User contributions
From 2008.igem.org
(Latest | Earliest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)
- 02:17, 29 June 2008 (diff | hist) N SC001 (New page: <pre> GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAA </pre> ---- <div style="text-align: center;"> Sherine Cheung </div> <div style="text-align...)
- 02:14, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 02:13, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 02:11, 29 June 2008 (diff | hist) File (top)
- 02:10, 29 June 2008 (diff | hist) File
- 02:09, 29 June 2008 (diff | hist) N File (New page: <pre> GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAA </pre>)
- 02:07, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 02:02, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 02:02, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 01:59, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 01:44, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC sequencing
- 01:11, 29 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:51, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:51, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:50, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:40, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:40, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:34, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 22:22, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 20:26, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 00:32, 27 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 21:56, 26 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 18:08, 26 June 2008 (diff | hist) User:Sstcheung
- 18:07, 26 June 2008 (diff | hist) User:Sstcheung
- 18:06, 26 June 2008 (diff | hist) User:Sstcheung (Removing all content from page)
- 18:05, 26 June 2008 (diff | hist) N User:Sstcheung (New page: UC Berkeley Main Page)
- 18:03, 26 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 18:03, 26 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 17:55, 26 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 05:42, 25 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 05:41, 25 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 01:08, 25 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 20:55, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 19:33, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 19:32, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 19:29, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 19:26, 24 June 2008 (diff | hist) N Template:Team:UC Berkeley/Notebook/SC sequencing (New page: ---- <div style="text-align: center;"> Sherine Cheung </div> <div style="text-align: center;"> Back to Berkeley </div>)
- 19:25, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 19:23, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes
- 19:22, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes (Removing all content from page)
- 19:20, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC notes (→23 June 2008)
- 19:20, 24 June 2008 (diff | hist) N Template:Team:UC Berkeley/Notebook/SC notes (New page: == 23 June 2008 == Having completed one week of training/lectures, I've finally started on my own little portion of the lab work! Over last weekend, I searched for the DNA sequences of th...)
- 18:58, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 18:56, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 18:55, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 18:55, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 18:49, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 18:40, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction (Removing all content from page)
- 18:40, 24 June 2008 (diff | hist) Template:Team:UC Berkeley/Notebook/SC construction
- 18:38, 24 June 2008 (diff | hist) N Template:Team:UC Berkeley/Notebook/SC construction (New page: test)
(Latest | Earliest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)