User contributions
From 2008.igem.org
- 06:18, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:59, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:57, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:56, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:33, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Reloxilator)
- 05:04, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Results) (top)
- 05:00, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Results)
- 02:35, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Results)
- 02:33, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Reporting Assay 3)
- 02:24, 30 October 2008 (diff | hist) N File:NYMU RA3 sine.png (top)
- 02:24, 30 October 2008 (diff | hist) N File:NYMU RA3 osctun.png (top)
- 02:23, 30 October 2008 (diff | hist) N File:NYMU RA3 osc.png (top)
- 02:23, 30 October 2008 (diff | hist) N File:NYMU RA3 LB.png (top)
- 02:03, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Reporting Assay 2)
- 01:58, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (→Reporting Assay 1)
- 01:49, 30 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Results of Reloxilator (New page: Only the Oscillator, Tuner, and Reporter was successfully ligated together, so we performed a few Reporting As...)
- 01:30, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator (→Experimental Results) (top)
- 01:15, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Cyanoxilator)
- 01:13, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence (→Seq pOmpF) (top)
- 01:12, 30 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Cyanobacteria Sequence (New page: ==Seq pOmpF== GACGGTGTTCACAAAGTTCCTTAAATTTTACTTTTGGTTACATATTTTTTCTTTTTGAAACCAAATCTTTATCTTTGTAG CACTTTCACGGTAGCGAAACGTTAGTTTGAATGGAAAGATGCCTGC ==Seq RpaA== ATGAAACCCCGCATCCTCGTGATCGA...)
- 01:07, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Cyanoxilator)
- 01:06, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Cyanoxilator)
- 00:53, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments
- 00:47, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Experimental Results)
- 00:46, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments (→Experimental Results)
- 00:45, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments
- 00:36, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project
- 00:35, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project
- 00:32, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator (top)
- 00:32, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator
- 00:31, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator
- 00:28, 30 October 2008 (diff | hist) N File:NYMU PCR rpaa sasa.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU FRpfu47.JPG (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 20080930 od lb.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 20080929 od m9.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 1004ODm9m.jpg (top)
- 00:28, 30 October 2008 (diff | hist) N File:NYMU 1004odlbm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 1004GFPm9m.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 1004gfplbm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0930GFPm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0929GFPm.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0914BR,FS49.jpg (top)
- 00:27, 30 October 2008 (diff | hist) N File:NYMU 0910cyanopfu47M.JPG (top)
- 00:26, 30 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Results of Cyanoxilator (New page: {{:Team:NYMU-Taipei/Header}} === Extraction of the genomic DNA of S. elongatus PCC 7942=== {| | Image:NYMU 20080826 PCC7942 genomic DNA with 1kb marker.JPG | * tube 1: 101.3 ng/uL (26...)
- 00:25, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Cyanoxilator (top)
- 00:22, 30 October 2008 (diff | hist) N File:NYMU Cyano promoter reporter.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Timer cyano.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Takao.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Susan.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU KaiABCcircuit.JPG (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU KaiABC.JPG (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Design unp.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Design p.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Cyanobacteria.JPG (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Cyanoassembly0923.jpg (top)
- 00:20, 30 October 2008 (diff | hist) N File:NYMU Cyano reporting circuit.jpg (top)
- 00:00, 30 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Cyanoxilator
- 23:58, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Links (top)
- 23:58, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments
- 23:58, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Experiments
- 23:55, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Experiments (Parts!)
- 23:53, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator (→Conclusion)
- 23:51, 29 October 2008 (diff | hist) N File:Reloxilator construct schedule.png (top)
- 23:51, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator (→Experimental Results)
- 23:50, 29 October 2008 (diff | hist) N File:NYMU reloxilator modelling.png (top)
- 23:50, 29 October 2008 (diff | hist) N File:NYMU reloxilator component testing.png (top)
- 23:50, 29 October 2008 (diff | hist) N File:NYMU reloxilator promoter testing.png (top)
- 23:49, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator
- 23:48, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator (→Related Biobricks)
- 23:44, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator
- 23:29, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation (top)
- 23:28, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation
- 23:24, 29 October 2008 (diff | hist) File:NYMU timer circuit bb.png (uploaded a new version of "Image:NYMU timer circuit bb.png") (top)
- 23:23, 29 October 2008 (diff | hist) File:NYMU timer.png (uploaded a new version of "Image:NYMU timer.png") (top)
- 23:22, 29 October 2008 (diff | hist) N File:NYMU timer circuit bb.png
- 23:21, 29 October 2008 (diff | hist) N File:NYMU timer circuit b b.png (top)
- 23:21, 29 October 2008 (diff | hist) N File:NYMU timer circuit.png (top)
- 23:20, 29 October 2008 (diff | hist) N File:NYMU timer circuit0.png (top)
- 23:20, 29 October 2008 (diff | hist) N File:NYMU timer.png
- 23:20, 29 October 2008 (diff | hist) File:NYMU threshold.png (uploaded a new version of "Image:NYMU threshold.png") (top)
- 23:20, 29 October 2008 (diff | hist) File:NYMU reloxilator.png (uploaded a new version of "Image:NYMU reloxilator.png") (top)
- 23:14, 29 October 2008 (diff | hist) N File:NYMU threshold.png
- 23:14, 29 October 2008 (diff | hist) File:NYMU reloxilator.png (uploaded a new version of "Image:NYMU reloxilator.png")
- 23:13, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation
- 20:31, 29 October 2008 (diff | hist) N File:NYMU iGEM08 pi standard curve 2N H2SO4 (2).png (top)
- 20:31, 29 October 2008 (diff | hist) N File:NYMU iGEM08 pi standard curve 5N H2SO4.png (top)
- 20:30, 29 October 2008 (diff | hist) N File:NYMU iGEM08 pi standard curve 2N H2SO4.png (top)
- 20:30, 29 October 2008 (diff | hist) N File:NYMU iGEM08 pi standard curve 0.7N H2SO4.png (top)
- 20:30, 29 October 2008 (diff | hist) N File:NYMU NYMU iGEM08 pi standard curve linear region comparison under different H2SO4 concentration.png (top)
- 20:29, 29 October 2008 (diff | hist) N IGEM08 How to measure phosphate (New page: == Reagent preparation == === Reagent I === * Sulfuric acid (H<sub>2</sub>SO<sub>4</sub>) * Potassium antimonyl tartrate solution * Ammonium molybdate solution === Reagent II === * Ascor...) (top)
- 20:27, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Phosphate
- 20:26, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Phosphate/Experiments/Pi measure (top)
- 20:25, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 33.png (top)
- 20:25, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 32.png (top)
- 20:24, 29 October 2008 (diff | hist) N File:Pi standard curve 20080723.png (top)
- 20:24, 29 October 2008 (diff | hist) N File:NYMU Pi measure dynamics in MOPS 100 300 500 1000 2000 3000uM.png (top)
- 20:24, 29 October 2008 (diff | hist) N File:NYMU Pi measure dynamics 100 300 500 uM.png (top)
- 20:24, 29 October 2008 (diff | hist) N File:NYMU NYMU iGEM08 pi standard curve 20080730 PM1000.png (top)
- 20:24, 29 October 2008 (diff | hist) N File:NYMU NYMU iGEM08 pi standard curve 20080730 PM0948.png (top)
- 20:24, 29 October 2008 (diff | hist) N File:NYMU NYMU iGEM08 pi standard curve 20080730 PM0800.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 200nm 20080822 by blent.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 200nm 20080821 by blent.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 3 by 志賢.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 3 by 佳妤.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 3 by Jesse.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 2 20mins.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 2 10mins.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU IGEM08 pi standard curve 5N H2SO4 20080814 trial 1 10mins.png (top)
- 20:23, 29 October 2008 (diff | hist) N File:NYMU 20080827 pi measure dynamics time point selection.png (top)
- 20:21, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Phosphate/Experiments/Pi measure (New page: == Standard Curve in ddH<sub>2</sub>O == * iGEM08 How to measure phosphate === 7/23, 2008 PM 4:04 === * 100, 200, 300, 400, 500 uM pi * reaction time: 10 mins * 5N H<sub>2</sub>SO<sub...)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU K12 SmaI digest cut gel.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU K12 SmaI digest 02.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU 20081005 PST fusion.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU 20081001 PST right.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU 20081001 PST gradient 03.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU 20081001 colony PCR RBS PPK.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU 20081001 colony PCR pLac P0440.jpg (top)
- 20:16, 29 October 2008 (diff | hist) N File:NYMU 20080927 colony PCR pLac P0440 and RBS PPK.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080926 colony PCR.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080927 colony PCR pLac P0440.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080924 ppk.JPG (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080923 pst ppk E0240.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080921 pst ppk PCR.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080921 colony PCR.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080920 P0440 J04430 I763004 colony PCR.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080920 P0440 colony PCR.jpg (top)
- 20:15, 29 October 2008 (diff | hist) N File:NYMU 20080919 pst.jpg (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080918 ppk pst 01.jpg (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080915pstppk2.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080915ppk2nestedPCR.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080915 ppk2 htlB.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080911 ppk1.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080910 ppk2 htlB.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080910 ppk2 graII.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080910 ppk2 gra.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080910 ppk1 and ppk2.JPG (top)
- 20:14, 29 October 2008 (diff | hist) N File:NYMU 20080909 pst PCR.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080909 htlB ppk2 taq pfu 13cycle.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080908 pst gradient and htlB.jpg (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080906 pst gradient ppk1 ppk2 htlb.jpg (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080905 pst re-examine.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080905 ppk PCR.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080905 gfp pst PCR.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080904 pst PCR.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080903 pst PCR.JPG (top)
- 20:13, 29 October 2008 (diff | hist) N File:NYMU 20080903 ppk pst PCR.JPG (top)
- 20:11, 29 October 2008 (diff | hist) N File:NYMU 20080902 pst PCR.JPG (top)
- 20:03, 29 October 2008 (diff | hist) N File:NYMU Pst Operon.png (top)
- 20:03, 29 October 2008 (diff | hist) N File:NYMU Pst operon cutting site scanning report.png (top)
- 20:03, 29 October 2008 (diff | hist) N File:NYMU Ppk mut cutting site scanning report.png (top)
- 20:03, 29 October 2008 (diff | hist) N File:NYMU Ppk cutting site scanning report.png (top)
- 20:03, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Phosphate/PRIMER of pstSCAB-phoU PST operon (→operon structure) (top)
- 20:01, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Phosphate/PRIMER of ppk (New page: <html><style> .purple{color:purple;} .red{color:red;} .EcoRI{color:white; background:purple} .ORF{background:lightblue} .primer{background:yellow;} .double{background:gold;} .forward, .dou...) (top)
- 20:01, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Phosphate/PRIMER of pstSCAB-phoU PST operon (New page: <html><style> .purple{color:purple;} .red{color:red;} .ORF{background:lightblue} .primer{background:yellow;} .double{background:gold;} .forward, .double{text-decoration:overline;} .reverse...)
- 20:00, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Phosphate/Experiments/GEL Electrophoresis (→PCR for new parts) (top)
- 19:56, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Phosphate/Experiments/GEL Electrophoresis (New page: == Experiments to be verified by Electrophoresis == * Gene cloning (PCR) * Digestion for vectors and inserts (Enzyme digestion) * Ligation * Transformation (Colony PCR) == PCR for new pa...)
- 19:54, 29 October 2008 (diff | hist) N File:NYMU 20081007 pi absorption test.png (top)
- 19:54, 29 October 2008 (diff | hist) N File:NYMU 20081007 pi regulation test.png (top)
- 19:54, 29 October 2008 (diff | hist) N File:NYMU 20081007 pi operations.png (top)
- 19:53, 29 October 2008 (diff | hist) N File:NYMU 20081007 pi regulation design.png (top)
- 19:53, 29 October 2008 (diff | hist) N File:NYMU 20081007 pi absorption design.png (top)
- 19:53, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Phosphate/Experiments/Assembly (New page: == Auto-Regulated Phosphate Absorption Device == === Phosphate Absorption Circuit === 400px === Phosphate Regulatory Circuit === [[Image:...) (top)
- 19:45, 29 October 2008 (diff | hist) N NYMU-Taipei/Project/Phosphate/Phosphate-related Medical Syndromes (New page: {{:Team:NYMU-Taipei/Header}} * When the phosphate level in blood <font color=red>exceeds '''6.5 mg/dL'''</font>, a patient kidney failure has a high risk of death * A '''high''' serum conc...) (top)
- 19:43, 29 October 2008 (diff | hist) N File:NYMU 20081003 pPhoB 40uM pi GFP.png (top)
- 19:43, 29 October 2008 (diff | hist) N File:NYMU 20081003 pPhoB 40uM pi growth.png (top)
- 19:42, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Phosphate
- 19:34, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Attachment (→Experiment Result) (top)
- 19:34, 29 October 2008 (diff | hist) N File:NYMU attach protocol.jpg (top)
- 19:33, 29 October 2008 (diff | hist) N File:NYMU Figure.2.jpg (top)
- 19:33, 29 October 2008 (diff | hist) N File:NYMU Figure.1.jpg (top)
- 19:33, 29 October 2008 (diff | hist) N File:NYMU attach protocal.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU Attachment testingcircuit-5.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU Attachment bindingcircuit-5.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU Attachment-muFimH-5.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU NYMU-Attachment-constructnew.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU Attachment cuttingsite-5.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU Attachment protease-5.jpg (top)
- 19:32, 29 October 2008 (diff | hist) N File:NYMU PROCESS3.jpg (top)
- 19:31, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Attachment
- 17:49, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Attachment/FimH (top)
- 17:47, 29 October 2008 (diff | hist) N File:NYMU Attachment-fimh-pocket.jpg (top)
- 17:46, 29 October 2008 (diff | hist) N File:NYMU Attachment-fimh-lectin-structure.jpg (top)
- 17:46, 29 October 2008 (diff | hist) N File:NYMU Attachment-fimhstructure.jpg (top)
- 17:46, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Attachment/FimH (New page: ====FimH Binding Domain Structure==== *FimH can bind to different kind of mannose on human bladder or intestine epitheial cells. *FimH has different variants. Monomannose-specific phenotyp...)
- 17:26, 29 October 2008 (diff | hist) N File:NYMU 20081025 pNhaA 300uM Na.png (top)
- 17:26, 29 October 2008 (diff | hist) N File:NYMU 20081025 pNhaA 150uM Na.png (top)
- 17:26, 29 October 2008 (diff | hist) N File:NYMU 20081025 pNhaA 0uM Na.png (top)
- 17:25, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/pH Sensor
- 17:21, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Guanidine (top)
- 17:20, 29 October 2008 (diff | hist) File:NYMU 9 12 1.png (uploaded a new version of "Image:NYMU 9 12 1.png") (top)
- 17:18, 29 October 2008 (diff | hist) N File:NYMU 9 12 1.png
- 17:18, 29 October 2008 (diff | hist) N File:NYMU 9 12 2.png (top)
- 17:17, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Guanidine
- 16:58, 29 October 2008 (diff | hist) N File:NYMU HPLC pic.jpg (top)
- 16:58, 29 October 2008 (diff | hist) N File:NYMU Gugu630 2.png (top)
- 16:58, 29 October 2008 (diff | hist) N File:NYMU Gugu620.png (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU guanidine3.jpg (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU guanidine2.jpg (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU Guani humanOCT3 pointmutation PCR workflow.png (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU 10 2 1.jpg (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU 9 25 1.jpg (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU 9 23 1.jpg (top)
- 16:57, 29 October 2008 (diff | hist) N File:NYMU 9 18 2 3.jpg (top)
- 16:57, 29 October 2008 (diff | hist) File:NYMU 9 12 127.png (uploaded a new version of "Image:NYMU 9 12 127.png") (top)
- 16:56, 29 October 2008 (diff | hist) N File:NYMU 9 12 127.png
- 16:55, 29 October 2008 (diff | hist) N File:NYMU 9 12 1 1 digest.png (top)
- 16:53, 29 October 2008 (diff | hist) File:NYMU Urea0731.png (uploaded a new version of "Image:NYMU Urea0731.png": Reverted to version as of 18:51, 1 August 2008) (top)
- 16:52, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project/Urea
- 16:51, 29 October 2008 (diff | hist) N File:NYMU urea transport in human body.png (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea poor growth.jpg (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea plasmid1014.png (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea plasmid1012 labeled.png (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea exp 0822.png (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea exp 0821.png (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea CompareUreaRemovalMethods.jpg (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea colonyPCR 0910.png (top)
- 16:50, 29 October 2008 (diff | hist) N File:NYMU urea biobrick.jpg (top)
- 16:49, 29 October 2008 (diff | hist) File:NYMU Urea0731.png (uploaded a new version of "Image:NYMU Urea0731.png")
- 16:49, 29 October 2008 (diff | hist) N File:NYMU uera in LB.png (top)
- 16:49, 29 October 2008 (diff | hist) N File:NYMU G and U PCR20080904.png (top)
- 16:48, 29 October 2008 (diff | hist) N File:NYMU EtBr test labeled.png (top)
- 16:38, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/FAQ (New page: .) (top)
- 02:44, 29 October 2008 (diff | hist) Team:NYMU-Taipei/Project (project overview!)
- 02:42, 29 October 2008 (diff | hist) N Team:NYMU-Taipei/Project/Waste Removal (New page: {{:Team:NYMU-Taipei/Header}} Waste removal is function we want to perform when our BacToKidney enters the small intestine. Waste removal is split into three parts: * [[Team:NYMU-Taipei/Pr...)
- 02:41, 29 October 2008 (diff | hist) Team:NYMU-Taipei (fixed. >.<) (top)
- 18:14, 28 October 2008 (diff | hist) m Team:NYMU-Taipei/News (small changes) (top)
- 18:11, 28 October 2008 (diff | hist) Team:NYMU-Taipei/Header (new banner!) (top)
- 18:09, 28 October 2008 (diff | hist) Team:NYMU-Taipei/Links (new links!)
- 18:08, 28 October 2008 (diff | hist) Team:NYMU-Taipei (Main page picture updated!)
- 18:05, 28 October 2008 (diff | hist) N File:NYMU Banner-wider 965px.png (top)
- 18:04, 28 October 2008 (diff | hist) N File:NYMU main pic 965px-bw.png (top)
- 18:04, 28 October 2008 (diff | hist) N File:NYMU main pic 965px.png (top)
- 18:03, 28 October 2008 (diff | hist) File:NYMU Bannerinpic 700px.png (uploaded a new version of "Image:NYMU Bannerinpic 700px.png") (top)
- 18:01, 28 October 2008 (diff | hist) N File:NYMU Bannerinpic 700px.png
- 17:58, 28 October 2008 (diff | hist) Team:NYMU-Taipei/PPLDB (people--;) (top)
- 00:35, 15 August 2008 (diff | hist) File:NYMU Wang JH.jpg (uploaded a new version of "Image:NYMU Wang JH.jpg") (top)
- 17:06, 12 August 2008 (diff | hist) Team:NYMU-Taipei/News
- 17:05, 12 August 2008 (diff | hist) m Team:NYMU-Taipei/Team (top)
- 17:04, 12 August 2008 (diff | hist) Team:NYMU-Taipei/Team
- 16:59, 12 August 2008 (diff | hist) Team:NYMU-Taipei/PPLDB
- 16:59, 12 August 2008 (diff | hist) File:NYMU Kung YW.jpg (uploaded a new version of "Image:NYMU Kung YW.jpg") (top)
- 16:55, 12 August 2008 (diff | hist) Team:NYMU-Taipei/Team
- 16:54, 12 August 2008 (diff | hist) N Team:NYMU-Taipei/PersonStyle (New page: <html><style> .person{ width:100px; height:160px; border:1px solid gray; padding:2px; float:left; text-align:center; font-size:85%; } .personpic{ width:92px;height:122px;display:ta...) (top)
- 16:53, 12 August 2008 (diff | hist) m Team:NYMU-Taipei/PPLDB
- 16:53, 12 August 2008 (diff | hist) N Team:NYMU-Taipei/Person (New page: <!-- IMPORTANT: MUST INCLUDE /PersonStyle if using this as a template. @params: 1: name 2: picture --><html><div class="person all </html>{{{c|}}}<html>"><center><div class="personpic"></h...) (top)
- 16:53, 12 August 2008 (diff | hist) N Team:NYMU-Taipei/PPLDB (New page: b{{:Team:NYMU-Taipei/PersonStyle|}} <html><style></html> .sub{{{1|}}}{{{2|}}}{{{3|}}}{{{4|}}}{{{5|}}} .unfloat{float:left;clear:both;} .sub{{{1|}}}{{{2|}}}{{{3|}}}{{{4|}}}{{{5|}}} .all{ d...)
- 16:52, 12 August 2008 (diff | hist) N File:NYMU Yu HY.jpg (top)
- 16:52, 12 August 2008 (diff | hist) N File:NYMU Yen HW.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Yang CJ.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Yang CH.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Wu J.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Wang JH.jpg
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Wang CW.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Tsai YW.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Tsai MH.jpg (top)
- 16:51, 12 August 2008 (diff | hist) N File:NYMU Tsai CW.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Sun CC.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Lo WX.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Liao WC.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Li YC.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Lee YH.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Kuo YJ.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Kung YW.jpg
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Hung HC.jpg (top)
- 16:50, 12 August 2008 (diff | hist) N File:NYMU Huang YC.jpg (top)
- 16:49, 12 August 2008 (diff | hist) N File:NYMU Huang TY.jpg (top)
- 16:49, 12 August 2008 (diff | hist) N File:NYMU Huang SH.jpg (top)
- 16:49, 12 August 2008 (diff | hist) N File:NYMU Hsu TY.jpg (top)
- 16:49, 12 August 2008 (diff | hist) N File:NYMU Hsu CY.jpg (top)
- 16:49, 12 August 2008 (diff | hist) N File:NYMU Fan CJ.jpg (top)
- 16:49, 12 August 2008 (diff | hist) N File:NYMU Chung CY.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Chuang KA.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Chen YC.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Chen CH.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Chang YF.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Chang CH.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Chang C.jpg (top)
- 16:48, 12 August 2008 (diff | hist) N File:NYMU Blank.jpg (top)
- 18:11, 6 August 2008 (diff | hist) N Team:NYMU-Taipei/ (Because with the slash, comes a different page.) (top)
- 18:06, 6 August 2008 (diff | hist) Team:NYMU-Taipei/News
- 18:04, 6 August 2008 (diff | hist) Team:NYMU-Taipei/Header
- 18:04, 6 August 2008 (diff | hist) Team:NYMU-Taipei/Links
- 18:03, 6 August 2008 (diff | hist) Team:NYMU-Taipei (New main page design!)
- 17:58, 6 August 2008 (diff | hist) N File:NYMU banner 800.png (BacToKidney - Toward a better way of life.) (top)
- 17:56, 6 August 2008 (diff | hist) N File:NYMU banner 600.png (BacToKidney - Toward a better way of life.) (top)
- 17:56, 6 August 2008 (diff | hist) N File:NYMU main page 800bw.png (top)
- 17:55, 6 August 2008 (diff | hist) N File:NYMU main page 800.png (top)
- 16:29, 2 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Guanidine
- 18:51, 1 August 2008 (diff | hist) File:NYMU Urea0731.png (uploaded a new version of "Image:NYMU Urea0731.png")
- 18:32, 1 August 2008 (diff | hist) Team:NYMU-Taipei
- 17:52, 1 August 2008 (diff | hist) Team:NYMU-Taipei
- 17:47, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator
- 17:39, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/pH Sensor
- 17:39, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Attachment
- 17:38, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Urea
- 17:38, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Phosphate
- 17:38, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Guanidine
- 17:37, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation
- 17:37, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation
- 17:36, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Cyanoxilator
- 17:35, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Time Regulation/Reloxilator
- 17:35, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Footer (The current footer file) (top)
- 17:35, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Header (The current header file)
- 17:33, 1 August 2008 (diff | hist) N File:NYMU Urea0731.png
- 17:33, 1 August 2008 (diff | hist) N File:NYMU reloxilator.png
- 17:33, 1 August 2008 (diff | hist) N File:NYMU Promoter elements of nhaA.png (top)
- 17:33, 1 August 2008 (diff | hist) N File:NYMU NhaA protein expression and activity regulated by pH.png (top)
- 17:33, 1 August 2008 (diff | hist) N File:NYMU IGEM08 phosphate device.png (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU IGEM08 NhaA regulation.png (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU Gugu2.jpg (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU Flagellum.png (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU Cyanoxilator.jpg (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU Combine 3.jpg (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU Attachment pic.jpg (top)
- 17:32, 1 August 2008 (diff | hist) N File:NYMU Attachment.jpg (top)
- 17:31, 1 August 2008 (diff | hist) N File:NYMU 7600693f1.jpg (top)
- 16:34, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Project/Attachment
- 16:34, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Part (Path shortcut (I think)) (top)
- 14:03, 1 August 2008 (diff | hist) Team:NYMU-Taipei/Team (Replacing page with 'All about us! hurrah!')
- 13:53, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/pH Sensor (New page: == Motivation == * When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work. * In this subsystem, we are going to create a pH sensor which senses...)
- 13:51, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/Urea (New page: == Why should urea be removed == Physiologically, urea is synthesized from ammonia and carbon dioxide. The elimination of urea means getting rid of nitrogenous waste from the body. In hea...)
- 13:50, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/Phosphate (New page: == Motivation == * When the phosphate level in blood exceeds 6.5 mg/dl, a patient kidney failure has a high risk of death. * A '''high''' serum concentration of [http://en.wikipedia.org/wi...)
- 13:50, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/Guanidine (New page: '''MOTIVATION:''' <br> Renal failure can make one unable to regulate water and electrolyte balances, and metabolic waste. If not treated, lethargy, weakness, shortness of breath, and gene...)
- 13:49, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Cyanoxilator (New page: 700px =Reference= *Mackey, S. R. and S. S. Golden (2007). "Winding up the cyanobacterial circadian clock." Trends in Microbiology 15(9): 381-8. *Walthers, D....)
- 13:48, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation/Reloxilator (New page: Our '''Reloxilator''' (Relaxation Oscillator): A four-part system consisting of an oscillator, a synchronizer, a tuner, and a reporter. 726px == Description == T...)
- 13:47, 1 August 2008 (diff | hist) Team:NYMU-Taipei
- 13:44, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Project/Time Regulation (New page: We, the subteam self-proclaimed as the regulators of time, control time through the use of oscillators. Our goal is to design a subsystem such that it would set to detach after a specified...)
- 13:42, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/News (New page: '''News and Updates.''' * 2008-08-01: Wikipage Online!)
- 13:41, 1 August 2008 (diff | hist) N Team:NYMU-Taipei/Links (New page: <html> <style> #nav .left, #nav .right, #nav .both{ border-color: gray; border-style:solid; } #nav .left{ border-width:0px 0px 0px 1px; } #nav .right{ border-width:0px 1px 0px 0px; } #nav ...)
- 13:40, 1 August 2008 (diff | hist) Team:NYMU-Taipei
- 13:39, 1 August 2008 (diff | hist) N File:NYMU-Taipei.png (NYMU-Taipei Main page picture.) (top)
- 13:37, 1 August 2008 (diff | hist) Team:NYMU-Taipei (Go NYMU-Taipei!)