 reverse complement read<br />
<br />
<pre><br />
AAAGGATCATTAAGCAACTGTAATGAAATGCGTCAAAATGTTGAAGAGATGCCATTGGGATATATCAACGATGGTATATCCAGTGATTCTTTTCTCC<br />
ATGATAGCTTCGTCAGAACCGAAAAATCCCGATAAGTCAAAAAATACGACCGGTAAAGATGGTATGGCGATGGTCATCAAGTAGGACCATTTGGAAG<br />
AAGAGATCCAGAATTGCCATTATCAACAAGGCGCACAAAAAAGCAGGGTCCGAATTGGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTGTTC<br />
TTCCCCAAGAAAGCGGCTCTGGACCTCAAGGGATCTGAACAAAAACTCATCTCAGAAGAGGATCTGTAAGGATCTAAAAAAAAACCCCGCCCCTGAC<br />
AGGGCGGGGTTTTTTTTAGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGTCGTCGCGCGCAGGCTA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Template:Team:UC_Berkeley/Notebook/SC_AsequencingTemplate:Team:UC Berkeley/Notebook/SC Asequencing2008-08-15T20:09:52Z<p>Sstcheung: </p>
<hr />
<div><span style='font-family:"Century Gothic";color:maroon;font-size:10.0pt' align="center"><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div><br />
<div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div><br />
<br />
{| cellpadding="3" cellspacing="5" border="1"<br />
| '''''Read''''' || '''''Date''''' || '''''sca #''''' || '''''Clone #''''' || '''''Oligo'''''|| '''''Result''''' || '''''File'''''<br />
|-<br />
| CC09 || 7/18/2008 || SCA15(trial 1)|| Clone #1 || ca998/g00101 || Bad read || [[SCA15]] <br />
|-<br />
| CC10 || 7/18/2008 || SCA17(trial 1)|| Clone #2 || ca998/g00101 || Bad read || [[SCA17]] <br />
|-<br />
| CC11 || 7/22/2008 || SCA18(trial 1) || Clone #4 || ca998 || Low signal || [[SCA18]] <br />
|-<br />
| CC12 || 7/22/2008 || SCA19(trial 1) || Clone #1 || ca998 || Low signal || [[SCA19]] <br />
|-<br />
| CC13 || 7/22/2008 || SCA18(trial 1) || Clone #4 || ca998 || Low signal || [[SCA18-2]]<br />
|-<br />
| CC14 || 7/22/2008 || SCA19(trial 1) || Clone #1 || ca998 || Low signal || [[SCA19-2]] <br />
|-<br />
| SC16 || 7/22/2008 || SCA16 || Clone #3 || ca998 || Bad--mixed inserts || [[SCA16]] <br />
|-<br />
| SC17 || 7/22/2008 || SCA20 || Clone #5 || ca998/G00101 || Bad--mixed inserts || [[SCA20]]<br />
|-<br />
| SC18 || 7/22/2008 || SCA22-1 || Clone #1 || ca998 || Perfect || [[SCA22]] <br />
|-<br />
| SC19 || 7/22/2008 || SCA23-3 || Clone #3 || ca998 || Perfect || [[SCA23]] <br />
|-<br />
| SC20 || 7/22/2008 || SCA24-1 || Clone #1 || ca998 || Perfect || [[SCA24]] <br />
|-<br />
| SC21 || 7/22/2008 || SCA25-1 || Clone #1 || ca998 || Perfect || [[SCA25]] <br />
|-<br />
| SC22 || 7/23/2008 || sca3-2 (fr. SP) || Clone #2 || ca998 || Did not work || [[SCA3-SP2]] <br />
|-<br />
| SC23 || 7/24/2008 || sca3-PR2 || Clone #2 || ca998 || mixed inserts || [[SCA3-PR2]] <br />
|-<br />
| SC24 || 7/24/2008 || sca15-1 (trial 2) || Clone #1 || ca998/g00101 ||ca998 weird;g00101 good || [[SCA15-1]] <br />
|-<br />
| SC25 || 7/30/2008 || sca1 T || Clone # || ca998/g00101 || 2 pt mutations || [[SC25]] <br />
|-<br />
| SC26 || 7/30/2008 || sca2 T || Clone # || ca998 || Bad Read || [[SC26]] <br />
|-<br />
| SC27 || 7/30/2008 || sca3 T || Clone #1 || ca998 || Bad Read || [[SC27]] <br />
|-<br />
| SC28 || 7/30/2008 || sca4 T || Clone # || ca998 || Perfect(missing EcoRI) || [[SC28]] <br />
|-<br />
| SC29 || 7/30/2008 || sca6 T || Clone # || ca998 || Perfect || [[SC29]] <br />
|-<br />
| SC30 || 7/30/2008 || sca7 T || Clone # || ca998 || Perfect || [[SC30]] <br />
|-<br />
| SC31 || 7/30/2008 || sca8 T || Clone # || ca998/g00101 || Perfect || [[SC31]] <br />
|-<br />
| SC32 || 7/30/2008 || sca9 T || Clone # || ca998/g00101 || random sequence || [[SC32]] <br />
|-<br />
| SC33 || 7/30/2008 || sca14 T || Clone # || ca998 || Perfect || [[SC33]] <br />
|-<br />
| CC15 || 7/29/2008 || sca5 (pBca1256) || Clone #1 || ca998 || Perfect || [[SCA5-1]] <br />
|-<br />
| CC16 || 7/29/2008 || sca5 (pBca1256) || Clone #2 || ca998 || Perfect || [[SCA5-2]] <br />
|-<br />
| CC17 || 7/29/2008 || sca11 (pBca1256) || Clone #1 || ca998 || Perfect || [[SCA11-1]] <br />
|-<br />
| CC18 || 7/29/2008 || sca11 (pBca1256)|| Clone #2 || ca998 || Perfect || [[SCA11-2]] <br />
|-<br />
| CC19 || 8/1/2008 || sca5 T || Clone #2 || ca998 || Perfect. no Bam site || [[SCA5 T2]] <br />
|-<br />
| CC20 || 8/1/2008 || sca11 T || Clone #1 || ca998 || Perfect || [[SCA11 T1]] <br />
|-<br />
| CC21 (CC11)|| 8/3/2008 || sca5 T {<HA!} || Clone #2 || G00101 || Perfect || [[sca5 T]] <br />
|-<br />
| CC22 (CC12)|| 8/3/2008 || sca11 T {<HA>}|| Clone #1 || G00101 || Perfect || [[sca11 T]]<br />
|-<br />
| SC42 || 8/4/2008 || sca2-1 || Clone #1 || g00101(try) || no part...wrong || [[sca2-1]]<br />
|-<br />
| SC43 || Date || sca3-9 || Clone #9 || ca998(&RS) || Bad Read || file <br />
|-<br />
| SC44 || 8/5/2008 || sca23-4 || Clone #4 || ca998 || Perfect || [[sca23-4]] <br />
|-<br />
| SC45 || 8//8/2008 ||Stock amplif. fimH || 1 sample || ca998 || mixed inserts || [[Amplif. fimH]] <br />
|-<br />
| <s>SC46</s> || Date || fimH || Clone # || oligo || result || file <br />
|-<br />
| SC47 || 8/13/2008 || sca40-1 || Clone #1 || g00101 || Perfect || [[sca40-1]] <br />
|-<br />
| SC48 || 8/13/2008 || sca40-4 || Clone #4 || g00101 || mixed inserts || [[sca40-4]] <br />
|-<br />
| SC49 || 8/13/2008 || sca41-4 || Clone #4 || g00101 || Perfect || [[sca41-4]] <br />
|-<br />
| SC50 || 8/13/2008 || sca42-2 || Clone #2 || g00101 || short - partial perfect || [[sca42-2]] <br />
|-<br />
| SC51 || 8/13/2008|| sca42-5 (maybe sca43-2)? || Clone #5 || g00101 || Perfect(but contains <FLAG!) || [[sca42-5]]<br />
|-<br />
| SC52 || 8/13/2008 || sca43-4 || Clone #4 || g00101 || short - only b1006 present || [[sca43-4]]<br />
|-<br />
| SC53 || 8/14/2008 || sca42-5 || Clone #5 || g00101 || mixed inserts || [[sca42-5 2nd try]] <br />
|-<br />
| SC54 || 8/14/2008 || sca43-2 || Clone #2 || g00101 || perfect || [[sca43-2]] <br />
|-<br />
| SC55 || 8/14/2008 || sca44 || Clone #1 || ca998 || perfect || [[sca44-1]] <br />
|-<br />
| SC56 || 8/14/2008 || sca45 || Clone #1 || ca998 || perfect || [[sca45-1]]<br />
|-<br />
| SC57 || 8/14/2008 || sca46 || Clone #1 || ca998 || perfect || [[sca46-1]]<br />
|-<br />
| SC58 || 8/14/2008 || sca47 || Clone #1 || ca998 || short, but perfect || [[sca47-1]] <br />
|-<br />
| SC59 || 8/15/2008 || sca42 || Clone #7 || g00101 || short, missing phoA || [[sca42-7]]<br />
|-<br />
| SC60 || 8/15/2008 || sca42 || Clone #8 || g00101 || short, perfect || [[sca42-8]]<br />
|-<br />
| SC61 || 8/15/2008 || sca42 || Clone #12 || g00101 || short, perfect || [[sca42-12]]<br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
| Read || Date || Description || Clone # || oligo || result || file <br />
|-<br />
|}<br />
<br />
<br />
<br />
----<br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley]] </div><br />
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div></div>Sstcheunghttp://2008.igem.org/Sca43-2Sca43-22008-08-14T22:21:39Z<p>Sstcheung: </p>
<hr />
<div>g00101 reverse complement <br />
<br />
<pre><br />
TCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGC<br />
GCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGC<br />
GCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCG<br />
GTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCT<br />
GGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCG<br />
CGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTACAGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTT<br />
ACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCAT<br />
CAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCG<br />
ATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGGGATCTGACTACAAGGATGACGACGACAAGTAAGGATCTAAAAAAAAACCCCGC<br />
CCCTGACAGGGCGGGGTTTTTTTTA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheunghttp://2008.igem.org/Sca43-2Sca43-22008-08-14T22:21:11Z<p>Sstcheung: New page: <pre> TCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGC GCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGC...</p>
<hr />
<div><pre><br />
TCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGC<br />
GCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGC<br />
GCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCG<br />
GTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCT<br />
GGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCG<br />
CGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTACAGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTT<br />
ACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCAT<br />
CAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCG<br />
ATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGGGATCTGACTACAAGGATGACGACGACAAGTAAGGATCTAAAAAAAAACCCCGC<br />
CCCTGACAGGGCGGGGTTTTTTTTA<br />
</pre><br />
<br />
{{SC_seqLinks}}</div>Sstcheung