http://2008.igem.org/wiki/index.php?title=Special:Contributions/Normanwang&feed=atom&limit=50&target=Normanwang&year=&month=2008.igem.org - User contributions [en]2024-03-29T08:08:14ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/IGEM_PublicityIGEM Publicity2008-12-04T21:50:00Z<p>Normanwang: /* news articles about iGEM */ news about Team Hawaii</p>
<hr />
<div><div style="color:#aaa; padding-bottom:20px;">(Members of the press, please see the [[Press_Kit | iGEM Press Kit]])</div><br />
<br />
<div><br />
<span style="color:#1e90ff; font-size:135%">'''blogs </span><span style="color:#3cb371; font-size:135%">covering iGEM'''</span><br />
* [http://www.the-scientist.com/blog/browse/blogger/33/ <span style="color:red; font-size: 130%">'''The Scientist'''</span>] scroll down for several blog posts about iGEM and the Jamboree written by Alla Katsnelson.<br />
* [http://igemkuleuven.wordpress.com/ <span style="font-size:130%">'''KULeuven''']</span> blogs about their iGEM experience.<br />
* iGEM 2008 judge, [http://synthesis.typepad.com/synthesis/2008/11/igem-2008.html <span style="color:#e25500; font-size:130%">'''Rob Carlson''']</span>, shares his thoughts about iGEM and the successes of this year's teams.<br />
* [http://blog.ginkgobioworks.com/2008/11/09/team-slovenia-igem-grand-prize-winners-again/ <span style="color:#000; font-size:130%; font-weight:bold;">'''Ginkgo</span><span style="color:#77bc35; font-size:130%;">bioworks</span>'''], with several of its members serving as judges this year, blog about the iGEM 2008 Jamboree.<br />
* Eric Bland writes about iGEM on his [http://blogs.discovery.com/news_interior_design/2008/11/igem-2008.html<span style="color:#000; font-size:130%; font-weight:bold">Interior</span> <span style="color:#21528a; font-size:140%">Design</span>] blog, as part of '''Discovery Channel News'''.<br />
* [http://bostonist.com/2008/11/12/beaker_hill_synthetic_biology_igem.php <span style="color:#323232; font-weight: bold; font-size: 135%;">boston</span><span style="color:#323232; font-size: 135%;">ist</span>] talks about the Jamboree in a [http://bostonist.com/tags/igem three part series] on iGEM.<br />
* The UC Berkeley team blogs about their iGEM experience on their [http://blogs.coe.berkeley.edu/igem/about/ <span style="color:#323232; font-weight: bold; font-size: 135%;">Berkeley Engineering</span>] blog.<br />
</div><br />
<br />
<br />
<div><br />
====<font size=4><font color=dodgerblue>'''news articles</font><font color=mediumseagreen> about iGEM'''</font></font>====<br />
<br />
<br />
If you would like to share an article that was written about iGEM or your iGEM team, please link to it on this page. If you have multiple articles featuring your team, link to them all individually!<br />
<br />
Post the name of your team, the title of your article, where it was featured, and provide a link to it. <br />
<br />
''Example'':<br> <br />
'''Team Example''': ''Title of article'', Nature, [link]<br />
<br />
*'''National Geographic News''': ''New Biological "Machines" Fight Disease, Produce Power'' [http://news.nationalgeographic.com/news/2008/11/081112-synthetic-biology.html National Geographic News]<br />
*'''Finalists''': ''New Biological "Machines" Fight Disease, Produce Power'' [http://news.nationalgeographic.com/news/pf/17802599.html National Geographic]<br />
*[http://radar.oreilly.com/archives/2007/12/stories-we-want-1.html '''O'Reilly Radar: Looking Forward to iGEM in 2008''']<br />
*[http://www.sciencefriday.com/program/archives/200802291 '''Science Friday: Anticipating Synthetic Biology] ([http://podcastdownload.npr.org/anon.npr-podcasts/podcast/510221/87816117/npr_87816117.mp3 mp3 here)]<br />
<br />
<br />
*'''Hawaii''': "Bioengineers bring home awards from iGEM", [http://media.www.kaleo.org/media/storage/paper872/news/2008/12/04/News/Bioengineers.Bring.Home.Awards.From.Igem-3568981.shtml Ka Leo O Hawaii (December 4th, 2008)]<br />
<br />
* '''Alberta NINT & University of Alberta''' "U of A students bring home hardware from iGEM competition", [http://www.expressnews.ualberta.ca/article.cfm?id=9758 University of Alberta Express News (November 13, 2008)]<br />
<br />
* '''Alberta NINT''' "iGEM Jamboree Attracts 7 Alberta Student Teams", [http://www.innovationanthology.com/programs.php?id=195 Innovation Anthology (November 6, 2008)] [http://www.innovationanthology.com/uploads/Innovation%20Anthology%20182.mp3 (mp3 here)]<br />
<br />
* '''Alberta NINT & University of Alberta''' "Success of Butanerds fires up competitive spirit in synthetic biology", [http://www.expressnews.ualberta.ca/article.cfm?id=9605 University of Alberta Express News (September 18, 2008)] <br />
* '''Guelph''' "Student Project Aims to Prevent Blindness in Children Using Bacteria", [http://www.uoguelph.ca/news/2008/11/post_151.html University of Guelph Press Release (November 13, 2008)] <br />
* '''Guelph''' "Student Project Aims to Prevent Blindness in Children Using Bacteria", [http://news.guelphmercury.com/News/BreakingNews/article/403883 The Guelph Mercury (November 13, 2008)] <br />
* '''Guelph''' "Guelph Team wins metal at MIT iGEM", [http://www.plant.uoguelph.ca/news/archive/fall2008.html Plant Agriculture News (November 13, 2008)] <br />
*'''Guelph''' "Student Project Aims to Prevent Blindness in Children Using Bacteria", [http://www.exchangemagazine.com/morningpost/2008/week46/Friday/111416.htm Exchange Morning Post (November 14,2008)] <br />
*'''Guelph''' "Researchers at the University of Guelph Make Bacteria with Unusual Properties", [http://www.youtube.com/watch?v=6AWAuOkJm1c 1460 CJOY AM (November 14, 2008)]<br />
<br />
*'''Guelph''' "Guelph team wins at international science competition at MIT - project has potential to solve problem of vitamin A deficiency", [http://theontarion.ca/viewarticle.php?id_pag=2067 The Ontarion; The University of Guelph's Independant Student Newspaper (November 20, 2008)]<br />
* '''KULeuven''': ''"Synthetische biologie: Open source biologie" ("Synthetic biology: Open source biology")'', [https://static.igem.org/mediawiki/2008/a/ac/22-23_memo7_synthetischebiologie.pdf C<sub>2</sub>W Life Sciences (July 12 2008) & MeMo (September 11 2008)] (MeMo is a magazine of the [http://www.kvcv.be/ Koninklijke Vlaamse Chemische Vereniging])<br />
* '''KULeuven''': ''"Studenten K.U.Leuven met ontwerp intelligente bacterie Dr. Coli in MIT-wedstrijd synthetische biologie" ("Students of K.U.Leuven with design of intelligent bacterium Dr. Coli in MIT-competition synthetic biology")'', [http://dagkrant.kuleuven.be/?q=node/5098 Dagkrant K.U.Leuven (September 1 2008)]<br />
*'''MIT+Caltech''': ''Engineering Edible Bacteria'', [http://www.technologyreview.com/printer_friendly_article.aspx?id=21654 MIT Tech Review] (with video)<br />
* '''Rice''':''"Better beer: college team creating anti-cancer brew",'' [http://www.media.rice.edu/media/NewsBot.asp?MODE=VIEW&ID=11642 Rice University News and Media (October 17th, 2008)]<br />
* '''Rice''':''"'BioBeer' with wine's cancer fighting qualities",'' [http://www.dailyindia.com/show/277686.php Daily India (October 17th, 2008)]<br />
* '''Rice''':''"College students making anti-cancer beer,'' [http://www.upi.com/Health_News/2008/10/17/College_students_making_anti-cancer_beer/UPI-33191224299305/ United Press International (October 17th, 2008)]<br />
* '''Rice''':''"Drink beer to avoid cancer…",'' [http://blogs.zdnet.com/emergingtech/?p=1067 ZDNet (October 17th, 2008)]<br />
* '''Rice''':''"Coming soon, ”BioBeer” with wine’’s cancer fighting qualities",'' [http://www.thaindian.com/newsportal/india-news/coming-soon-biobeer-with-wines-cancer-fighting-qualities_100108232.html Thaindian.com/ANI wire (October 17th, 2008)]<br />
* '''Rice''':''"College Team Create Anticancer 'BioBeer' For Entry In Synthetic Biology's IGEM Contest",'' [http://www.medicalnewstoday.com/articles/125887.php Medical News Today (October 17th, 2008)]<br />
* '''Rice''':''"Rice Biology Students: Making Beer Better",'' [http://blogs.houstonpress.com/hairballs/2008/10/biobeer_genetic_resveratrol.php Houston Press (October 17th, 2008)]<br />
* '''Rice''':''"Can drinking beer help cure cancer?",'' [http://mobile.itwire.com/content/view/21268/1066/ IT Wire (October 17th, 2008)]<br />
* '''Rice''':''"Creating anticancer beer",'' [http://current.com/items/89430237_creating_anticancer_beer Current.com (October 20th, 2008)]<br />
* '''Rice''':''"It's Oktober: I'll Drink To That!",'' [http://www.popsci.com/rachel-durfee/article/2008-10/its-oktober-ill-drink?page= Popular Science, (October 21st, 2008)]<br />
* '''Rice''':''"University researchers developing cancer-fighting beer",'' [http://www.computerworld.com/action/article.do?command=printArticleBasic&taxonomyName=Development&articleId=9117656&taxonomyId=11 Computerworld, (October 21st, 2008)]<br />
* '''Rice''':''"Free Beer in an Unfree World",'' [http://reason.com/blog/show/129611.html Reason.com (October 22nd, 2008)]<br />
* '''Rice''':''"Researchers Developing Cancer-Fighting Beer",'' [http://science.slashdot.org/article.pl?sid=08/10/22/2230223&from=rss Slashdot (October 22nd, 2008)]<br />
* '''Rice''':''"Cold, Frosty and Healthy ...",'' [http://www.foxnews.com/story/0,2933,443798,00.html Fox News (October 24th, 2008)]<br />
* '''Rice''':''"Snart kan öl bekämpa cancer",'' [http://www.metro.se/se/article/2008/10/24/15/4736-68/index.xml Metro Teknik (October 24th, 2008)]<br />
* '''Rice''':''"'Fancy a swift twother?'",'' [http://www.thepublican.com/story.asp?sectioncode=7&storycode=61591&c=1 The Publican (October 24th, 2008)]<br />
* '''Rice''':''"Breakthroughs, tips and trends: Beer therapy",'' [http://www.timesonline.co.uk/tol/life_and_style/health/article5007974.ece Times of London (October 25th, 2008)]<br />
* '''Rice''':''"BioBeer Fights Cancer And Gets You Drunk",'' [http://www.javno.com/en/world/clanak.php?id=196507 Javno (Croatia) (October 25th, 2008)]<br />
* '''Rice''':''"A beer that battles cancer?",'' [http://www.odt.co.nz/lifestyle/health/28866/a-beer-battles-cancer Otago Daily Times (New Zealand) (October 25th, 2008)]<br />
* '''Rice''':''"Geek Week: Geek-o-naut returns home, researchers go for the foam",'' [http://weblog.infoworld.com/robertxcringely/archives/2008/10/geek_week_geeko.html InfoWorld (October 27th, 2008)]<br />
* '''Rice''':''"Rice University Students Aim For Creating A Beer Healthier Than Red Wine",'' [http://www.allheadlinenews.com/articles/7012806080 All Headline News (October 27th, 2008)]<br />
* '''Rice''':''"University researchers developing cancer-fighting beer",'' [http://www.techworld.com.au/article/264626/university_researchers_developing_cancer-fighting_beer TechWorld Australia (This Computerworld story also appears in CIO Magazine, Australia) (October 28th, 2008)]<br />
* '''Rice''':''"Beer Drinkers Rejoice: Cancer-Fighting Beer in Development",'' [http://www.nationalledger.com/artman/publish/article_272623475.shtml The National Ledger (October 28th, 2008)]<br />
* '''Rice''':''"Anti-cancer beer under development",'' [http://www.cosmosmagazine.com/news/2278/anti-cancer-beer-under-development COSMOS magazine (October 29th, 2008)]<br />
* '''Rice''':''"Beer taps wine's health benefit",'' [http://www.signonsandiego.com/uniontrib/20081028/news_lz1c28lafee.html San Diego Union-Tribune (October 29th, 2008)]<br />
* '''TU Delft''': ''"Studenten pimpen bacteriën" ("Students pimp bacteria")'', [http://www.tudelft.nl/live/pagina.jsp?id=23acdd35-ef09-4bfc-bee6-19e0f974913f&lang=nl TU Delft news (June 25 2008)]<br />
* '''TU Delft''': ''"Synthetische biologie: Open source biologie" ("Synthetic biology: Open source biology")'', [http://www.biw.kuleuven.be/persberichten/fiches/c2wLS-080712.pdf C2W Life Sciences (July 12 2008)]<br />
* '''TU Delft''': ''"Creatief met genetische lego - studenten bouwen thermometerbacteriën in internationale competitie" ("Being creative with genetic lego - Students build thermometer bacteria in an international competition")'', NRC newspaper (August 21 2008)<br />
* '''TU Delft''': "Studenten maken een thermometerbacterie" ("Students engineer a thermometer bacterium"), [http://www.delta.tudelft.nl/nl/archief/artikel/studenten-maken-een-thermometerbacterie/18466 ''TU Delta (September 25 2008)'']</div>Normanwanghttp://2008.igem.org/Team:HawaiiTeam:Hawaii2008-10-28T08:09:08Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/5/5b/Oahu_makapuu_UHM_TKT.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
<br />
{|class=wikitable align=center width=900<br />
!<big>Resources</big><br />
!<big>Parts</big><br />
!<big>Help</big><br />
!<big>Links</big><br />
|-<br />
|align=center|<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[https://2008.igem.org/Team:Hawaii/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
| align=center|<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
| align=center|<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
| align=center|<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
|}<br />
<br />
<html> <div align="center"><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="25"<br />
maxlength="450" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:80%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-10-28T08:08:48Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/5/5b/Oahu_makapuu_UHM_TKT.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Fri. Afternoon (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
=== Design ===<br />
*[[Team:Hawaii/Primer Design for BioBricking|Primer Design for BioBricking]]<br />
*[[Team:Hawaii/Norman's Primer Design Notes|Norman's Primer Design Notes]]<br />
*[[Team:Hawaii/Adam's Primer Design Notes|Adam's Primer Design Notes]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/File:Oahu_makapuu_TKT.jpgFile:Oahu makapuu TKT.jpg2008-10-28T08:07:33Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:Oahu_makapuu_UHM.jpgFile:Oahu makapuu UHM.jpg2008-10-28T08:06:58Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:Oahu_makapuu_UHM_TKT.jpgFile:Oahu makapuu UHM TKT.jpg2008-10-28T08:06:18Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-10-28T07:28:27Z<p>Normanwang: /* Design */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Fri. Afternoon (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
=== Design ===<br />
*[[Team:Hawaii/Primer Design for BioBricking|Primer Design for BioBricking]]<br />
*[[Team:Hawaii/Norman's Primer Design Notes|Norman's Primer Design Notes]]<br />
*[[Team:Hawaii/Adam's Primer Design Notes|Adam's Primer Design Notes]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-10-28T07:27:24Z<p>Normanwang: /* Design */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Fri. Afternoon (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
=== Design ===<br />
*[[Team:Hawaii/Primer Design for BioBricking]]<br />
*[[Team:Hawaii/Norman's Primer Design Notes|Norman's Primer Design Notes]]<br />
*[[Team:Hawaii/Adam's Primer Design Notes|Adam's Primer Design Notes]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Primer_Design_for_BioBrickingPrimer Design for BioBricking2008-10-28T07:27:08Z<p>Normanwang: Primer Design for BioBricking moved to Team:Hawaii/Primer Design for BioBricking</p>
<hr />
<div>#REDIRECT [[Team:Hawaii/Primer Design for BioBricking]]</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Primer_Design_for_BioBrickingTeam:Hawaii/Primer Design for BioBricking2008-10-28T07:27:08Z<p>Normanwang: Primer Design for BioBricking moved to Team:Hawaii/Primer Design for BioBricking</p>
<hr />
<div>=== U. Hawaii BioBrick Primer Design Procedure ===<br />
==== 1. Assess BioBrickability ====<br />
* Assess gene BioBricking feasibility. Analyze sequence for existing BioBrick sites to see if additional processing is needed before designing BioBricking primers. [http://syntheticbiology.org/BioBricks/Part_fabrication.html#These_sites_MUST_be_absent site removal reference]<br />
: '''These_sites_MUST_be_absent''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#These_sites_MUST_be_absent]<br />
:: <pre>EcoRI, XbaI, SpeI, PstI, NotI</pre><br />
: '''Strongly prefer that these sites be absent''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Strongly_prefer_that_these_sites_be_absent]<br />
:: ApoI (probably impossible because it occurs frequently), MfeI, AvrII, NheI, NsiI, SbfI <br />
: '''Would prefer that these sites be absent''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Would_prefer_that_these_sites_be_absent]<br />
:: Offset cutters<br />
:: <pre>AarI, AcuI (medium priority), BbsI, BbvCI, BciVI (would be nice, medium priority), BfuAI (high priority), BmrI (high priority), BsmBI, BsaI, BsgI (medium priority), BsmI (includes nicking enzyme, high priority), BspMI, BsrDI (includes nicking enzyme, high priority), BtgZI, EarI, EcoP15I (high priority), FokI (best effort), Nt.BstNBI, SapI (high priority, should already be eliminated from EarI), TspRI (probably difficult, best effort)</pre><br />
:: Nicking enzymes<br />
:: <pre>Nt.BstNBI, BbvCI, Nt.AlwI (best effort to at least remove sites near each other)</pre><br />
:: Homing endonucleases<br />
:: <pre>I-CeuI, I-SceI, PI-PspI, PI-SceI, I-PpoI</pre><br />
:: Others<br />
:: <pre>AgeI, AscI, FseI, RsrII, SgrAI, XmnI, XcmI</pre><br />
: '''Would be convenient if these sites were removed''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Would_be_convenient_if_these_sites_were_removed]<br />
:: These are common, efficient cutters that people might want to use.<br />
:: <pre> HindIII, BamHI, XhoI, NcoI, SacI, NdeI </pre><br />
:: Here are other low priority cut sites to remove<br />
:: <pre>KasI, MssI, NgoMIV, PacI, PmeI, SalI, SfiI, SgfI, SmiI, SrfI, SwaI, XmaI, ZraI</pre><br />
: '''Sites to include''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Sites_to_include]<br />
:: Having GATC sites in your part can sometimes be useful because it allows plasmid purified DNA to be cut (via DpnI) whereas PCR product DNA is not. Such a trick is useful for some site directed mutagenesis protocols. <br />
: '''Miscellaneous''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Miscellaneous]<br />
:: BaeI is an enzyme whose is exact cut position is unknown. It is explicitly included in some pSB plasmid replications origins so that the plasmid can optionally be destroyed via another enzyme. You may want to eliminate this site from your part if you intend to use this feature of the BioBricks plasmids.<br />
<br />
==== 2. Make Primers ====<br />
* Pick first ~20 and last ~20(reverse complement) residues of full length desired region for making primers, adjust cut length at 3' boundry according to calculated Tm. (target for 60C Tm for first-cycle annealing to your target DNA). Account for necessary adjustments such as replacing stop codon with TAATAA (where replaced region no longer match/anneal to template) . Only calculate Tm for region that is annealing to target site in the first cycle.<br />
** we would like to standardize Tm calculation algorithm used by all team members. <br />
Please use:[http://scitools.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]<br />
with the parameters: Oligo content of 0.4 uM, Na+ concentration of 50 mM, Mg++ concentration of 2mM, and a dNTP concentration of 2mM.<br />
<br />
==== 3. Attach BioBrick Ends ====<br />
* Attach biobrick ends accordingly, using the table below. Calculate the primer+extension Tm.<br />
<br />
===== Back-Insert Primers (X-SP, preferred) =====<br />
====== Prefix [X] ======<br />
<pre><br />
EcoRI NotI XbaI<br />
GAATTC GCGGCCGC T TCTAGA G<br />
<br />
regular<br />
cct T TCTAGA G [anything]<br />
<br />
protein (A=overlaps XbaI A, T=spacer, G=n/a)<br />
cct T TCTAG [ATG]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
cct T TCTAGA [no start ATG]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
====== Suffix [SP] ======<br />
<pre><br />
PstI NotI SpeI<br />
CTGCAG CGGCCGC T ACTAGT A<br />
<br />
regular<br />
aagg CTGCAG CGGCCGC T ACTAGT A [anything]<br />
<br />
protein<br />
aagg CTGCAG CGGCCGC T ACTAGT A [TTA TTA double stop codon]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
aagg CTGCAG CGGCCGC T ACTAGT [no stop codon]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
===== Front-Insert Primers (EX-S, not preferred) =====<br />
====== Prefix [EX] ======<br />
<pre><br />
EcoRI NotI XbaI<br />
at GAATTC GCGGCCGC T TCTAGA G<br />
<br />
regular<br />
at GAATTC GCGGCCGC T TCTAGA G [anything]<br />
<br />
protein (A=overlaps XbaI A, T=spacer, G=n/a)<br />
at GAATTC GCGGCCGC T TCTAG [ATG]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
at GAATTC GCGGCCGC T TCTAGA [no start ATG]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
====== Suffix [S] ======<br />
<pre><br />
PstI NotI SpeI<br />
CTGCAG CGGCCGC T ACTAGT A<br />
<br />
regular<br />
c T ACTAGT A [anything]<br />
<br />
protein<br />
c T ACTAGT A [TTA TTA double stop codon]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
c T ACTAGT [no stop codon]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
===== Back-Insert De Novo Synthesis [prefix]-[gene]-[suffix] =====<br />
Forward Strand: 5'-3'<br />
<pre><br />
de novo synthesis regular<br />
CTAGA G [anything ] T ACTAGT A GCGGCCG CTGCA<br />
- - -------------- - ------ - ------- -<br />
de novo synthesis protein<br />
CTAG [ATG-----TAATAA] T ACTAGT A GCGGCCG CTGCA<br />
-------------- - ------ - ------- -<br />
de novo synthesis fusionbricks<br />
CTAGA [nostart-nostop] ACTAGT A GCGGCCG CTGCA<br />
- -------------- ------ - ------- -<br />
de novo synthesis endinbricks<br />
<br />
</pre><br />
<br />
Reverse Strand: 5'-3'<br />
<pre><br />
de novo synthesis regular<br />
G CGGCCGC T ACTAGT A [anything ] C T<br />
----- ------- - ------ - -------------- - -----<br />
de novo synthesis protein<br />
G CGGCCGC T ACTAGT A [TTATTA-----CAT] <br />
----- ------- - ------ - -------------- ----<br />
de novo synthesis fusionbricks<br />
G CGGCCGC T ACTAGT [nostart-nostop] T<br />
----- ------- - ------ -------------- -----<br />
de novo synthesis endinbricks<br />
<br />
</pre><br />
<br />
==== 4. Error Checking ====<br />
# use [http://scitools.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]<br />
#* hairpins<br />
#* self-dimer<br />
#* hetero-dimers<br />
<br />
=== Tools ===<br />
* IDT OligoAnalyser [http://scitools.idtdna.com/analyzer/Applications/OligoAnalyzer/IDT OligoAnalyzer]<br />
** Oligo content of 0.4 uM <br />
** Na+ concentration of 50 mM<br />
** Mg++ concentration of 2mM<br />
** dNTP concentration of 2mM<br />
* Alternative Tools<br />
*# [http://bioinfo.ut.ee/oligotm/ oligoTM] (web interface to primer3 package's oligotm algorithm)<br />
*# [http://www.promega.com/biomath/calc11.htm Nifty alternative tool] to calculate Tm for oligos (thanks Grace!)<br />
<br />
=== Design Notes ===<br />
* [[Team:Hawaii/Norman's Primer Design Notes|Norman's Primer Design Notes]]<br />
* [[Tean:Hawaii/Adam's Primer Design Notes|Adam's Primer Design Notes]]<br />
<br />
=== References ===<br />
* [http://hdl.handle.net/1721.1/21168 Idempotent Vector Design for Standard Assembly of BioBricks] by [http://openwetware.org/wiki/Tom_Knight Tom Knight]<br />
* [http://openwetware.org/wiki/Cfrench:bbprimerdesign BioBrick Primer Design Notes by Chris French]<br />
* [http://partsregistry.org/cgi/htdocs/Assembly/rbs_cds.cgi RBS & Protein Coding Sequence biobricking primer design considerations]<br />
* [http://syntheticbiology.org/BioBricks/Part_fabrication.html Syntheticbiology.org Biobrick Part Fabrication notes]<br />
* [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp NEB: Number of extra spacer nucleotides needed for efficient restriction digestion]</div>Normanwanghttp://2008.igem.org/Tean:Hawaii/Adam%27s_Primer_Design_NotesTean:Hawaii/Adam's Primer Design Notes2008-10-28T07:26:38Z<p>Normanwang: Tean:Hawaii/Adam's Primer Design Notes moved to Team:Hawaii/Adam's Primer Design Notes</p>
<hr />
<div>#REDIRECT [[Team:Hawaii/Adam's Primer Design Notes]]</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Adam%27s_Primer_Design_NotesTeam:Hawaii/Adam's Primer Design Notes2008-10-28T07:26:38Z<p>Normanwang: Tean:Hawaii/Adam's Primer Design Notes moved to Team:Hawaii/Adam's Primer Design Notes</p>
<hr />
<div>Below are my notes on how a biobrick primer must work in detail, and how they must be constructed. Silver lab and the Paris team have very similar methods for primer construction. My prefix and suffix sequences are Silvers, but they are exactly how they should be put on the 5 prime end of the primer. Someone should check, but I think this is it.<br />
[[Image:BiobrickPCR.jpg|800px]]<br />
[[Image:PrimerInfo.jpg|800px]]</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Adam%27s_Primer_Design_NotesTeam:Hawaii/Adam's Primer Design Notes2008-10-28T07:25:01Z<p>Normanwang: New page: Below are my notes on how a biobrick primer must work in detail, and how they must be constructed. Silver lab and the Paris team have very similar methods for primer construction. My pre...</p>
<hr />
<div>Below are my notes on how a biobrick primer must work in detail, and how they must be constructed. Silver lab and the Paris team have very similar methods for primer construction. My prefix and suffix sequences are Silvers, but they are exactly how they should be put on the 5 prime end of the primer. Someone should check, but I think this is it.<br />
[[Image:BiobrickPCR.jpg|800px]]<br />
[[Image:PrimerInfo.jpg|800px]]</div>Normanwanghttp://2008.igem.org/File:PrimerInfo.jpgFile:PrimerInfo.jpg2008-10-28T07:24:12Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:BiobrickPCR.jpgFile:BiobrickPCR.jpg2008-10-28T07:23:59Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/Team:Hawaii/Norman%27s_Primer_Design_NotesTeam:Hawaii/Norman's Primer Design Notes2008-10-28T07:23:18Z<p>Normanwang: New page: == Method Variation Comparisons == === Alignment Of Various Methods === <pre> Forward 5’-3’ EcoRI NotI XbaI ...</p>
<hr />
<div>== Method Variation Comparisons ==<br />
=== Alignment Of Various Methods ===<br />
<pre><br />
Forward 5’-3’<br />
EcoRI NotI XbaI SpeI NotI PstI<br />
[1] defined by Knight 2003 GAATTC GCGGCCGC T TCTAGA G [ ] T ACTAGT A GCGGCCG CTGCAG<br />
[2] wetware RBS & TT gtttcttc GAATTC GCGGCCGC T TCTAGA G [ ]<br />
[3] wetware Protein gtttcttc GAATTC GCGGCCGC T TCTAG [ATG start ]<br />
[4] wetware ("Designing_Primers") cct T TCTAGA G [ ]<br />
[5] silver PCR ends (fusion brick) cct T TCTAGA [ ]<br />
[6] silver Oligo Synthesis (fusion brick) CTAGA [fwd coding sequence ] ACTAGT A GCGGCCG CTGCA <br />
<br />
Reverse 5’-3’<br />
PstI NotI SpeI XbaI NotI EcoRI<br />
[1] defined by Knight 2003 CTGCAG CGGCCGC T ACTAGT A [ ] C TCTAGA A GCGGCCGC GAATTC<br />
[2] wetware RBS & TT gtttcttc CTGCAG CGGCCGC T ACTAGT A [ ] <br />
[3] wetware Protein gtttcttc CTGCAG CGGCCGC T ACTAGT A [TTA TTA double stop codon ]<br />
[4] wetware ("Designing_Primers") aagg CTGCAG CGGCCGC T ACTAGT A [ ] <br />
[5] silver PCR ends (fusion brick) aagg CTGCAG CGGCCGC T ACTAGT [ ] <br />
[6] silver Oligo Synthesis (fusion brick) G CGGCCGC T ACTAGT [rvc coding sequence ] T<br />
</pre><br />
<br />
=== OpenWetware Wiki Referenced as of 6/16/2008 ===<br />
:[1] http://dspace.mit.edu/handle/1721.1/21168 (has error in XbaI site, reverse complement should be AGATCT instead of ACATCT)<br />
:[2] http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication#Quick_reference<br />
:[3] http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication#Quick_reference_2<br />
:[4] http://openwetware.org/wiki/Designing_primers#BioBrick_primers<br />
:[5] http://openwetware.org/wiki/Silver:_PCR<br />
:[6] http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts<br />
:[7] http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix<br />
:[8] http://openwetware.org/wiki/Cfrench:bbprimerdesign<br />
<br />
=== Notes: ===<br />
* lowercase letters denote unknown (reason?) extensions<br />
* spacers (*) exist between: NotI * XbaI * [gene] * SpeI * NotI, fusion bricks are missing spacers flaking [gene]<br />
* wetware protein definition removed AG before the gene. last A of XbaI overlaps with ATG of start codon; G is a spacer and is removed.<br />
* NotI recognition/cut site is 8 letters; the second NotI site in BioBrick Definition is only 7 letters because its last C overlaps with first C of the following PstI<br />
* {fusion brick} It is important to note that the spacer nucleotides between the part and the XbaI and SpeI sites were originally incorporated in order to prevent DNA methylation and its consequential inhibition of the required restriction enzymes. These spacer nucleotides are not present in the assembly strategy presented here {silver fusion brick}. Hence, it is required to prescreen parts to ensure that methylation sites are not incorporated. Dam methylation of the XbaI site is the most critical. Parts beginning with the sequences TCx create a site capable of inhibiting XbaI. If a desired part naturally begins with this sequence (coding for serine), it is necessary to change the first codon to either AGT or AGC (both also encoding serine).<br />
<br />
<br />
== Excerpt of Various Methods ==<br />
<br />
=== Use this approach for promoters, ribosome binding sites, terminators and most other BioBricks parts. ===<br />
<br />
http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication#Quick_reference<br />
<pre><br />
Quick reference<br />
<br />
Once you are ready to design your primers for making a BioBrick, you can copy and paste the following sequences into your primers.<br />
<br />
Copy and paste the following 30 bp sequence onto the 5' end of your upstream primer:<br />
5' ---> 3'<br />
GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG<br />
<br />
Copy and paste the following 29 bp sequence onto the 5' end of your downstream primer:<br />
5' ---> 3'<br />
GTT TCT TCC TGC AGC GGC CGC TAC TAG TA<br />
</pre><br />
<br />
=== Use this approach for proteins ===<br />
<br />
http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication#Quick_reference_2<br />
<pre><br />
Construction of protein coding sequences in BioBricks form requires slightly specialized BioBricks prefixes and suffixes for two reasons.<br />
<br />
1. The prefix is slightly altered to ensure appropriate spacing between the ribsome binding site and the start codon.<br />
2. BioBricks coding sequences standardly end with two sequential TAA stop codons. <br />
<br />
Quick reference<br />
<br />
Once you are ready to design your primers for making a BioBrick, you can copy and paste the following sequences into your primers.<br />
<br />
Copy and paste the following 31 bp sequence onto the 5' end of your upstream primer for your coding sequence:<br />
includes the ATG start codon!<br />
5' ---> 3'<br />
GTT TCT TCG AAT TCG CGG CCG CTT CTA G [ATG start]<br />
<br />
Copy and paste the following 35 bp sequence onto the 5' end of your downstream primer for your coding sequence:<br />
includes the TAATAA double stop codon!<br />
5' ---> 3'<br />
GTT TCT TCC TGC AGC GGC CGC TAC TAG TA [TTA TTA double stop codon]<br />
</pre><br />
<br />
=== (WRONG INSTRUCTION: suffix primer needs to be reverse complemented) ===<br />
<br />
http://openwetware.org/wiki/Designing_primers<br />
<pre><br />
To BioBrick a part, the following tails should be added to your primers:<br />
<br />
* PREFIX Primer cctttctagag 11 bp<br />
* SUFFIX Primer tactagtagcggccgctgcagcctt 25 bp <br />
<br />
The prefix primer adds an Xba I site, and the suffix adds the entire BB suffix (Spe I-Not I-Pst I)<br />
<br />
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles). <br />
</pre><br />
<br />
=== Silver Lab PCR Strategy ===<br />
<br />
http://openwetware.org/wiki/Silver:_PCR<br />
<pre><br />
For typical BioBricks construction, you want a PCR product which has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part.<br />
Then, the forward primer should be of the form:<br />
5' CCTTTCTAGA (15-20 bp of the coding strand) 3'<br />
and the reverse primer should be of the form:<br />
5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'<br />
</pre><br />
<br />
=== Silver Lab Oligo Strategy (total chemical synthesis of DNA) ===<br />
<br />
http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts<br />
<pre><br />
Design of oligonucleotide inserts<br />
<br />
* The sense oligo should be of the form:<br />
5' CTAGA(coding sequence)ACTAGTAGCGGCCGCTGCA 3'<br />
* The anti-sense oligo should be of the form:<br />
5' GCGGCCGCTACTAGT(reverse complement of coding sequence)T 3' <br />
</pre></div>Normanwanghttp://2008.igem.org/Team:Hawaii/Primer_Design_for_BioBrickingTeam:Hawaii/Primer Design for BioBricking2008-10-28T07:22:46Z<p>Normanwang: New page: === U. Hawaii BioBrick Primer Design Procedure === ==== 1. Assess BioBrickability ==== * Assess gene BioBricking feasibility. Analyze sequence for existing BioBrick sites to see if additi...</p>
<hr />
<div>=== U. Hawaii BioBrick Primer Design Procedure ===<br />
==== 1. Assess BioBrickability ====<br />
* Assess gene BioBricking feasibility. Analyze sequence for existing BioBrick sites to see if additional processing is needed before designing BioBricking primers. [http://syntheticbiology.org/BioBricks/Part_fabrication.html#These_sites_MUST_be_absent site removal reference]<br />
: '''These_sites_MUST_be_absent''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#These_sites_MUST_be_absent]<br />
:: <pre>EcoRI, XbaI, SpeI, PstI, NotI</pre><br />
: '''Strongly prefer that these sites be absent''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Strongly_prefer_that_these_sites_be_absent]<br />
:: ApoI (probably impossible because it occurs frequently), MfeI, AvrII, NheI, NsiI, SbfI <br />
: '''Would prefer that these sites be absent''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Would_prefer_that_these_sites_be_absent]<br />
:: Offset cutters<br />
:: <pre>AarI, AcuI (medium priority), BbsI, BbvCI, BciVI (would be nice, medium priority), BfuAI (high priority), BmrI (high priority), BsmBI, BsaI, BsgI (medium priority), BsmI (includes nicking enzyme, high priority), BspMI, BsrDI (includes nicking enzyme, high priority), BtgZI, EarI, EcoP15I (high priority), FokI (best effort), Nt.BstNBI, SapI (high priority, should already be eliminated from EarI), TspRI (probably difficult, best effort)</pre><br />
:: Nicking enzymes<br />
:: <pre>Nt.BstNBI, BbvCI, Nt.AlwI (best effort to at least remove sites near each other)</pre><br />
:: Homing endonucleases<br />
:: <pre>I-CeuI, I-SceI, PI-PspI, PI-SceI, I-PpoI</pre><br />
:: Others<br />
:: <pre>AgeI, AscI, FseI, RsrII, SgrAI, XmnI, XcmI</pre><br />
: '''Would be convenient if these sites were removed''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Would_be_convenient_if_these_sites_were_removed]<br />
:: These are common, efficient cutters that people might want to use.<br />
:: <pre> HindIII, BamHI, XhoI, NcoI, SacI, NdeI </pre><br />
:: Here are other low priority cut sites to remove<br />
:: <pre>KasI, MssI, NgoMIV, PacI, PmeI, SalI, SfiI, SgfI, SmiI, SrfI, SwaI, XmaI, ZraI</pre><br />
: '''Sites to include''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Sites_to_include]<br />
:: Having GATC sites in your part can sometimes be useful because it allows plasmid purified DNA to be cut (via DpnI) whereas PCR product DNA is not. Such a trick is useful for some site directed mutagenesis protocols. <br />
: '''Miscellaneous''' [http://syntheticbiology.org/BioBricks/Part_fabrication.html#Miscellaneous]<br />
:: BaeI is an enzyme whose is exact cut position is unknown. It is explicitly included in some pSB plasmid replications origins so that the plasmid can optionally be destroyed via another enzyme. You may want to eliminate this site from your part if you intend to use this feature of the BioBricks plasmids.<br />
<br />
==== 2. Make Primers ====<br />
* Pick first ~20 and last ~20(reverse complement) residues of full length desired region for making primers, adjust cut length at 3' boundry according to calculated Tm. (target for 60C Tm for first-cycle annealing to your target DNA). Account for necessary adjustments such as replacing stop codon with TAATAA (where replaced region no longer match/anneal to template) . Only calculate Tm for region that is annealing to target site in the first cycle.<br />
** we would like to standardize Tm calculation algorithm used by all team members. <br />
Please use:[http://scitools.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]<br />
with the parameters: Oligo content of 0.4 uM, Na+ concentration of 50 mM, Mg++ concentration of 2mM, and a dNTP concentration of 2mM.<br />
<br />
==== 3. Attach BioBrick Ends ====<br />
* Attach biobrick ends accordingly, using the table below. Calculate the primer+extension Tm.<br />
<br />
===== Back-Insert Primers (X-SP, preferred) =====<br />
====== Prefix [X] ======<br />
<pre><br />
EcoRI NotI XbaI<br />
GAATTC GCGGCCGC T TCTAGA G<br />
<br />
regular<br />
cct T TCTAGA G [anything]<br />
<br />
protein (A=overlaps XbaI A, T=spacer, G=n/a)<br />
cct T TCTAG [ATG]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
cct T TCTAGA [no start ATG]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
====== Suffix [SP] ======<br />
<pre><br />
PstI NotI SpeI<br />
CTGCAG CGGCCGC T ACTAGT A<br />
<br />
regular<br />
aagg CTGCAG CGGCCGC T ACTAGT A [anything]<br />
<br />
protein<br />
aagg CTGCAG CGGCCGC T ACTAGT A [TTA TTA double stop codon]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
aagg CTGCAG CGGCCGC T ACTAGT [no stop codon]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
===== Front-Insert Primers (EX-S, not preferred) =====<br />
====== Prefix [EX] ======<br />
<pre><br />
EcoRI NotI XbaI<br />
at GAATTC GCGGCCGC T TCTAGA G<br />
<br />
regular<br />
at GAATTC GCGGCCGC T TCTAGA G [anything]<br />
<br />
protein (A=overlaps XbaI A, T=spacer, G=n/a)<br />
at GAATTC GCGGCCGC T TCTAG [ATG]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
at GAATTC GCGGCCGC T TCTAGA [no start ATG]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
====== Suffix [S] ======<br />
<pre><br />
PstI NotI SpeI<br />
CTGCAG CGGCCGC T ACTAGT A<br />
<br />
regular<br />
c T ACTAGT A [anything]<br />
<br />
protein<br />
c T ACTAGT A [TTA TTA double stop codon]<br />
<br />
fusion protein (skips spacer to be in-frame)<br />
c T ACTAGT [no stop codon]<br />
<br />
edinbricks?<br />
<br />
</pre><br />
<br />
===== Back-Insert De Novo Synthesis [prefix]-[gene]-[suffix] =====<br />
Forward Strand: 5'-3'<br />
<pre><br />
de novo synthesis regular<br />
CTAGA G [anything ] T ACTAGT A GCGGCCG CTGCA<br />
- - -------------- - ------ - ------- -<br />
de novo synthesis protein<br />
CTAG [ATG-----TAATAA] T ACTAGT A GCGGCCG CTGCA<br />
-------------- - ------ - ------- -<br />
de novo synthesis fusionbricks<br />
CTAGA [nostart-nostop] ACTAGT A GCGGCCG CTGCA<br />
- -------------- ------ - ------- -<br />
de novo synthesis endinbricks<br />
<br />
</pre><br />
<br />
Reverse Strand: 5'-3'<br />
<pre><br />
de novo synthesis regular<br />
G CGGCCGC T ACTAGT A [anything ] C T<br />
----- ------- - ------ - -------------- - -----<br />
de novo synthesis protein<br />
G CGGCCGC T ACTAGT A [TTATTA-----CAT] <br />
----- ------- - ------ - -------------- ----<br />
de novo synthesis fusionbricks<br />
G CGGCCGC T ACTAGT [nostart-nostop] T<br />
----- ------- - ------ -------------- -----<br />
de novo synthesis endinbricks<br />
<br />
</pre><br />
<br />
==== 4. Error Checking ====<br />
# use [http://scitools.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]<br />
#* hairpins<br />
#* self-dimer<br />
#* hetero-dimers<br />
<br />
=== Tools ===<br />
* IDT OligoAnalyser [http://scitools.idtdna.com/analyzer/Applications/OligoAnalyzer/IDT OligoAnalyzer]<br />
** Oligo content of 0.4 uM <br />
** Na+ concentration of 50 mM<br />
** Mg++ concentration of 2mM<br />
** dNTP concentration of 2mM<br />
* Alternative Tools<br />
*# [http://bioinfo.ut.ee/oligotm/ oligoTM] (web interface to primer3 package's oligotm algorithm)<br />
*# [http://www.promega.com/biomath/calc11.htm Nifty alternative tool] to calculate Tm for oligos (thanks Grace!)<br />
<br />
=== Design Notes ===<br />
* [[Team:Hawaii/Norman's Primer Design Notes|Norman's Primer Design Notes]]<br />
* [[Tean:Hawaii/Adam's Primer Design Notes|Adam's Primer Design Notes]]<br />
<br />
=== References ===<br />
* [http://hdl.handle.net/1721.1/21168 Idempotent Vector Design for Standard Assembly of BioBricks] by [http://openwetware.org/wiki/Tom_Knight Tom Knight]<br />
* [http://openwetware.org/wiki/Cfrench:bbprimerdesign BioBrick Primer Design Notes by Chris French]<br />
* [http://partsregistry.org/cgi/htdocs/Assembly/rbs_cds.cgi RBS & Protein Coding Sequence biobricking primer design considerations]<br />
* [http://syntheticbiology.org/BioBricks/Part_fabrication.html Syntheticbiology.org Biobrick Part Fabrication notes]<br />
* [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp NEB: Number of extra spacer nucleotides needed for efficient restriction digestion]</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-10-28T07:20:58Z<p>Normanwang: /* Parts */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Fri. Afternoon (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
=== Design ===<br />
*[[Primer Design for BioBricking]]<br />
*[[Norman's Primer Design Notes]]<br />
*[[Adam's Primer Design Notes]]<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/ExperimentTeam:Hawaii/Experiment2008-10-28T07:01:57Z<p>Normanwang: /* In Progress */</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
'''[[Template:Team:Hawaii/Experiment|Experiment Template]]'''<br />
== In Progress ==<br />
<onlyinclude><br />
* [[Team:Hawaii/Ligation of pRL1383a Parts| Ligation of pRL1383a Parts]]<br />
* [[Team:Hawaii/Construction of BioBrick intermediates|Construction of BioBrick intermediates]]<br />
* [[Team:Hawaii/Construction of Broad-Host-Range Expression Vector| Construction of Broad-Host-Range Expression Vector]]<br />
* [[Team:Hawaii/Construction of Omega Interposon BioBrick | Construction of Omega Interposon BioBrick]]<br />
* [[Team:Hawaii/Antibiotic_test_for_BB-pRL1383a |Antibiotic test for BB-pRL1383a]]<br />
* [[Team:Hawaii/Antibiotic_test_for_aadA construct|Antibiotic test for ''aadA'' construct]]<br />
</onlyinclude><br />
<br />
== Not Started ==<br />
<br />
* [[Team:Hawaii/PCC6803 Electroporation of PCC6803 | Electroporation of PCC6803]]<br />
<br />
== Completed ==<br />
<!-- More Recent Entries On Top --><br />
<br />
* [[Team:Hawaii/PCR Amplification of pRL1383a| PCR Amplification of pRL1383a]]<br />
* [[Team:Hawaii/PCC6803_cell_density| PCC6803 cell density test]]<br />
* [[Team:Hawaii/PCC6803 Cryostock Thaw Test | PCC6803 Cryostock Thaw Test]]<br />
* [[Team:Hawaii/Effect of CO2 on Growth Experiment | Effect of CO<sub>2</sub> on Growth Experiment]]<br />
* [[Team:Hawaii/Effect of Water Motion on Clumping of Liquid Cultures | Effect of Water Motion on Clumping of Liquid Cultures]]<br />
* [[Team:Hawaii/Make Competent E. Coli | Make Competent E. Coli]]<br />
* [[Team:Hawaii/Test Competent E. Coli | Test Competent E. Coli]]<br />
* [[Team:Hawaii/Initial E. Coli Transformation | Initial E. Coli Transformation]]<br />
* [[Team:Hawaii/Initial BioBrick Plasmid Extraction From Filter Paper|Initial BioBrick Plasmid Extraction From Filter Paper]]<br />
* [[Team:Hawaii/Biobricks_extraction_&_transformation_competency_test| Biobricks extraction/transformation competency test]]<br />
* [[Team:Hawaii/Initial PCC6803 Transformation | Initial PCC6803 Transformation]]<br />
* [[Team:Hawaii/Tri-parental_conjugation_between_E. coli_and_PCC6803 | Tri-parental conjugation between ''E. coli'' and PCC6803]]<br />
* [[Team:Hawaii/Plasmid_Prep | Mini Plasmid Prep]]<br />
* [[Team:Hawaii/Large-Scale Preparation of Plasmid from E. coli | Large-Scale Preparation of Plasmid]]<br />
* [[Team:Hawaii/Initial_Synth._Oligo_Assembly| Initial Synthetic Oligonucleotide Assembly]]<br />
* [[Team:Hawaii/Biobrick_conversions|Conversion of GFP into a fusion brick and pRL1383a into a Biobrick vector]]<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/TeamTeam:Hawaii/Team2008-10-28T06:47:43Z<p>Normanwang: /* Advisors */</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
{|align="justify"<br />
|-<br />
|[[Image:IMG_1638.JPG|left|thumb|300px|Jamie Allison (Lab Technician), Norman Wang, Krystle Salazar, Grace Kwan, Margaret Ruzicka, Gernot Presting, Sean Callahan]]<br />
|valign="top"|[[Image:IMG_1669.JPG|right|thumb|340px|iGEM 2008 - Hawaii]]''Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting.''<br />
|-<br />
|}<br />
<br />
==The team==<br />
=== Students ===<br />
<onlyinclude><br />
* [[Special:Contributions/MargaretRuzicka|Margaret Ruzicka (MargaretRuzicka)]]<br />
* [[Special:Contributions/Gracek|Grace Kwan (Gracek)]]<br />
* [[Special:Contributions/Ksalazar|Krystle Salazar (Ksalazar)]]<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<br />
<gallery><br />
Image:GK.png|<div style="text-align: center;">Grace Kwan<br> ''"Where did all the gummy bears go?"''</div><br />
Image:MR.png|<div style="text-align: center;">Margaret Ruzicka<br> ''"You just have to believe you're awesome and fabulous."''</div> <br />
Image:KS.png|<div style="text-align: center;">Krystle Salazar <br> ''"Oooh, shiny..."''</div><br />
</gallery><br />
|}<br />
<br />
===Advisors===<br />
<onlyinclude><br />
* [[Special:Contributions/Normanwang|Norman Wang (Normanwang)]]<br />
* Adam Baker<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<gallery><br />
Image:wang.jpg|[http://openwetware.org/wiki/User:Norman_Wang <div style="text-align: center;">Norman Wang]</div><br />
Image:AB.png|<div style="text-align: center;">Adam Baker</div><br />
</gallery><br />
|}<br />
<br />
===Faculty===<br />
<onlyinclude><br />
* [http://genomics.hawaii.edu/prestinglab/ Dr. Gernot Presting]<br />
* [http://www2.hawaii.edu/~scallaha/SMCsite/ Dr. Sean Callahan]<br />
* [http://www.ctahr.hawaii.edu/mbbe/faculty/gautz.html Dr. Loren Gautz]<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<gallery><br />
Image:presting.JPG|[http://genomics.hawaii.edu/prestinglab/ <div style="text-align: center;">Gernot Presting]</div><br />
Image:callahan.jpg|[http://www2.hawaii.edu/~scallaha/SMCsite/ <div style="text-align: center;">Sean Callahan] <br>''aka Cookie Monster''</div><br />
Image:gautz.jpg|[http://www.ctahr.hawaii.edu/mbbe/faculty/gautz.html <div style="text-align: center;"> Loren Gautz ] <br>''"Uncle Loren"''</div><br />
</gallery><br />
|}<br />
<br />
== Facts ==<br />
* The Hawaii team really likes gummi bears and cookies. Our gummy bear diet can be (and often has been) substituted with [http://en.wikipedia.org/wiki/Swedish_fish Swedish Fish].<br />
** At the highest consumption rate, we devoured two pounds of gummy bears during a three hour meeting.<br />
<br />
* When combined, Grace's and Krystle's initials are a palindrome (KSGSK). Norman claims they speak and dress alike to confuse faculty and advisors.<br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/File:Wang.jpgFile:Wang.jpg2008-10-28T06:47:13Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/Team:Hawaii/TeamTeam:Hawaii/Team2008-10-28T06:42:58Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
{|align="justify"<br />
|-<br />
|[[Image:IMG_1638.JPG|left|thumb|300px|Jamie Allison (Lab Technician), Norman Wang, Krystle Salazar, Grace Kwan, Margaret Ruzicka, Gernot Presting, Sean Callahan]]<br />
|valign="top"|[[Image:IMG_1669.JPG|right|thumb|340px|iGEM 2008 - Hawaii]]''Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting.''<br />
|-<br />
|}<br />
<br />
==The team==<br />
=== Students ===<br />
<onlyinclude><br />
* [[Special:Contributions/MargaretRuzicka|Margaret Ruzicka (MargaretRuzicka)]]<br />
* [[Special:Contributions/Gracek|Grace Kwan (Gracek)]]<br />
* [[Special:Contributions/Ksalazar|Krystle Salazar (Ksalazar)]]<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<br />
<gallery><br />
Image:GK.png|<div style="text-align: center;">Grace Kwan<br> ''"Where did all the gummy bears go?"''</div><br />
Image:MR.png|<div style="text-align: center;">Margaret Ruzicka<br> ''"You just have to believe you're awesome and fabulous."''</div> <br />
Image:KS.png|<div style="text-align: center;">Krystle Salazar <br> ''"Oooh, shiny..."''</div><br />
</gallery><br />
|}<br />
<br />
===Advisors===<br />
<onlyinclude><br />
* [[Special:Contributions/Normanwang|Norman Wang (Normanwang)]]<br />
* Adam Baker<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<gallery><br />
Image:Unnatural_evolution.png|[http://openwetware.org/wiki/User:Norman_Wang <div style="text-align: center;">Norman Wang]</div><br />
Image:AB.png|<div style="text-align: center;">Adam Baker</div><br />
</gallery><br />
|}<br />
<br />
===Faculty===<br />
<onlyinclude><br />
* [http://genomics.hawaii.edu/prestinglab/ Dr. Gernot Presting]<br />
* [http://www2.hawaii.edu/~scallaha/SMCsite/ Dr. Sean Callahan]<br />
* [http://www.ctahr.hawaii.edu/mbbe/faculty/gautz.html Dr. Loren Gautz]<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<gallery><br />
Image:presting.JPG|[http://genomics.hawaii.edu/prestinglab/ <div style="text-align: center;">Gernot Presting]</div><br />
Image:callahan.jpg|[http://www2.hawaii.edu/~scallaha/SMCsite/ <div style="text-align: center;">Sean Callahan] <br>''aka Cookie Monster''</div><br />
Image:gautz.jpg|[http://www.ctahr.hawaii.edu/mbbe/faculty/gautz.html <div style="text-align: center;"> Loren Gautz ] <br>''"Uncle Loren"''</div><br />
</gallery><br />
|}<br />
<br />
== Facts ==<br />
* The Hawaii team really likes gummi bears and cookies. Our gummy bear diet can be (and often has been) substituted with [http://en.wikipedia.org/wiki/Swedish_fish Swedish Fish].<br />
** At the highest consumption rate, we devoured two pounds of gummy bears during a three hour meeting.<br />
<br />
* When combined, Grace's and Krystle's initials are a palindrome (KSGSK). Norman claims they speak and dress alike to confuse faculty and advisors.<br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/File:Callahan.jpgFile:Callahan.jpg2008-10-28T06:41:47Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:Presting.JPGFile:Presting.JPG2008-10-28T06:40:43Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:Gautz.jpgFile:Gautz.jpg2008-10-28T06:40:20Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/Team:Hawaii/Meeting/2008-10-27Team:Hawaii/Meeting/2008-10-272008-10-28T06:20:01Z<p>Normanwang: New page: {{Team:Hawaii/Header}} == Agenda == # progress updates == Minutes == Present: Gernot, Sean, Loren, Grace, Margaret, Krystle, Norman # Parts to be submitted: ## 7 parts from GK, KS ## ...</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
== Agenda ==<br />
<br />
# progress updates<br />
<br />
== Minutes ==<br />
<br />
Present: Gernot, Sean, Loren, Grace, Margaret, Krystle, Norman<br />
<br />
# Parts to be submitted:<br />
## 7 parts from GK, KS<br />
## 5 parts from MR<br />
<br />
== Action Items ==<br />
<br />
* get presentation ready. possibly do practice presentation by this Friday 10/31, revise with suggestions, practice presenting again next Monday.<br />
<br />
== Coming Up ==<br />
<br />
* practice presentation Monday<br />
* poster<br />
<br />
{{Team:Hawaii/Footer}}</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-10-28T06:17:28Z<p>Normanwang: /* Meetings (t) */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Fri. Afternoon (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-10-28T06:17:00Z<p>Normanwang: /* Notebook (t) */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=10 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Thu. 9-10 (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=09 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Notebook/2008-10-20Team:Hawaii/Notebook/2008-10-202008-10-20T12:51:49Z<p>Normanwang: New page: {{Team:Hawaii/Header}} = Things we did today = == Wetlab work == ===Name of Task=== :<strong> name of person/people who performed the task</strong> :* Summary of task and what was done. ...</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
= Things we did today =<br />
== Wetlab work ==<br />
===Name of Task===<br />
:<strong> name of person/people who performed the task</strong><br />
<br />
:* Summary of task and what was done. Link to experiment for detailed notes if necessary.<br />
:* e.g. worked on &lt;blah experiment link&gt;, PCR, ran gel<br />
<br />
== Drylab Work ==<br />
<br />
===Name of Task===<br />
:<strong> name of person/people who performed the task</strong><br />
<br />
:* Summary of task and what was done. Link to experiment for detailed notes if necessary.<br />
:* e.g. read through papers, worked on proposal, etc.<br />
<br />
<br />
= Discussion =<br />
<br />
= Quote of the Day =<br />
<blockquote>''Garbage truck dripping E. coli... this has got to stop. '' - Roswell Mayor, http://www.youtube.com/watch?v=f7mEb-p4F44 ''(ok maybe we should start taking Amp + Kan + Sm + Sp before going to the bathroom)''</blockquote><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Meeting/2008-10-_6Team:Hawaii/Meeting/2008-10- 62008-10-01T06:49:24Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
== Agenda ==<br />
<br />
# select top three track choice, see [https://2008.igem.org/Judging/Judging_Criteria#Area_Prizes description] (due Wednesday October 8, 11:59pm EST.)<br />
## Food or Energy <br />
## Environment<br />
## Health or Medicine<br />
## Manufacturing<br />
## New Application<br />
## Foundational Advance<br />
## Software<br />
<br />
== Minutes ==<br />
<br />
Present: &lt;Person A&gt;, &lt;Person B&gt;<br />
<br />
# <br />
<br />
== Action Items ==<br />
<br />
* &lt;Person A&gt;: Task<br />
* <br />
<br />
== Coming Up ==<br />
<br />
* <br />
*<br />
<br />
{{Team:Hawaii/Footer}}</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Meeting/2008-10-_6Team:Hawaii/Meeting/2008-10- 62008-10-01T06:48:12Z<p>Normanwang: New page: {{Team:Hawaii/Header}} == Agenda == # select top three track choice ## Food or Energy ## Environment ## Health or Medicine ## Manufacturing ## New Application ## Foundational Advance ##...</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
== Agenda ==<br />
<br />
# select top three track choice<br />
## Food or Energy <br />
## Environment<br />
## Health or Medicine<br />
## Manufacturing<br />
## New Application<br />
## Foundational Advance<br />
## Software<br />
<br />
== Minutes ==<br />
<br />
Present: &lt;Person A&gt;, &lt;Person B&gt;<br />
<br />
# <br />
<br />
== Action Items ==<br />
<br />
* &lt;Person A&gt;: Task<br />
* <br />
<br />
== Coming Up ==<br />
<br />
* <br />
*<br />
<br />
{{Team:Hawaii/Footer}}</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Meeting/2008-09-29Team:Hawaii/Meeting/2008-09-292008-09-30T01:04:18Z<p>Normanwang: New page: {{Team:Hawaii/Header}} == Agenda == # progress update ## Graystle :) ## Margaret == Minutes == Present: Dr. Callahan, Dr. Presting, Margaret, Grace, Krystle, Norman # Testing our part ...</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
== Agenda ==<br />
<br />
# progress update<br />
## Graystle :)<br />
## Margaret<br />
<br />
== Minutes ==<br />
<br />
Present: Dr. Callahan, Dr. Presting, Margaret, Grace, Krystle, Norman<br />
# Testing our part in Cyanobacteria<br />
## Sm/Sp resistence of our plasmid (emergency or the pMARG100)<br />
## plasmid prep and verify size<br />
### plasmid prep to transform E. coli<br />
### grow E. coli to obtain enough plasmid<br />
### verify size by RE digest<br />
## get plasmid by copy size by compare chromosomal vs plasmid in rtPCR (may take a week to get this to work)<br />
<br />
== Action Items ==<br />
<br />
* Grace/Krystle get what we have into the emergency vector (without TT for now)<br />
* 1 week countdown to do triparental conjugation into cyano (takes 2 weeks to grow)<br />
<br />
== Coming Up ==<br />
<br />
* Oct 8th select Track <br />
[https://2008.igem.org/Judging/Judging_Criteria#Area_Prizes Judging Criteria Area Descriptions]<br />
<br />
<br />
<pre><br />
Dear iGEM participants,<br />
<br />
In order to group similar projects together so that they may be judged<br />
fairly, the judging committee has come up with the following area<br />
tracks:<br />
<br />
Food or Energy<br />
Environment<br />
Health or Medicine<br />
Manufacturing<br />
New Application<br />
Foundational Advance<br />
Software<br />
<br />
You can find descriptions of each track on the Judging Criteria page.<br />
<br />
The judging committee hopes to award prizes in the above areas,<br />
conditional on the accomplishments presented by the teams. Each prize<br />
will be awarded at the discretion of the judges.<br />
<br />
<br />
We ask that each team indicate their top three choices by sending an<br />
email to judging@igem.org. Please remember to include your team name.<br />
The deadline is Wednesday October 8, 11:59pm EST.<br />
<br />
Once the judging committee has received all of the team preferences and<br />
assigned each team to a track, we will post the assignments so that you<br />
may review which track you are part of.<br />
<br />
<br />
<br />
Thank you,<br />
<br />
iGEM judging committee<br />
</pre><br />
<br />
{{Team:Hawaii/Footer}}</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Notebook/2008-09-24Team:Hawaii/Notebook/2008-09-242008-09-26T09:31:17Z<p>Normanwang: /* Making Emergency BB Vector Insert (contaminant troubleshoot) */</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
= Things we did today =<br />
== Wetlab work ==<br />
===Verified plasmid preps===<br />
:<strong> Grace</strong><br />
<br />
:* PCR of plasmid preps from yesterday to verify inserts<br />
::* Ran PCR products on gel<br />
:::* nrg #1 and nrsg #2 returned blanks. Bad plasmid prep?<br />
:::* BB-pRL1383a and colony PCR of BB-pRL1383a ''E. coli'' both blank. Yikes!<br />
:* Quantified BB-pRL1383a and pSB1A3 plasmid preps<br />
::* Blanks. Really low conc.? Will nanodrop to check.<br />
<br />
===Construction of secretion device (cont.)===<br />
:<strong>Grace</strong><br />
<br />
:* Overnight RE digest:<br />
::* nir, nrsg, and nrg PCR products with EcoRI and SpeI<br />
::* rgt PCR products with XbaI and PstI<br />
::* J33207 PCR product and pRL1383a plasmid with HindIII and BamHI<br />
<br />
===Prep for sequencing===<br />
:<strong> Grace</strong><br />
<br />
:* nrg #4, nrg #7, nrsg #8, rgt #1, rgt #2<br />
:* plac+rbs<br />
::* PCR machine froze while ExoSAPing. Unable to retrieve samples from machine. Jamie says she will figure it out.<br />
<br />
===Making Emergency BB Vector Insert (help contaminant troubleshoot)===<br />
[[Image:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.annotated.jpg|thumb|right|making x6 Parallel MCS Replacement fragmenets via PCR Redo!!! with clean uncontaminated primers [[Media:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.jpg|download unannotated]]]]<br />
:<strong>Norman</strong><br />
:* Cross posted in [[Team:Hawaii/Notebook/2008-09-23|2008-09-23]] for comparison with contaminated PCR gel run.<br />
<div style="clear:both"></div><br />
<br />
= Discussion =<br />
<br />
= Quote of the Day =<br />
<blockquote>''History is the only laboratory we have in which to test the consequences of thought.'' - Étienne Gilson</blockquote><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Notebook/2008-09-24Team:Hawaii/Notebook/2008-09-242008-09-26T09:29:20Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
= Things we did today =<br />
== Wetlab work ==<br />
===Verified plasmid preps===<br />
:<strong> Grace</strong><br />
<br />
:* PCR of plasmid preps from yesterday to verify inserts<br />
::* Ran PCR products on gel<br />
:::* nrg #1 and nrsg #2 returned blanks. Bad plasmid prep?<br />
:::* BB-pRL1383a and colony PCR of BB-pRL1383a ''E. coli'' both blank. Yikes!<br />
:* Quantified BB-pRL1383a and pSB1A3 plasmid preps<br />
::* Blanks. Really low conc.? Will nanodrop to check.<br />
<br />
===Construction of secretion device (cont.)===<br />
:<strong>Grace</strong><br />
<br />
:* Overnight RE digest:<br />
::* nir, nrsg, and nrg PCR products with EcoRI and SpeI<br />
::* rgt PCR products with XbaI and PstI<br />
::* J33207 PCR product and pRL1383a plasmid with HindIII and BamHI<br />
<br />
===Prep for sequencing===<br />
:<strong> Grace</strong><br />
<br />
:* nrg #4, nrg #7, nrsg #8, rgt #1, rgt #2<br />
:* plac+rbs<br />
::* PCR machine froze while ExoSAPing. Unable to retrieve samples from machine. Jamie says she will figure it out.<br />
<br />
===Making Emergency BB Vector Insert (contaminant troubleshoot)===<br />
[[Image:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.annotated.jpg|thumb|right|making x6 Parallel MCS Replacement fragmenets via PCR Redo!!! with clean uncontaminated primers [[Media:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.jpg|download unannotated]]]]<br />
:<strong>Norman</strong><br />
:* Cross posted in [[Team:Hawaii/Notebook/2008-09-23|2008-09-23]] for comparison with contaminated PCR gel run.<br />
<div style="clear:both"></div><br />
<br />
= Discussion =<br />
<br />
= Quote of the Day =<br />
<blockquote>''History is the only laboratory we have in which to test the consequences of thought.'' - Étienne Gilson</blockquote><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-09-25T08:21:17Z<p>Normanwang: /* Meetings (t) */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=09 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Thu. 9-10 (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=09 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-09-25T08:21:04Z<p>Normanwang: /* Notebook (t) */</p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=09 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Thu. 9-10 (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=08 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Notebook/2008-09-23Team:Hawaii/Notebook/2008-09-232008-09-25T06:19:20Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
= Things we did today =<br />
== Wetlab work ==<br />
===Plasmid prep===<br />
:<strong> Grace</strong><br />
<br />
:* pSB1A3<br />
:* rbs+GFPf+tt #1, 2<br />
:* nir+rbs+GFP #1, 4, 7<br />
:* nir+rbs+slr1+GFPf #2, 8<br />
:* nir+rbs+pilA #18<br />
<br />
===Sequencing===<br />
<br />
<br />
<br />
:<strong> Margaret</strong><br />
[[Image:rep_9_23.jpg|right|thumb|300px|1st lane is ladder, 2nd lane is rep amplified from a colony, 3rd lane is rep amplified from a restriction product of rep from the same colony.]]<br />
<br />
:*PCR of rep, ran a gel to verify size, and exo-sap. will send in tomorrow<br />
<div style="clear:both;"><br />
<br />
===PCR: pRL1383a MCS Replacement===<br />
:'''Norman'''<br />
[[Image:20080923-emergency_vector_pRLBB_vector_insert_PCR.annotated.jpg|thumb|right|making x6 Parallel MCS Repalcement fragmenets via PCR using OLD PRIMERS!!! [[Media:20080923-emergency_vector_pRLBB_vector_insert_PCR.jpg|download unannotated]]]]<br />
[[Image:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.annotated.jpg|thumb|right|making x6 Parallel MCS Repalcement fragmenets via PCR Redo!!! with clean uncontaminated primers [[Media:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.jpg|download unannotated]]]]<br />
* x6 parallel MCS replacements fragment by PCR amplification. PCR out each MCS replacement insert with HindIII-VF2BB_fx._sb.1 and BamHI-VRBB_rx._sb.1<br />
*# BBa_I52002 from pSB4A5 (Spring 2008 Plate 1022 1C)<br />
*# BBa_I52001 from pSB4T5 (Spring 2008 Plate 1020 1A)<br />
*# BBa_I52002 from BBa_I51020 (BBa_I51020 Base Vector from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-A3 INV-Z80-R1-A3])<br />
*# BBa_P1010 from pSB1A3 (pSB1A3 from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-A3 INV-Z80-R1-A3])<br />
*# BBa_P1010 from pSB1A7 (pSB1A7 from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-A3 INV-Z80-R1-A3])<br />
*# BBa_J33207 from pSB1A2 ([http://partsregistry.org/wiki/index.php/Part:BBa_J33207 BBa_J33207] harboring pSB1A2 from plasmid prep)<br />
* x2 (or x3) Controls<br />
*# positive control: [http://partsregistry.org/wiki/index.php/Part:BBa_K125805 BBa_K125805] from pSB1A3 ([http://partsregistry.org/wiki/index.php/Part:BBa_K125805 BBa_K125805] harboring pSB1A3 from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-D4 INV-Z80-R1-D4])<br />
*# negative control: H<sub>2</sub>O primer set used on 1-7<br />
*# negative control: H<sub>2</sub>O old Bam-VF2BB Hind-VRBB primers<br />
<br />
<div style="clear:both;"><br />
= Discussion =<br />
<br />
= Quote of the Day =<br />
<blockquote>''History is the only laboratory we have in which to test the consequences of thought.'' - Étienne Gilson</blockquote><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/File:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.jpgFile:20080924-emergency vector pRLBB vector insert PCR redo.jpg2008-09-25T06:14:35Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:20080924-emergency_vector_pRLBB_vector_insert_PCR_redo.annotated.jpgFile:20080924-emergency vector pRLBB vector insert PCR redo.annotated.jpg2008-09-25T06:14:26Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:20080923-emergency_vector_pRLBB_vector_insert_PCR.jpgFile:20080923-emergency vector pRLBB vector insert PCR.jpg2008-09-25T05:34:43Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/File:20080923-emergency_vector_pRLBB_vector_insert_PCR.annotated.jpgFile:20080923-emergency vector pRLBB vector insert PCR.annotated.jpg2008-09-25T05:34:36Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/Team:Hawaii/Notebook/2008-09-23Team:Hawaii/Notebook/2008-09-232008-09-24T09:13:21Z<p>Normanwang: MCS replacment redo. PCR amplify BB insert for replacing pRL1383a-BamHI-HindIII with BB sites</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
= Things we did today =<br />
== Wetlab work ==<br />
===Plasmid prep===<br />
:<strong> Grace</strong><br />
<br />
:* pSB1A3<br />
:* rbs+GFPf+tt #1, 2<br />
:* nir+rbs+GFP #1, 4, 7<br />
:* nir+rbs+slr1+GFPf #2, 8<br />
:* nir+rbs+pilA #18<br />
<br />
===Sequencing===<br />
:<strong> Margaret</strong><br />
[[Image:rep_9_23.jpg|right|thumb|300px|1st lane is ladder, 2nd lane is rep amplified from a colony, 3rd lane is rep amplified from a restriction product of rep from the same colony.]]<br />
<br />
:*PCR of rep, ran a gel to verify size, and exo-sap. will send in tomorrow<br />
<br />
===PCR: pRL1383a MCS Replacement===<br />
:'''Norman'''<br />
* x6 parallel MCS replacements fragment by PCR amplification. PCR out each MCS replacement insert with HindIII-VF2BB_fx._sb.1 and BamHI-VRBB_rx._sb.1<br />
*# BBa_I52002 from pSB4A5 (Spring 2008 Plate 1022 1C)<br />
*# BBa_I52001 from pSB4T5 (Spring 2008 Plate 1020 1A)<br />
*# BBa_I52002 from BBa_I51020 (BBa_I51020 Base Vector from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-A3 INV-Z80-R1-A3])<br />
*# BBa_P1010 from pSB1A3 (pSB1A3 from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-A3 INV-Z80-R1-A3])<br />
*# BBa_P1010 from pSB1A7 (pSB1A7 from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-A3 INV-Z80-R1-A3])<br />
*# BBa_J33207 from pSB1A2 ([http://partsregistry.org/wiki/index.php/Part:BBa_J33207 BBa_J33207] harboring pSB1A2 from plasmid prep)<br />
* x2 Controls<br />
*# positive control: [http://partsregistry.org/wiki/index.php/Part:BBa_K125805 BBa_K125805] from pSB1A3 ([http://partsregistry.org/wiki/index.php/Part:BBa_K125805 BBa_K125805] harboring pSB1A3 from glycerol stock Inventory [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/INV-Z80-R1-D4 INV-Z80-R1-D4])<br />
*# negative control: H<sub>2</sub>O<br />
<br />
<br />
= Discussion =<br />
<br />
= Quote of the Day =<br />
<blockquote>''History is the only laboratory we have in which to test the consequences of thought.'' - Étienne Gilson</blockquote><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Meeting/2008-09-_8Team:Hawaii/Meeting/2008-09- 82008-09-06T11:12:01Z<p>Normanwang: New page: {{Team:Hawaii/Header}} == Agenda == # Exchange Lab Techniques & Protocols ## plasmid prep using low media volume, big flask (Margaret) ## SAP treatment of vector to prevent self-ligation...</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
== Agenda ==<br />
<br />
# Exchange Lab Techniques & Protocols<br />
## plasmid prep using low media volume, big flask (Margaret)<br />
## SAP treatment of vector to prevent self-ligation, success? (Grace/Krystle)<br />
## Gel cutting using SYBRSafe+Blue Light, [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Project:Phytoleum/Experiment/phaE_T855C_SigE_G855C_BioBricking_Site_Directed_Mutagenesis#Track_Yield_Loss_from_PCR.2C_post_ExoSAP.2FRestriction_Digestion.2C_and_post_Gel_Purification_Kit Yield Loss at each step](NW)<br />
## 70min [http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Phosphorylation_and_Hybridization_of_Oligonucleotide_Insert PNK+Oligo Annealing Protocol] (NW)<br />
# Updates of progress from the past two weeks<br />
## Grace<br />
### Re-replacement of BB-pRL1383a MCS<br />
## Krystle<br />
### GFPf w/ tt? GFP w/ tt?<br />
## Margaret<br />
### Rep, OriT, OriV, etc...<br />
### aadA, Omega<br />
### P1 Lytic<br />
## Norman<br />
### Bioplastic synthase operon (phaABCE) construction progress<br />
### site directed mutagenesis of two genes phaE and "sigma master switch"<br />
# Logistics<br />
## Travel itinerary (NW)<br />
## Sign Waiver (All)<br />
<br />
== Minutes ==<br />
<br />
Present: &lt;Person A&gt;, &lt;Person B&gt;<br />
<br />
# <br />
<br />
== Action Items ==<br />
<br />
* &lt;Person A&gt;: Task<br />
* <br />
<br />
== Coming Up ==<br />
<br />
* <br />
*<br />
<br />
{{Team:Hawaii/Footer}}</div>Normanwanghttp://2008.igem.org/File:Igem_hawaii_2008.jpgFile:Igem hawaii 2008.jpg2008-09-06T09:46:53Z<p>Normanwang: </p>
<hr />
<div>5 laptops, 3 people... we put the computers to work!</div>Normanwanghttp://2008.igem.org/Team:Hawaii/EventTeam:Hawaii/Event2008-09-06T09:45:58Z<p>Normanwang: added photo</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
'''[[Calendar_of_Events|iGEM Competition Calendar of Events]]'''<br />
[[Image:Igem hawaii 2008.jpg|thumb|right|500px]]<br />
== Soon ==<br />
<onlyinclude><br />
* 2008.08.25 First Day of Instruction (Fall 2008)<br />
* 2008.08.27 Jamie leaves for vacation<br />
* 2008.09.09 Jamie returns<br />
</onlyinclude><br />
<br />
== Future ==<br />
* 2008.09.01 Labor Day<br />
* 2008.11.04 Election Day<br />
<br />
== Past ==<br />
* 2008.07.01 iGEM Fee due<br />
* 2008.07.01 Project Description Due<br />
* 2008.06.30 Second batch of primer ordering<br />
* 2008-06-12 Final draft of project proposals due<br />
** send proposal day before to advisers for review Q&A during meeting.<br />
* 2008-06-12 Parts required list, & primer designs due<br />
* 2008-06-05 Draft of project proposals due<br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/File:Igem_hawaii_2008.jpgFile:Igem hawaii 2008.jpg2008-09-06T09:41:49Z<p>Normanwang: </p>
<hr />
<div></div>Normanwanghttp://2008.igem.org/Team:Hawaii/Birds_Eye_ViewTeam:Hawaii/Birds Eye View2008-08-20T02:54:08Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Common.css}}<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2008/c/c9/Oahu_makapuu.jpg" alt="Oahu"><br />
</html><br />
<br />
{{Team:Hawaii/Header}}<br />
<br />
<!-- ##<content>## --><br />
{|<br />
|style="background-color:WhiteSmoke;border-width: 0px;padding: 3px;text-align:left;"|Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting. We envision a wide diversity of future broad-host-range BioBrick parts, created and transported, with this or similar BioBrick vectors; each designated to be compatible with specific organism(s). These modules can also be combinatorially transformed or combined into organisms as larger devices to produce desired products. [[Team:Hawaii/Project|more...]]<br />
|}<br />
{|<br />
|-valign="top"<br />
|width="240px"|<br />
<!-- ###<team>### --><br />
== <html><br />
<img src="http://openwetware.org/images/6/6d/Groups_turquoise.png" alt="Team"><br />
</html>[[Team:Hawaii/Team|Team]] ==<br />
{{:Team:Hawaii/Team}}<br />
== [[Team:Hawaii/Logistic|Logistics]] ==<br />
{{:Team:Hawaii/Logistic}}<br />
== [[Team:Hawaii/Sponsors|Sponsors]] ==<br />
{{:Team:Hawaii/Sponsors}}<br />
<!-- ###</team>### --><br />
<!-- ###<projects>### --><br />
|width="240px"|<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Projects"><br />
</html>[[Team:Hawaii/Project|Projects]] ==<br />
{{:Team:Hawaii/Project}}<br />
== [[Team:Hawaii/Experiment|Experiments]] ([[Template:Team:Hawaii/Experiment|t]]) ==<br />
{{:Team:Hawaii/Experiment}}<br />
== [[Team:Hawaii/Notebook|Notebook]] ([[Template:Team:Hawaii/Notebook|t]]) ==<br />
{{#calendar: title=Team:Hawaii/Notebook | year=2008 | month=08 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Notebook}}<br />
<!-- ###</projects>### --><br />
<!-- ###<events>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/0/06/Sblab.png" alt="Events"><br />
</html>[[Team:Hawaii/Event|Events]] ==<br />
{{:Team:Hawaii/Event}}<br />
== [[Team:Hawaii/Milestone|Milestones]] ==<br />
{{:Team:Hawaii/Milestone}}<br />
== [[Team:Hawaii/Meeting | Meetings]] ([[Template:Team:Hawaii/Meeting|t]]) ==<br />
Mon. 12-1 or Thu. 9-10 (as needed basis)<br />
{{#calendar: title=Team:Hawaii/Meeting | year=2008 | month=08 | format=%Y-%m-%e | query=preload=Template:Team:Hawaii/Meeting}}<br />
<!-- ###</events>### --><br />
<!-- ###<resources>### --><br />
|width="240px"|<br />
<br />
== <html><br />
<img src="http://openwetware.org/images/b/b1/Courses_violet.png" alt="Resources"><br />
</html>[[Team:Hawaii/Resources|Resources]] ==<br />
<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008/References References]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Protocols Protocols]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Inventory Inventory]<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/Shopping_List Ordering]<br />
=== Parts ===<br />
*[http://partsregistry.org/cgi/partsdb/search.cgi Parts Search]<br />
*[http://partsregistry.org/assembly/libraries.cgi?id=15 Parts Kit Content (Spring 2008)]<br />
*[http://partsregistry.org/Help:IGEM_08_DNA_distribution Parts Kit Instructions]<br />
*[[Team:Hawaii/Parts Extracted|Parts We Extracted]]<br />
*[[Team:Hawaii/Parts|Parts We Submitted]]<br />
<br />
=== Help ===<br />
*[http://partsregistry.org/wiki/index.php/Help:Contents BioBrick Help]<br />
*[[Team:Hawaii/Wiki Help|Wiki Help]]<br />
<html><br />
<form method="get" action="http://www.google.com/search"><br />
<div><br />
<input type="text" name="q" size="15"<br />
maxlength="255" value="" /><br />
<input type="submit" value="Google" /><br />
<div align="center" style="font-size:70%"><br />
Search <input type="radio" name="sitesearch" value="2008.igem.org"/>iGEM 2008<input type="radio" name="sitesearch" value="http://parts.mit.edu/igem07/"/>iGEM 2007<input type="radio" name="sitesearch" value="en.wikipedia.org"/>Wikipedia<br />
</div></div></form></html><br />
<br />
=== Links ===<br />
*[http://packrat.stjohn.hawaii.edu/prestinglab/wiki/iGEM:2008 Hawaii Team Private Homepage]<br />
*[https://2008.igem.org iGEM 2008 Homepage]<br />
*[http://partsregistry.org Parts Registry Homepage]<br />
<br />
=== Other Team Pages ===<br />
* [https://igem.org/Team_Wikis iGEM 2008]<br />
* [http://parts.mit.edu/igem07/index.php/IGEM2007_Team_List iGEM 2007] [http://parts.mit.edu/igem07/index.php/Results Winners] [http://parts.mit.edu/igem07/index.php/Presentations Presentations]<br />
* [http://parts2.mit.edu/wiki/index.php/Schools_Participating_in_iGEM_2006 iGEM 2006] [http://igem2006.com/results.htm Winners] [http://www.igem2006.com/presentations.htm Presentations]<br />
<br />
== [[Team:Hawaii/Protocols|Protocols]] ([[Template:Team:Hawaii/Protocol|t]]) ==<br />
<br />
<!-- ###</resources>### --><br />
|}<br />
<!-- ##</content>## --><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/ProjectTeam:Hawaii/Project2008-08-20T02:44:46Z<p>Normanwang: </p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
== Overall Project ==<br />
Cyanobacteria are frequently studied for their ability to harness the power of photosynthesis to produce a wide variety of useful products including bio-fuels and -polymers. Such tasks are accomplished by these "little green factories" with a minimal input of salts, light, water, and carbon dioxide required for growth and carbon biomass accumulation. We aim to expand the availability of BioBrick vectors to cyanobacteria in order to “open source” the current BioBrick registry to a greater range of organisms. <br />
<br><br><br />
We plan to engineer:<br><br />
: 1) a mobilizable broad-host-range BioBrick vector that can be used to transfer genetic information between ''E. coli'' and ''Synechocystis'' sp. 6803, with the future possibility of transforming plants via ''Agrobacterium'' and other bacteria transformable by RSF1010 based plasmids; <br><br />
: 2) a cassette for protein export from ''Synechocystis''; and<br />
: 3) the nitrate-inducible cyanobacterial nir promoter.<br />
<br />
The functionality of the parts we engineer will be demonstrated by achieving inducible protein production and export of GFP construct introduced into ''Synechocystis'' using our novel BioBrick mobilizable shuttle vector.<br />
<br />
== Project Details==<br />
<strong><onlyinclude>[[Team:Hawaii/Project/Part A|Part A]]: Mobilizable Broad-Host-Range Plasmid </onlyinclude></strong><br />
:RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (oriT) and rep genes with an associated origin of vegetative replication (oriV), respectively. We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks. The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. [[Team:Hawaii/Project/Part A|(''read more...'')]]<br />
<br />
<br />
<strong><onlyinclude>[[Team:Hawaii/Project/Part B|Part B]]: Cyanobacterial protein secretion system</onlyinclude><br />
</strong><br />
:Photosynthetic cyanobacteria provide the opportunity for autotrophic production of practically any biomolecule. The ability to extract engineered biomolecules would make this bacterium a renewable, nearly self-sustaining "factory"- a potentially valuable tool in bioengineering. For Part B, we will create BioBricks encoding naturally occurring signal peptides that can be combined with a protein coding sequence in order to express the protein of interest extracellularly. [[Team:Hawaii/Project/Part B|(''read more...'')]]<br />
<br />
== Results ==<br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/Notebook/2008-08-19Team:Hawaii/Notebook/2008-08-192008-08-20T02:37:04Z<p>Normanwang: New page: {{Team:Hawaii/Header}} = Things we did today = == Wetlab work == ===Name of Task=== :<strong> name of person/people who performed the task</strong> :* Summary of task and what was done. ...</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
<br />
= Things we did today =<br />
== Wetlab work ==<br />
===Name of Task===<br />
:<strong> name of person/people who performed the task</strong><br />
<br />
:* Summary of task and what was done. Link to experiment for detailed notes if necessary.<br />
:* e.g. worked on &lt;blah experiment link&gt;, PCR, ran gel<br />
<br />
== Drylab Work ==<br />
<br />
===Name of Task===<br />
:<strong> name of person/people who performed the task</strong><br />
<br />
:* Summary of task and what was done. Link to experiment for detailed notes if necessary.<br />
:* e.g. read through papers, worked on proposal, etc.<br />
<br />
<br />
= Discussion =<br />
<br />
= Quote of the Day =<br />
<blockquote>''What?!? Grrr......'' - Krystle</blockquote><br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/EventTeam:Hawaii/Event2008-08-18T19:44:57Z<p>Normanwang: /* Soon */</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
'''[[Calendar_of_Events|iGEM Competition Calendar of Events]]'''<br />
== Soon ==<br />
<onlyinclude><br />
* 2008.08.25 First Day of Instruction (Fall 2008)<br />
* 2008.08.27 Jamie leaves for vacation<br />
* 2008.09.09 Jamie returns<br />
</onlyinclude><br />
<br />
== Future ==<br />
* 2008.09.01 Labor Day<br />
* 2008.11.04 Election Day<br />
<br />
== Past ==<br />
* 2008.07.01 iGEM Fee due<br />
* 2008.07.01 Project Description Due<br />
* 2008.06.30 Second batch of primer ordering<br />
* 2008-06-12 Final draft of project proposals due<br />
** send proposal day before to advisers for review Q&A during meeting.<br />
* 2008-06-12 Parts required list, & primer designs due<br />
* 2008-06-05 Draft of project proposals due<br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwanghttp://2008.igem.org/Team:Hawaii/TeamTeam:Hawaii/Team2008-08-17T08:39:02Z<p>Normanwang: updated advisor photos... swedish fish.</p>
<hr />
<div>{{Team:Hawaii/Header}}<br />
{|align="justify"<br />
|-<br />
|[[Image:IMG_1638.JPG|left|thumb|300px|Jamie Allison (Lab Technician), Norman Wang, Krystle Salazar, Grace Kwan, Margaret Ruzicka, Gernot Presting, Sean Callahan]]<br />
|valign="top"|[[Image:IMG_1669.JPG|right|thumb|340px|iGEM 2008 - Hawaii]]''Our team aims to create the framework and tools for expanding the scope of BioBrick synthetic biology to organisms other than E. coli. Creation of a mobilizable broad-host-range plasmid enables the transfer of modularized and abstracted genetic components to act in wide range of organisms that share a similar pool of intermediate metabolites. A broad-host-range mobilizable vector would serve as a channel to "open source" the rich diversity of genetic information between organisms in a laboratory setting.''<br />
|-<br />
|}<br />
<br />
== Students ==<br />
<onlyinclude><br />
* [[Special:Contributions/MargaretRuzicka|Margaret Ruzicka (MargaretRuzicka)]]<br />
* [[Special:Contributions/Gracek|Grace Kwan (Gracek)]]<br />
* [[Special:Contributions/Ksalazar|Krystle Salazar (Ksalazar)]]<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<br />
<gallery><br />
Image:GK.png|<div style="text-align: center;">Grace Kwan</div><br />
Image:MR.png|<div style="text-align: center;">Margaret Ruzicka<br> ''"You just have to believe you're awesome and fabulous."''</div> <br />
Image:KS.png|<div style="text-align: center;">Krystle Salazar <br> ''"Oooh, shiny..."''</div><br />
</gallery><br />
|}<br />
<br />
===Advisors===<br />
<onlyinclude><br />
* [[Special:Contributions/Normanwang|Norman Wang (Normanwang)]]<br />
* Adam Baker<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<gallery><br />
Image:Unnatural_evolution.png|[http://openwetware.org/wiki/User:Norman_Wang <div style="text-align: center;">Norman Wang]</div><br />
Image:AB.png|<div style="text-align: center;">Adam Baker</div><br />
</gallery><br />
|}<br />
<br />
===Faculty===<br />
<onlyinclude><br />
* [http://genomics.hawaii.edu/prestinglab/ Dr. Gernot Presting]<br />
* [http://www2.hawaii.edu/~scallaha/SMCsite/ Dr. Sean Callahan]<br />
* [http://www.ctahr.hawaii.edu/mbbe/faculty/gautz.html Dr. Loren Gautz]<br />
</onlyinclude><br />
{|border = "0" align=center<br />
|-<br />
|rowspan="3"|<gallery><br />
Image:Swedishfish_y.jpg|[http://genomics.hawaii.edu/prestinglab/ <div style="text-align: center;">Gernot Presting]</div><br />
Image:Swedishfish_g.jpg|[http://www2.hawaii.edu/~scallaha/SMCsite/ <div style="text-align: center;">Sean Callahan] <br>''aka Cookie Monster''</div><br />
Image:Swedishfish_r.jpg|[http://www.ctahr.hawaii.edu/mbbe/faculty/gautz.html <div style="text-align: center;"> Loren Gautz ] <br>''"Uncle Loren"''</div><br />
</gallery><br />
|}<br />
<br />
== Facts ==<br />
* The Hawaii team really likes gummi bears and cookies. Our gummy bear diet are often substituted by [http://en.wikipedia.org/wiki/Swedish_fish Swedish Fish].<br />
** At the highest consumption rate, we devoured two pounds of gummy bears during a three hour meeting.<br />
* When combined, Grace and Krystal initials are palindromes (KSGSK), and tend to speak and dress alike to confuse faculty and advisors.<br />
<br />
{{Team:Hawaii/Footer}}<br />
<br />
__NOTOC__</div>Normanwang