http://2008.igem.org/wiki/index.php?title=Special:Contributions/Ruudjorna&feed=atom&limit=50&target=Ruudjorna&year=&month=2008.igem.org - User contributions [en]2024-03-29T05:04:52ZFrom 2008.igem.orgMediaWiki 1.16.5http://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-30T10:56:55Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
Fast links to different parts of the results:<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!BBa_K115012!!SEM*2 for BBa_K115012!!BBa_K115035!!SEM*2 for BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|0.30<br />
|1.00<br />
|0.10<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.04<br />
|1.92 <br />
|0.36<br />
|-<br />
|37ºC<br />
|4.66<br />
|2.18<br />
|17.6<br />
|7.52<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-30T10:56:37Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
Fast links to different parts of the results:<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!Luminescence fold increasement BBa_K115012!!SEM*2 for BBa_K115012!!BBa_K115035!!SEM*2 for BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|0.30<br />
|1.00<br />
|0.10<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.04<br />
|1.92 <br />
|0.36<br />
|-<br />
|37ºC<br />
|4.66<br />
|2.18<br />
|17.6<br />
|7.52<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelftTeam:TUDelft2008-10-30T10:50:31Z<p>Ruudjorna: /* The Project - Engineering a biothermometer */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
Welcome to the TU Delft 2008 iGEM wiki! On this page information about the project and its progress can be found. The climax of this project is the Jamboree in Boston, which will take place at the 8th and 9th of November in 2008. <br />
<br />
== The Team ==<br />
This is the first year the TU Delft participates in the iGEM competition. We are six undergraduate students, four instructors and a lot of advisors, willing to help out and think with us when this is necessary. An overview of the people involved and our competences can be found on the [[Team:TUDelft/Team|team]] page.<br />
<!-- It is a test --><br />
<br />
==The Project - Engineering a biothermometer==<br />
<br />
The goal of our project is to construct temperature-sensing bacteria ''Escherichia coli'' that changes color at different temperatures. Such a thermometer can be applied e.g. as a temperature reporter system in large-scale fermentations, or as a temperature-inducible protein production system. The functionality of this thermometer relies on the post-transcriptional regulation of a temperature-sensitive RNA structure: it opens and enables the ribosome to bind, only when the temperature exceeds a certain threshold. <br />
<br />
[[Image:System.png|thumb|200px|right|Black box representation of the biothermometer, with temperature as input and color as output. The system can be split into two subsystems: A temperature sensitive input system and a color producing output system. The temperature sensitive input system works as a switch, switching on the output system at a certain temperature.]]<br />
<br />
We designed new artificial temperature sensitive RNA sequences, and developed protocols, using luciferase as a reporter, to test their functionality. For the colour output, we built upon the existing carotene biosynthesis pathway and converted all new elements to the BioBrick standard. Furthermore, we developed mathematical models describing both the temperature sensitive parts and the colour mevalonate pathway, and estimated parameters using the experimental data. The ethical issues in design and possible implementation of a commercial product are also addressed. <br />
<br />
If you are interested in this project, we invite you to take a closer look at the website. For a more detailed summary of the project, please read the [[Team:TUDelft/Research_Proposal|research proposal]]. For an overview of the results obtained during the summer, please consult the [[Team:TUDelft/Deliverables|deliverables]] section.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-30T10:08:10Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
Fast links to different parts of the results:<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!BBa_K115012!!SEM*2 for BBa_K115012!!BBa_K115035!!SEM*2 for BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|0.30<br />
|1.00<br />
|0.10<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.04<br />
|1.92 <br />
|0.36<br />
|-<br />
|37ºC<br />
|4.66<br />
|2.18<br />
|17.6<br />
|7.52<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-30T10:06:49Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
Fast links to different parts of the results:<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!BBa_K115012!!SEM*2!!BBa_K115035!!SEM*2<br />
|-<br />
|20ºC<br />
|1.00<br />
|0.30<br />
|1.00<br />
|0.10<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.04<br />
|1.92 <br />
|0.36<br />
|-<br />
|37ºC<br />
|4.66<br />
|2.18<br />
|17.6<br />
|7.52<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-30T10:05:32Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
Fast links to different parts of the results:<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!BBa_K115012!!SEM*2!!!BBa_K115035!!SEM*2!<br />
|-<br />
|20ºC<br />
|1.00<br />
|<br />
|1.00<br />
|<br />
|- <br />
|30ºC<br />
|2.44<br />
|<br />
|1.92 <br />
|<br />
|-<br />
|37ºC<br />
|4.66<br />
|<br />
|17.6<br />
|<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Research_ProposalTeam:TUDelft/Research Proposal2008-10-30T09:53:22Z<p>Ruudjorna: /* Goals */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
== Research Proposal ==<br />
<br />
===Background===<br />
The international Genetically Engineered Machines or iGEM competition is an initiative of the Massachusetts Institute for Technology (MIT). From 2005 on this competition in synthetic biology has been organized and grown from five participants in 2005 to 80 participants this year. Basically the iGEM competition likes to address the following question: "Can simple biological systems be built from standard, interchangeable parts and operated in living cells? Or is biology just too complicated to be engineered in this way?" The three main reasons to begin organizing iGEM were <span id="cite_ref_1">[[Team:TUDelft/Research_Proposal#cite_note_1|[1]]]</span>:<br> <br />
<br />
1. To enable the systematic engineering of biology<br><br />
2. To promote the open and transparent development of tools for engineering biology<br><br />
3. To help construct a society that can productively apply biological technology<br><br />
<br />
In practice, the first two reasons comprise constructing an open source library of standardized biological parts. These parts of standardized stretches of DNA are called BioBricks. These BioBricks can be used to make sensory systems, oscillators, or other applications that can be performed by bacteria. The standardization of the parts is achieved by placing a known standard sequence before and after each part (pre- and suffix) that is made. The prefix and suffix consist of three known restriction enzyme sites, this means every part can be cut and pasted if the right combination of restriction enzymes is used. Of course this requires the restriction sites to be absent in any of the stretches of DNA between pre- and suffix. At present, there are thousands of these BioBricks. These make up promoters, terminators, regulatory elements and protein coding sequences of different sorts are some examples of what the BioBricks are. Within this setting student teams from all over the world are challenged to build an applicable system and add parts to the BioBrick library. Participants are encouraged to pursue ambitious projects, although there are no real requirements other than that it has fit into the iGEM setting.<br />
<br />
Our aim is to make <i>Escherichia coli</i> act as a thermometer, showing different colors when incubated at different temperatures. A micro sized thermometer can serve a number of purposes, e.g. creating surface temperature profiles in electronic and biological devices <span id="cite_ref_2">[[Team:TUDelft/Research_Proposal#cite_note_2|[2]]]</span>. Also these thermometers can play a analytical role in industrial fermentation. Controlling the temperature within a large volume is a big issue in industrial fermentations. If the temperature should not come above (or below) a certain threshold temperature, one could add the thermometer bacteria to the fermentation. With these bacteria added, it is possible to see whether the temperature did exceed the threshold by looking at the color of the bacteria. Another application would be to deliver on demand temperature inducable gene expression. The designed RNA sequences could be used to produce any gene above a chosen threshold temperature. The advantage of this system is that it does not need a chemical for induction that potentially can interfere with cellular processes. Within the iGEM open source setting, these sequences would become available to everyone.<br />
<br />
===Goals===<br />
Our project comprises several research goals. The first goal is to construct an RNA thermometer <span id="cite_ref_3">[[Team:TUDelft/Research_Proposal#cite_note_3|[3]]]</span> in vivo. Because it is probably not feasible to construct the whole system in the time available we will focus on several subgoals that would help create the RNA thermometer in future. These subgoals are: providing a sound theoretical basis for the functioning of an in vivo RNA thermometer, designing and testing temperature sensitive stretches of RNA and cloning protein coding sequences of enzymes involved in the color pathway. We will focus on standardizing all parts made during the project according to iGEM regulations. The second goal is to predict behavior of this system using computer models. The third goal of this project is to focus on ethical considerations of synthetic biology in general (on a macro scale) and the implications of using synthetic biology within the open source technology setting of iGEM (on a micro level). <br />
<br />
For sensing temperature (input) we are focusing on RNA thermometers. From literature, we will take 5’ UTR RNA sequences from organisms that have temperature sensitive induced protein expression or synthetic RNA sequences that have been shown to be able to induce temperature sensitive translation. The sources of these 5’ UTR sequences are heat shock proteins from e.g. ''Bradirhizobium japonicum'' <span id="cite_ref_4">[[Team:TUDelft/Research_Proposal#cite_note_4|[4]]]</span>, transcription factors from pathogenic bacteria <span id="cite_ref_5">[[Team:TUDelft/Research_Proposal#cite_note_5|[5]]]</span><span id="cite_ref_6">[[Team:TUDelft/Research_Proposal#cite_note_6|[6]]]</span> and designed temperature sensitive sequences <span id="cite_ref_8">[[Team:TUDelft/Research_Proposal#cite_note_8|[8]]]</span>. We will screen different varieties on the designed RNA thermometer sequences. Furthermore, we want to make an inducible system, so all influences except temperature can be kept constant. How an RNA thermometer works in vivo is depicted in figure 1.<br />
<br />
<br />
[[Image:TUDelftRNAthermometer.jpg|thumb|center|Figure 1. An RNA thermometer designed to switch at 37ºC.]]<br />
<br />
For the output on the system we want to obtain visibly colored <i>E. coli</i> colonies. To achieve this, we will introduce enzymes that originate from <i>Saccharomyces cerevisiae</i> and overexpress other <i>E. coli</i> enzymes in <i>E. coli</i>. These enzymes have been shown to be able to produce Farnesyl Pyrophosphate (FPP) in <i>E. coli</i> <span id="cite_ref_7">[[Team:TUDelft/Research_Proposal#cite_note_7|[7]]]</span>. FPP is a precursor for pathways that lead to color production. When production of FPP in <i>E. coli</i> is achieved, the production of color will be the next goal. To obtain colored cells we could use the standardized pathway that is already made available by another iGEM-team (Edinburgh 2007).<br />
<br />
===Labwork===<br />
During this project we will work with <i>E. coli K12</i> derived strains. For both the thermometer and the FPP pathway, <i>E. coli</i> will be transformed. In order to do this, vectors containing the relevant (c)DNA of the genes or temperature sensitive RNAs will be cloned into vectors provided by iGEM. Protocols available on the OpenWetWare (OWW) website will be followed in the laboratory. If no protocols are available on the OWW website, supplier’s protocol will be followed or we will make our own protocols.<br />
<br />
An inducible system will be made in order to keep environmental conditions as equal as possible in all tests. All cells will be grown at 37oC, induced, and placed at different temperatures to investigate the temperature sensitive RNA structures. The lac operon will be in place before the RNA structures and after that the luciferase protein. <br />
<br />
The lac operon can be induced by the presence of Isopropyl β-D-1-thiogalactopyranoside (IPTG), a molecular mimic of allolactose, a metabolite of lactose. By spraying IPTG on dishes, a concentration between 100 µM and 1.5 mM of IPTG should be reached in order to induce the system effectively.<br />
<br />
The inducible temperature sensitive RNA structures will be tested by luciferase assays. Luciferase will be expressed under control of a standard promoter and temperature sensitive RNA. Luciferase is a 62 kDa protein obtained from the firefly. Luciferase catalyzes (in the presence of Mg2+) the bioluminescent reaction (1): <br />
<br />
luceferin + ATP + O2 --> oxyluceferin + AMP + PPi + CO2 + light (1)<br />
<br />
The amount of light produced by this reaction can be measured and gives as a clue about the relative amount of luciferase present. The amount of luciferase present correlates with promoter strength and the effect of the temperature sensitive RNA present. As long as cells from the same bacterial colony (i.e. cells with the same amount<br />
of plasmids present and the same RNA temperature sensitive part and promoter) are handled, relative expression of luciferase induced at different temperatures can be compared. For creating variations in the riboswitch structures, we intend to introduce small (One or two mutations in the sequence) alterations in the DNA. We can achieve this, for example, by performing error-prone Polymerase Chain Reaction (PCR). Screening of the resulting RNA sequence library could again be performed by LacZ screening at different induction temperatures. This way, we might be able to create RNA thermometers sensitive to different temperatures.<br />
<br />
As has been stated before, FPP overproduction is needed to produce colored <i>E.coli</i>. In <i>E. coli</i> there is endogenous expression of FPP, it is produced by the DXP pathway. Simply overexpressing this pathway has led to only small increases in FPP production, as there are enzymes involved with very limited capacity. This is why we seek to overproduce FPP in another way. The color pathway we want to introduce consists of endogenous <i>E. coli</i> enzymes combined with enzymes ‘borrowed’ from the yeast <i>Saccharomyces cerevisiae</i>, some of the mevalonate pathway. It has been shown that this combination of enzymes is a more potent producer of FPP than the endogenous DXP pathway <span id="cite_ref_7">[[Team:TUDelft/Research_Proposal#cite_note_7|[7]]]</span>. An overview of the compounds involved in the color pathway with names of the enzymes can be found in figure 1. To investigate the presence of the enzymes of the FPP pathway in transformed <i>E. coli</i>, we will screen for the products of the pathway in the transformed cells and compare them to wild type <i>E. coli</i>. This screening will be performed using gas chromatography or mass spectrometry analysis. Overexpressing FPP in <i>E. coli</i> bears a potential risk to the cells while FPP is toxic to <i>E. coli</i> if present in high concentration <span id="cite_ref_7">[[Team:TUDelft/Research_Proposal#cite_note_7|[7]]]</span>. One way to prevent a concentration buildup of FPP within the cell is by draining the FPP pool by expressing a colorant, as we plan to do. However, it will be important to tune FPP production: there should be enough to produce a visible color, but not more than the enzymes that produce the color can handle.<br />
<br />
[[Image:TUDelftPathway.jpg|thumb|center|Figure 2. Overview of the pathway we want to introduce into <i>E. coli</i> for color production. Lycopene is a red colorant, β-carotene an orange one and zeaxanthin is a yellow-colored compound.]]<br />
<br />
===Modeling===<br />
Part of the project will be focused on building models to predict the dynamic behavior of mRNA and proteins in the cell taking into account the effects of temperature on translation. The software used to model the metabolic activities in the cell is CellDesignerTM and/or MATLAB. The goal of setting up a mathematical model of the biological processes is to avoid pitfalls that can be predicted beforehand. <br />
<br />
Furthermore, the modeling of the system is in itself a goal: results from the laboratory can be used to test the model. Using the results, the model could be changed or optimized by fitting the parameters using experimental data. We aim to be able to predict at what temperature these RNA thermometers will allow translation using mathematical models.<br />
<br />
Besides these models we will investigate in silico how to alter the temperature sensitivity of the 5' UTR by mutating the RNA sequence. Alteration of this sequence will change the stability of the RNA secondary structure occluding the ribosome binding site (RBS). More stable structures will denaturate at higher temperatures while less stable structures will denaturate at lower temperatures. This way we aim to design temperature sensitive sequences that act at different temperatures. We will use mfold <span id="cite_ref_9">[[Team:TUDelft/Research_Proposal#cite_note_9|[9]]]</span> and the Vienna RNA package <span id="cite_ref_10">[[Team:TUDelft/Research_Proposal#cite_note_10|[10]]]</span> to predict the secondary structures and their stability.<br />
<br />
===Ethical considerations on macro and micro level===<br />
Synthetic biology can generally comprise several goals. Some would say the goal is to make biology an engineering science, designing with biology. Others may state that building with biology can be used to further understand life. At the least, one may state that both the bottom-up, constructing part and the top-down, deconstructing aspects of synthetic biology rely on the principle of using more or less biological systems in a more or less natural way. This new approach of biology brings about new applications, but also new risks and new ethical considerations. The question is to what extent the participants in the iGEM competition realize this. <br />
We are interested in what these new ethical considerations as proposed by ethicists in the field of synthetic biology actually mean for the participants in iGEM. On an individual level, which ethical questions play a role for the TU Delft iGEM team? How do the team members work with or around these issues? These are the topics that are investigated in this study. <br />
<br />
Before these individual team member analyses can be carried out, a road-map of the ethical considerations that are associated with synthetic biology need to be investigated. Therefore, a literature survey is carried out, exploring the general, "macro" ethical sides of synthetic biology. With this road map, a framework for a questionnaire has been developed, by which the ethical considerations on the individual "micro" level will be analyzed. <br />
<br />
===Predicted results from practical work===<br />
When input and output come together, a bio- thermometer could be created that changes color (or smells differently) at defined temperatures. A possible application of this project (temperature induced color production) can be to produce heat maps of surfaces on a microbial scale. A different application for the temperature sensitivity is to use this system for triggering bi-stable genetic switches or detection of temperature variations in cultivations. Furthermore, we hope the lab results will yield results to confirm or improve mathematical models based on the structure variations introduced in the temperature switch parts. <br />
<br />
The modeling part itself could result in a predictive temperature sensitivity algorithm of RNA. Also, it could give insight in the enzymatic reactions that happen in the color pathway.<br />
<br />
Finally, the ethics will provide us with a better insight of what iGEM participants know and think of developments in synthetic biology. <br />
<br />
==References==<br />
<ol class="references"><br />
<li id="cite_note_1"> [[Team:TUDelft/Research_Proposal#cite_ref_1 | ^]] http://en.wikipedia.org/wiki/IGEM</li><br />
<li id="cite_note_2"> [[Team:TUDelft/Research_Proposal#cite_ref_2 | ^]] J. Lee & N.A. Kotov. Thermometer design at the nanoscale. ''Nano Today'', 2(1):48-51, 2007. [http://dx.doi.org/10.1016/S1748-0132(07)70019-1 doi:10.1016/S1748-0132(07)70019-1]</li><br />
<li id="cite_note_3"> [[Team:TUDelft/Research_Proposal#cite_ref_3 | ^]] F. Narberhaus, T. Waldminghaus & S. Chowdhury. RNA thermometers. ''FEMS Microbiol Rev'', 30(1):3-16, 2006. [http://www.ncbi.nlm.nih.gov/pubmed/16438677 PMID:16438677]</li><br />
<li id="cite_note_4"> [[Team:TUDelft/Research_Proposal#cite_ref_4 | ^]] Saheli Chowdhury, Christophe Maris, Frédéric H-T Allain, and Franz Narberhaus. Molecular basis for temperature sensing by an RNA thermometer. ''The EMBO Journal'', 25:2487–2497, 2006. [http://www.ncbi.nlm.nih.gov/pubmed/16710302 PMID:16710302]</li><br />
<li id="cite_note_5"> [[Team:TUDelft/Research_Proposal#cite_ref_5 | ^]] Torsten Waldminghaus, Nadja Heidrich, Sabine Brantl, and Franz Narberhaus. FourU: a novel type of RNA thermometer in Salmonella. ''Molecular Microbiology'', 65(2):413-424, 2007. [http://www.ncbi.nlm.nih.gov/pubmed/17630972 PMID:17630972]</li><br />
<li id="cite_note_6"> [[Team:TUDelft/Research_Proposal#cite_ref_6 | ^]] J . Johansson, P . Mandin, A . Renzoni, C . Chiaruttini, M . Springer, and P . Cossart. An RNA thermosensor controls expression of virulance genes in Listeria monocytogenes. ''Cell'' , 110(5):551-561, 2002. [http://www.ncbi.nlm.nih.gov/pubmed/12230973 PMID:12230973] </li><br />
<li id="cite_note_7"> [[Team:TUDelft/Research_Proposal#cite_ref_7 | ^]] V. Martin, D. Pitera, S. Withers, J. Newman and J. Keasling. Engineering a mevalonate pathway in ''Escherichia coli'' for production of terpenoids. ''Nature Biotechnology''. 21(7):796-801, 2003. [http://www.ncbi.nlm.nih.gov/pubmed/12778056 PMID:12778056] </li><br />
<li id="cite_note_8"> [[Team:TUDelft/Research_Proposal#cite_ref_8 | ^]] M. Wieland and J.S. Hartig. RNA Quadruplex-Based Modulation of Gene Expression. ''Chemistry & Biology'', 14(7):757–763, 2007. [http://www.ncbi.nlm.nih.gov/pubmed/17656312 PMID:17656312] </li><br />
<li id="cite_note_9"> [[Team:TUDelft/Research_Proposal#cite_ref_9 | ^]] http://mfold.bioinfo.rpi.edu/</li><br />
<li id="cite_note_10"> [[Team:TUDelft/Research_Proposal#cite_ref_10 | ^]] http://rna.tbi.univie.ac.at</li><br />
</ol><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/ProtocolsTeam:TUDelft/Protocols2008-10-29T22:38:35Z<p>Ruudjorna: /* Protein content measurement */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Protocols=<br />
==Contents==<br />
# [[#Making_cells_competent|Making cells competent]]<br />
# [[#Transformations|Transformations]]<br />
# [[Team:TUDelft/Protocols#Restrictions|Restrictions]]<br />
# [[Team:TUDelft/Protocols#Purifying_small_DNA_parts|Purifying small DNA parts]]<br />
# [[Team:TUDelft/Protocols#DNA_precipitation|DNA precipitation]]<br />
# [[Team:TUDelft/Protocols#Ligation|Ligation]]<br />
# [[Team:TUDelft/Protocols#PCR|PCR protocols]]<br />
# [[Team:TUDelft/Protocols#DNA_gels|DNA gels]]<br />
# [[Team:TUDelft/Protocols#Protein_content_measurement|Protein_content_measurement]]<br />
# [[Team:TUDelft/Protocols#Luciferase_Assays|Luciferase assays]]<br />
# [[Team:TUDelft/Protocols#Protein_Precipitation|Protein precipitation]]<br />
# [[Team:TUDelft/Protocols#Cell_Lysis|Cell lysis]]<br />
# [[Team:TUDelft/Protocols#Buffers_&_(Stock)_Solutions|Buffers & (stock) solutions]]<br />
<br />
==Making cells competent==<br />
[[#Protocols | Back to top]]<br><br />
Most of the time, we used Top10 chemically competent cells. We did make a stock of chemically competent DB3.1 cells with the following protocol (found on OpenWetWare). We found that these cells were indeed very competent.<br />
<br />
You will need TSS buffer, for 50 mL:<br />
** 5g PEG 8000<br />
** 1.5 mL 1M MgCl2 (or 0.30g MgCl2*6H20)<br />
** 2.5 mL DMSO<br />
** Add LB to 50 mL<br />
Filter sterilize (0.22 μm filter) TSS buffer and store at 4ºC or -20ºC<br />
<br />
Preparing the cells:<br />
* Grow a 5ml overnight culture of cells in LB media. <br />
* In the morning, dilute this culture back into 25-50ml of fresh LB media in a 200ml conical flask. You should aim to dilute the overnight culture by at least 1/100.<br />
* Grow the diluted culture to an OD600 of 0.2 - 0.5. (You will get a very small pellet if you grow 25ml to OD600 0.2)<br />
* Put eppendorf tubes on ice now so that they are cold when cells are aliquoted into them later. If your culture is X ml, you will need X tubes. At this point you should also make sure that your TSS is being chilled (it should be stored at 4oC but if you have just made it fresh then put it in an ice bath).<br />
* Split the culture into two 50ml falcon tubes and incubate on ice for 10 min.<br />
<br />
All subsequent steps should be carried out at 4oC and the cells should be kept on ice wherever possible<br />
* Centrifuge for 10 minutes at 3000 rpm and 4oC.<br />
* Remove supernatant. The cell pellets should be sufficiently solid that you can just pour off the supernatant if you are careful. Pipette out any remaining media.<br />
* Resuspend in chilled TSS buffer. The volume of TSS to use is 10% of the culture volume that you spun down. You may need to vortex gently to fully resuspend the culture, keep an eye out for small cell aggregates even after the pellet is completely off the wall.<br />
* Add 100 μl aliquots to your chilled eppendorfs and store at − 80oC.<br />
<br />
==Transformations==<br />
[[#Protocols | Back to top]]<br><br />
Standard transformation procedure <br />
*Remove competent cells from -80, let thaw for 10 min on ice and aliquot in 50 ul amounts.<br />
*add 2-5 ul of vector, usually in H2O, to 50 ul cells, no mixing by pipet due to shear induction.<br />
*keep on ice for 20 minutes (vector spreading through volume)<br />
*heat shock (42°C) for 45 seconds<br />
*keep on ice for 2 minutes<br />
*add 200 ul SOC, put on 37°C for 1 hour or longer with agitation.<br />
*plate out 250 ul on appropriate antibiotics.<br />
<br />
==Restrictions==<br />
[[#Protocols | Back to top]]<br><br />
Try to do a restriction in a relatively large volume. As a rule of thumb, use a volume of 50 ul / 500 ng DNA.<br />
<br />
* Calculate the amount of DNA you want to use<br />
* add H2O<br />
* add 10 x H buffer (Roche)<br />
* add your calculated amount of DNA<br />
* add 0.5 ul of each enzyme. Keep in mind 0.5 ul = 5 U, where 1 U is defined as the amount of enzyme cutting 1000 ng of DNA / hour, so for extremely large amounts of DNA adjust this.<br />
* keep on 37°C for 2-3 hours.<br />
<br />
==Purifying small DNA parts==<br />
[[#Protocols | Back to top]]<br><br />
''Protocol found on OpenWetWare'' <br />
<br />
This protocol is for a simple ethanol precipitation of small fragments. This protocol was used to (partially) purify a DNA fragment containing a ribosome binding site (~40 bp) during 3A assembly]. The fragment was generated via restriction digest and it was used in a ligation reaction. Note that this protocol simply concentrates your sample and removes enough salts/enzymes for ligation to be successful. All DNA fragments from your digest will still be present in your pellet. These residual DNA fragments do not matter for 3A assembly which selects against incorrect ligation products.<br />
<br />
===Materials===<br />
<br />
*Absolute Ethanol (100% = 200 proof)<br />
*95% ethanol<br />
*Tabletop centrifuge<br />
*-80&deg;C freezer<br />
<br />
===Procedure===<br />
<br />
#Add 2 volumes ice cold absolute ethanol to sample. <br> Generally the sample is in a 1.5 mL eppendorf tube. I recommend storing the absolute ethanol at -20&deg;C.<br />
#Incubate 1 hr at -80&deg;C. <br> The long incubation time is critical for small fragments.<br />
#Centrifuge for 30 minutes at 0&deg;C at maximum speed (generally >10000 g at least).<br />
#Remove supernatant.<br />
#Wash with 750-1000 &mu;L room-temperature 95% ethanol. <br> Another critical step for small fragments under 200 base pairs. Generally washing involves adding the ethanol and inverting several times.<br />
#Centrifuge for 10 minutes at 4&deg;C at maximum speed (generally >10000 g at least).<br />
#Let air dry on benchtop. <br> I generally let the pellet air dry completely such that it becomes white so that all residual ethanol is eliminated.<br />
#Resuspend in an appropriate volume of H<sub>2</sub>O. <br> Many protocols recommend resuspending in 10 mM Tris-HCl or TE. The advantage of TE is that EDTA chelates magnesium ions which makes it more difficult for residual DNases to degrade the DNA. I generally prefer H<sub>2</sub>O and don't seem to experience problems of this sort. If you plan to ultimately use electroporation to transform your DNA then resuspending in H<sub>2</sub>O has the advantage of keeping the salt content of your ligation reaction down.<br />
<br />
==DNA precipitation==<br />
[[#Protocols | Back to top]]<br><br />
Another protocol for DNA precipitation, it was used to concentrate DNA samples for sequencing.<br />
<br />
* Add 1/10 volume of 3M Sodium Acetate (NaAc), pH 4.8<br />
* Add 2 volumes of 96% ethanol (EtOH)<br />
* Store for at least 1h @ -20ºC or 20' @ -80ºC (can also be stored o/n)<br />
* Spin for 20' at max speed and 4ºC<br />
* Decant supernatant and wash pellet with 1.5 volume of 70% EtOH (EtOH has to be cold)<br />
* Spin for 10' at max speed and 4ºC<br />
* Decant supernatant and air-dry pellet in approximately 15' (no EtOH should be left)<br />
* Resuspend pellet in wanted volume of H<sub>2</sub>O or TE<br />
* Incubate for 10' @ 4ºC to ensure all DNA is dissolved<br />
* NanoDrop for concentration and store at -20ºC for later use<br />
<br />
==Ligation==<br />
[[#Protocols | Back to top]]<br><br />
First make sure you have purified the DNA after restriction. Ligation should be in a small volume (we usually use 15 ul), so elute your DNA from the column in a small volume/high concentration. <br />
* add H2O<br />
* add 10 x ligation buffer<br />
* add backbone and insert (theoretically in a 1:3 or 1:4 ratio, for 3A assembly it seemed to work at 1:1 ratios, possibly even better). DNA amounts added are at least 50 ng of the backbone and if possible 100-150 ng of the insert DNA (including it's backbone).<br />
* add 1 ul of T4 Ligase.<br />
* keep the reaction at 16ºC for at least 2 hours, but o/n is preferable. <br />
* if used for transformation, all DNA can be added to competent cells, or if you want to analyze it on gel, keep 5 ul.<br />
<br />
==PCR==<br />
[[#Protocols | Back to top]]<br><br />
===Colony PCR===<br />
*Make biobrick mastermix, containing per sample: <br />
**12.5 ul ''Taq'' mastermix<br />
**2.5 ul 10x forward biobrick primer<br />
**2.5 ul 10x reverse biobrick primer<br />
**7.5 ul H2O<br />
*Put 25 ul in the PCR tubes. <br />
*With a toothpick or pipet point, touch a colony and stir it through the fluid<br />
*Run the iGEM colpcr program <i>(to be added later)</i><br />
<br />
===PCR using ''Taq'' Mastermix===<br />
Contents of the PCR mix is the for a large part the same as mentioned above for the Colony PCR. Differences will be noted here. First, instead of biobrick primer, any primer of choice can be added, also 2.5ul if standard solution has a concentration of 10 pmol/ul. Also x ul template DNA from a sample is added, where x depends on the total concentration of DNA in the sample. Typically 50 to 100 ng of total DNA is added. 7.5 - x ul of H<sub>2</sub>O is added to the mix.<br />
<br />
PCR program is:<br><br />
1. 5' @ 95ºC<br><br />
2. 1' @ 95ºC<br><br />
3. 1' @ annealing temperature of the primer<br> <br />
4. 1' @ 72ºC (1' is long enough for 1kb, longer times can be used if larger products are formed)<br><br />
5. repeat steps 2-4 29x (total of 30 cycles, more can be added if necessary)<br><br />
6. 5' @ 72ºC<br><br />
7. ∞ @ 4ºC (PCR can be stopped and stored in the fridge at any time from this point on)<br><br />
<br />
===PCR using ''Pfx'' polymerase===<br />
Mastermix does not exist for the ''Pfx'' polymerase. This means the components have to be added seperately. The mix consists of:<br />
* x ul template DNA (again 50 - 100 ng total)<br />
* 5.0 ul 10x buffer<br />
* 2.5 ul forward primer (10 pmol/ul)<br />
* 2.5 ul reverse primer (10 pmol/ul)<br />
* 0.2 ul ''Pfx''<br />
* 1.5 ul dNTP's (10 mM)<br />
* 1.0 ul MgSO<sub>4</sub> (50 mM)<br />
* 37.3-x ul H<sub>2</sub>O<br />
<br />
The PCR program looks the same as mentioned above for Taq polymerase, only difference is the elongation temperature in step 4. This is 68ºC for ''Pfx''.<br />
<br />
===Gradient PCR===<br />
<br />
Gradient PCR is mainly used to determine the best annealing temperature for primers. This is done in this project with Taq polymerase mastermix, as this is cheaper than ''Pfx''. However, as long as a PCR machine capable of making gradients is present, a gradient PCR can be performed with any polymerase. During the annealing step (step 3 in the taq mastermix protocol) every column in the PCR machine has a different temperature, going up from left to right. The range of the gradient can be installed manually, however the actual temperatures cannot (at least not in our machine). An example of PCR products put on gel after a gradient PCR can be seen in the lab notebook at the 20th of August, where gradients of 5ºC in 12 steps were tested for the atoB, idi and ispA primer pairs.<br />
<br />
===Touchdown PCR===<br />
<br />
Some of the ordered primers had long sequences that are not supposed to bind to the target DNA (the pre- and suffix for forward and reverse primer, respectively). Here low annealing temperatures could lead to a lot of aspecific product formation, while high annealing temperatures could be too specific, causing very little product formation. To suppress this, a touchdown PCR can be performed. Again 50 - 100 ng of template DNA should be used and any polymerase. The PCR program used in this project, with ''Pfx'' polymerase, looked like this:<br><br />
1. 5' @ 94°C<br><br />
2. 1' @ 94°C<br><br />
3. 1' @ 65°C --> temperature is lowered with 0.5°C per cycle<br><br />
4. 3' @ 72°C<br><br />
5. go to 2, 20 cycles in total<br><br />
6. 1' @ 94°C<br><br />
7. 1' @ 94°C<br><br />
8. 3' @ 72°C<br><br />
9. go to 6, 20 cycles in total<br><br />
10. 7' @ 72°C<br><br />
11. ∞ @ 10°C<br><br><br />
<br />
==DNA gels==<br />
[[#Protocols | Back to top]]<br><br />
* Take a flask of 0.8% up to 1.5% molten agarose from the 70oC stove.<br />
* Pour a it in a taped gel tray.<br />
* Add ca. 5 ul of SYBRSafe (depending on size gel)<br />
* Add a comb and let the gel harden for ca. 15 minutes.<br />
* Remove the comb and the tape and put the gel tray in an electrophoresis tray.<br />
* Add enough 1x TBE to completely cover the gel.<br />
* Add DNA loading buffer to your samples and load them. <br />
* Let the gel run at a voltage between 60V and 120V, depending on desired resolution/time available.<br />
* Visualize the DNA by putting it in the imager for taking a picture, or if you want to cut out your DNA, put it on the blue light emitter.<br />
<br />
==Protein content measurement==<br />
[[#Protocols | Back to top]]<br><br />
===BC assay===<br />
* Make a dilution series of standard 2mg/ml bovine serum albumin (BSA). We used 2, 1, 0.75, 0.5, 0.25, 0.1, 0.02 and 0 mg/ml.<br />
* Pipet 25ul of every sample from the standard solutions to a well in a 96-wells plate to make a calibration curve. Also pipet 25ul of every sample with unknown protein content. Always load samples at least twice.<br />
* Add 1 ml of reagens B to 50 ml of reagens A and mix.<br />
* Add 200ul of AB mix to all wells that have a sample in them.<br />
* Incubate 30' @ 37ºC<br />
* Read out OD<sub>562</sub> in plate reader<br />
<br />
==Luciferase Assays==<br />
[[#Protocols | Back to top]]<br><br />
Due to some protocols not working as desired, we've used various different ones. The one listed here is the specific measurement protocol, other more detailed protocols can be found under the following links: [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol 25th of September protocol]; [https://2008.igem.org/Team:TUDelft/15th_of_October_protocol 15th of October protocol]<br />
===Measurements===<br />
The luminometer used is the BioTek Gen5 plate reader.<br><br />
The luciferase assay kit used is the Promega Renilla Luciferase Assay System.<br />
*Mix 1 ul of 100X luciferase substrate in 100 ul of assay buffer per sample in the luminometer's reagent bottle.<br />
*At least in duplo, put 20 ul of soluble fraction of cells in a well for all samples of a white opaque 96 wells plate. <br />
*Put the prime plate in the plate reader(usually on top of the plate reader and surprisingly labeled 'priming plate')<br />
*Put the bottle with assay buffer under reagent needle no. 1, making sure the tip of the needle is in a position to reach all the assay buffer (the lowest point in the bottle). Fix it in this position by the elastic rubber band.<br />
*Rinse the tubing by priming 5 ml of H<sub>2</sub>O on the priming plate.<br />
*Purge the tubing for 1.5 ml, leaving empty tubing.<br />
*Prime the luminometer with 1000 ul assay buffer in the priming plate, which should exactly fill the tubing. If not sure, you can prime 15 ul until you see a small spot of fluid on the priming plate. <br />
*Measure luciferase activity by: <br />
**Adding 100 ul of assay buffer to a well in the slowest possible fill rate (225 ul/s)<br />
**Delay 2 seconds <br />
**Measure/integrate luminescence for 10 seconds.<br />
**Repeat for every well<br />
**There is a standard protocol on the computer in which you only have to indicate the wells to be assayed.<br />
*When finished, purge the tubing (If there's any assay buffer left, it can be stored and frozen at -80ºC for short periods (1 week at most) according to the technical manual)<br />
*Rinse the tubing with 5000 ul of ethanol, and purge it for 1.5 ml.<br />
*Rinse the tubing with 5000 ul of H2O, and purge it for 1.5 ml. <br />
*The tubing and injector should be clean and empty now.<br />
*Clean your plate and mark the wells you've used/throw away the plate.<br />
<br />
==Protein Precipitation==<br />
[[#Protocols | Back to top]]<br><br />
During the project, several ways of protein precipitation were used. Here is an overview of all of them.<br />
<br />
===Perchloric Acid (PCA)===<br />
<br />
* Add 1 volume of 1M PCA to sample and mix<br />
* Spin for 20' @ 1,500g and 4ºC<br />
* Remove supernatant and spin again for 20' @ 1,500g and 4ºC<br />
* Remove the supernatant as much as possible and resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
===Acetone/Trichloric Acid (TCA)===<br />
<br />
* Mix 10 volumes of cold 10% TCA in acetone (stored @ -20ºC) with your samples, vortex, and incubate at -20ºC for at least 3h, but o/n is optimal<br />
* Spin samples 10' @ 15,000g and remove supernatant<br />
* Wash pellet with 10 volumes of acetone, vortex, and incubate for at least 10' at -20ºC<br />
* Spin 5' @ 15,000g, remove supernatant (carefully) and air dry pellets<br />
* Resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
===TCA/Deoxycholate (DOC)===<br />
<br />
* Add 1/100 volume of 2% DOC, mix, and incubate on ice for 30'<br />
* Add 100% TCA so that final concentration of TCA in the sample is 15%<br />
* Vortex immediately to avoid formation of large conglomerates that can trap contaminants<br />
* Keep the sample on ice for at least 1h to allow protein to precipitate, but prefarably o/n<br />
* Spin 10' @ 15,000g and remove supernatant as much as possible<br />
* Wash pellet with EtOH or Acetone (stored @ -20ºC)<br />
* Vortex and incubate at RT for 5'<br />
* Spin for 10' @ 15,000g and remove supernatant<br />
* Repeat the last three steps (wash pellet twice)<br />
* Dry pellet (we let it air dry, although the original protocol suggested to do it under a SLOW stream of nitrogen)<br />
* Resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
===Methanol (MeOH)/Chloroform===<br />
<br />
* Add 4 volumes of MeOH and vortex well<br />
* Add 1 volume of chloroform and vortex<br />
* Add 3 volumes of dH<sub>2</sub>O and vortex<br />
* Spin 2' @ 15,000g - the sample will divide in two phases, proteins should be at the liquid interface<br />
* Remove aqueous top layer, add 4 volumes of methanol and vortex<br />
* Spin 2' @ 15,000g<br />
* Remove supernatant as much as possible<br />
* Air dry pellet (again, original protocol mentioned drying under nitrogen or speed-vacuum)<br />
* Resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
==Cell Lysis==<br />
[[#Protocols | Back to top]]<br><br />
===Promega lysis buffer===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x lysis buffer in H<sub>2</sub>O<br />
* Incubate for 30' on ice<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer supernatant (with protein) to a fresh eppendorf tube<br />
<br />
===Bead beater===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x PBS<br />
* Add 0.5g of small acid-washed glass beads<br />
* Add 20ul of 2uM lysozyme<br />
* Put samples in the bead beater for 1h in the cold room<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer 600ul of supernatant (with protein) to a fresh eppendorf tube<br />
<br />
===Fastprep===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x PBS<br />
* Add autoclaved glass bead (d=1mm) to the sample, the amount needed equals the amount filling the conical part at the bottom of a 2 ml Greiner Bio1 microcentrifuge tube<br />
* Shake the sample 5s at intensity 5 in the Thermo Savant FastPrep FP120 Homogenizer<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer 500 ul supernatant (with protein) to a fresh eppendorf tube<br />
<br />
===Sonication===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x PBS<br />
* Sonicate samples 2 times for 15 seconds with a 15 second pause in between. Make sure samples are kept on ice during sonication.<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer supernatant (with protein) to a fresh eppendorf tube<br />
<br />
==Buffers & (Stock) Solutions==<br />
[[#Protocols | Back to top]]<br><br />
===Antibiotics (1000x stock solutions)===<br />
*Ampicillin: 100 mg/ml in H<sub>2</sub>O<br />
*Chloroamphenicol: 34 mg/ml in etOH<br />
*Kanamycin: 10 mg/ml in H<sub>2</sub>O<br />
*Tetracycline: 5 mg/ml etOH<br />
<br />
===SOB (Super Optimal Broth)===<br />
For 1 liter dissolve in H<sub>2</sub>O<br />
*20 g Bacto tryptone<br />
*5 g Bacto-Yeast extract<br />
*0.5 g NaCl<br />
*10 ml 250 mM KCl<br />
*adjust pH to 7.0<br />
*before use add 5 ml of 2mM MgCl<sub>2</sub><br />
<br />
===SOC (Super Optimal broth with Catabolite repression)===<br />
*add 20 mM glucose to 1L SOB.<br />
*You can also order small bottles from Invitrogen (which is what we did)<br />
<br />
===LB medium (Lysogeny Broth<sup>[http://jb.asm.org/cgi/content/full/186/3/595]</sup>, but better known as Luria-Bertani Medium)===<br />
In 950 mL H<sub>2</sub>O<br />
*10 g Bacto Tryptone<br />
*5 g Bacto-Yeast extract<br />
*10 g NaCl<br />
*adjust pH to 7.0<br />
<br />
===10x TBE (Tris, Boric Acid, EDTA)===<br />
To make 1L, dissolve in 950 ml H<sub>2</sub>O<br />
*54 g Tris<br />
*27.5 g Boric Acid<br />
*4.65 g EDTA or 20 ml 0.5M EDTA pH 8.0<br />
<br />
===6x DNA Gel loading buffer ===<br />
*Dissolve in H<sub>2</sub>O<br />
*0.25% Bromophenolblue<br />
*0.25% Xylene Cyanol FF<br />
*40% (w/v) Sucrose<br />
<br />
===10x PBS (Phosphate Buffered Saline)===<br />
In 950 mL H<sub>2</sub>O dissolve:<br />
*11.5g Na<sub>2</sub>HPO<sub>4</sub><br />
*2g KH<sub>2</sub>PO<sub>4</sub><br />
*80g NaCl<br />
*2g KCl<br />
Adjust volume to 1L<br><br />
The pH of 1x PBS should be 7.4<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/ProtocolsTeam:TUDelft/Protocols2008-10-29T22:35:41Z<p>Ruudjorna: /* Protocols */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Protocols=<br />
==Contents==<br />
# [[#Making_cells_competent|Making cells competent]]<br />
# [[#Transformations|Transformations]]<br />
# [[Team:TUDelft/Protocols#Restrictions|Restrictions]]<br />
# [[Team:TUDelft/Protocols#Purifying_small_DNA_parts|Purifying small DNA parts]]<br />
# [[Team:TUDelft/Protocols#DNA_precipitation|DNA precipitation]]<br />
# [[Team:TUDelft/Protocols#Ligation|Ligation]]<br />
# [[Team:TUDelft/Protocols#PCR|PCR protocols]]<br />
# [[Team:TUDelft/Protocols#DNA_gels|DNA gels]]<br />
# [[Team:TUDelft/Protocols#Protein_content_measurement|Protein_content_measurement]]<br />
# [[Team:TUDelft/Protocols#Luciferase_Assays|Luciferase assays]]<br />
# [[Team:TUDelft/Protocols#Protein_Precipitation|Protein precipitation]]<br />
# [[Team:TUDelft/Protocols#Cell_Lysis|Cell lysis]]<br />
# [[Team:TUDelft/Protocols#Buffers_&_(Stock)_Solutions|Buffers & (stock) solutions]]<br />
<br />
==Making cells competent==<br />
[[#Protocols | Back to top]]<br><br />
Most of the time, we used Top10 chemically competent cells. We did make a stock of chemically competent DB3.1 cells with the following protocol (found on OpenWetWare). We found that these cells were indeed very competent.<br />
<br />
You will need TSS buffer, for 50 mL:<br />
** 5g PEG 8000<br />
** 1.5 mL 1M MgCl2 (or 0.30g MgCl2*6H20)<br />
** 2.5 mL DMSO<br />
** Add LB to 50 mL<br />
Filter sterilize (0.22 μm filter) TSS buffer and store at 4ºC or -20ºC<br />
<br />
Preparing the cells:<br />
* Grow a 5ml overnight culture of cells in LB media. <br />
* In the morning, dilute this culture back into 25-50ml of fresh LB media in a 200ml conical flask. You should aim to dilute the overnight culture by at least 1/100.<br />
* Grow the diluted culture to an OD600 of 0.2 - 0.5. (You will get a very small pellet if you grow 25ml to OD600 0.2)<br />
* Put eppendorf tubes on ice now so that they are cold when cells are aliquoted into them later. If your culture is X ml, you will need X tubes. At this point you should also make sure that your TSS is being chilled (it should be stored at 4oC but if you have just made it fresh then put it in an ice bath).<br />
* Split the culture into two 50ml falcon tubes and incubate on ice for 10 min.<br />
<br />
All subsequent steps should be carried out at 4oC and the cells should be kept on ice wherever possible<br />
* Centrifuge for 10 minutes at 3000 rpm and 4oC.<br />
* Remove supernatant. The cell pellets should be sufficiently solid that you can just pour off the supernatant if you are careful. Pipette out any remaining media.<br />
* Resuspend in chilled TSS buffer. The volume of TSS to use is 10% of the culture volume that you spun down. You may need to vortex gently to fully resuspend the culture, keep an eye out for small cell aggregates even after the pellet is completely off the wall.<br />
* Add 100 μl aliquots to your chilled eppendorfs and store at − 80oC.<br />
<br />
==Transformations==<br />
[[#Protocols | Back to top]]<br><br />
Standard transformation procedure <br />
*Remove competent cells from -80, let thaw for 10 min on ice and aliquot in 50 ul amounts.<br />
*add 2-5 ul of vector, usually in H2O, to 50 ul cells, no mixing by pipet due to shear induction.<br />
*keep on ice for 20 minutes (vector spreading through volume)<br />
*heat shock (42°C) for 45 seconds<br />
*keep on ice for 2 minutes<br />
*add 200 ul SOC, put on 37°C for 1 hour or longer with agitation.<br />
*plate out 250 ul on appropriate antibiotics.<br />
<br />
==Restrictions==<br />
[[#Protocols | Back to top]]<br><br />
Try to do a restriction in a relatively large volume. As a rule of thumb, use a volume of 50 ul / 500 ng DNA.<br />
<br />
* Calculate the amount of DNA you want to use<br />
* add H2O<br />
* add 10 x H buffer (Roche)<br />
* add your calculated amount of DNA<br />
* add 0.5 ul of each enzyme. Keep in mind 0.5 ul = 5 U, where 1 U is defined as the amount of enzyme cutting 1000 ng of DNA / hour, so for extremely large amounts of DNA adjust this.<br />
* keep on 37°C for 2-3 hours.<br />
<br />
==Purifying small DNA parts==<br />
[[#Protocols | Back to top]]<br><br />
''Protocol found on OpenWetWare'' <br />
<br />
This protocol is for a simple ethanol precipitation of small fragments. This protocol was used to (partially) purify a DNA fragment containing a ribosome binding site (~40 bp) during 3A assembly]. The fragment was generated via restriction digest and it was used in a ligation reaction. Note that this protocol simply concentrates your sample and removes enough salts/enzymes for ligation to be successful. All DNA fragments from your digest will still be present in your pellet. These residual DNA fragments do not matter for 3A assembly which selects against incorrect ligation products.<br />
<br />
===Materials===<br />
<br />
*Absolute Ethanol (100% = 200 proof)<br />
*95% ethanol<br />
*Tabletop centrifuge<br />
*-80&deg;C freezer<br />
<br />
===Procedure===<br />
<br />
#Add 2 volumes ice cold absolute ethanol to sample. <br> Generally the sample is in a 1.5 mL eppendorf tube. I recommend storing the absolute ethanol at -20&deg;C.<br />
#Incubate 1 hr at -80&deg;C. <br> The long incubation time is critical for small fragments.<br />
#Centrifuge for 30 minutes at 0&deg;C at maximum speed (generally >10000 g at least).<br />
#Remove supernatant.<br />
#Wash with 750-1000 &mu;L room-temperature 95% ethanol. <br> Another critical step for small fragments under 200 base pairs. Generally washing involves adding the ethanol and inverting several times.<br />
#Centrifuge for 10 minutes at 4&deg;C at maximum speed (generally >10000 g at least).<br />
#Let air dry on benchtop. <br> I generally let the pellet air dry completely such that it becomes white so that all residual ethanol is eliminated.<br />
#Resuspend in an appropriate volume of H<sub>2</sub>O. <br> Many protocols recommend resuspending in 10 mM Tris-HCl or TE. The advantage of TE is that EDTA chelates magnesium ions which makes it more difficult for residual DNases to degrade the DNA. I generally prefer H<sub>2</sub>O and don't seem to experience problems of this sort. If you plan to ultimately use electroporation to transform your DNA then resuspending in H<sub>2</sub>O has the advantage of keeping the salt content of your ligation reaction down.<br />
<br />
==DNA precipitation==<br />
[[#Protocols | Back to top]]<br><br />
Another protocol for DNA precipitation, it was used to concentrate DNA samples for sequencing.<br />
<br />
* Add 1/10 volume of 3M Sodium Acetate (NaAc), pH 4.8<br />
* Add 2 volumes of 96% ethanol (EtOH)<br />
* Store for at least 1h @ -20ºC or 20' @ -80ºC (can also be stored o/n)<br />
* Spin for 20' at max speed and 4ºC<br />
* Decant supernatant and wash pellet with 1.5 volume of 70% EtOH (EtOH has to be cold)<br />
* Spin for 10' at max speed and 4ºC<br />
* Decant supernatant and air-dry pellet in approximately 15' (no EtOH should be left)<br />
* Resuspend pellet in wanted volume of H<sub>2</sub>O or TE<br />
* Incubate for 10' @ 4ºC to ensure all DNA is dissolved<br />
* NanoDrop for concentration and store at -20ºC for later use<br />
<br />
==Ligation==<br />
[[#Protocols | Back to top]]<br><br />
First make sure you have purified the DNA after restriction. Ligation should be in a small volume (we usually use 15 ul), so elute your DNA from the column in a small volume/high concentration. <br />
* add H2O<br />
* add 10 x ligation buffer<br />
* add backbone and insert (theoretically in a 1:3 or 1:4 ratio, for 3A assembly it seemed to work at 1:1 ratios, possibly even better). DNA amounts added are at least 50 ng of the backbone and if possible 100-150 ng of the insert DNA (including it's backbone).<br />
* add 1 ul of T4 Ligase.<br />
* keep the reaction at 16ºC for at least 2 hours, but o/n is preferable. <br />
* if used for transformation, all DNA can be added to competent cells, or if you want to analyze it on gel, keep 5 ul.<br />
<br />
==PCR==<br />
[[#Protocols | Back to top]]<br><br />
===Colony PCR===<br />
*Make biobrick mastermix, containing per sample: <br />
**12.5 ul ''Taq'' mastermix<br />
**2.5 ul 10x forward biobrick primer<br />
**2.5 ul 10x reverse biobrick primer<br />
**7.5 ul H2O<br />
*Put 25 ul in the PCR tubes. <br />
*With a toothpick or pipet point, touch a colony and stir it through the fluid<br />
*Run the iGEM colpcr program <i>(to be added later)</i><br />
<br />
===PCR using ''Taq'' Mastermix===<br />
Contents of the PCR mix is the for a large part the same as mentioned above for the Colony PCR. Differences will be noted here. First, instead of biobrick primer, any primer of choice can be added, also 2.5ul if standard solution has a concentration of 10 pmol/ul. Also x ul template DNA from a sample is added, where x depends on the total concentration of DNA in the sample. Typically 50 to 100 ng of total DNA is added. 7.5 - x ul of H<sub>2</sub>O is added to the mix.<br />
<br />
PCR program is:<br><br />
1. 5' @ 95ºC<br><br />
2. 1' @ 95ºC<br><br />
3. 1' @ annealing temperature of the primer<br> <br />
4. 1' @ 72ºC (1' is long enough for 1kb, longer times can be used if larger products are formed)<br><br />
5. repeat steps 2-4 29x (total of 30 cycles, more can be added if necessary)<br><br />
6. 5' @ 72ºC<br><br />
7. ∞ @ 4ºC (PCR can be stopped and stored in the fridge at any time from this point on)<br><br />
<br />
===PCR using ''Pfx'' polymerase===<br />
Mastermix does not exist for the ''Pfx'' polymerase. This means the components have to be added seperately. The mix consists of:<br />
* x ul template DNA (again 50 - 100 ng total)<br />
* 5.0 ul 10x buffer<br />
* 2.5 ul forward primer (10 pmol/ul)<br />
* 2.5 ul reverse primer (10 pmol/ul)<br />
* 0.2 ul ''Pfx''<br />
* 1.5 ul dNTP's (10 mM)<br />
* 1.0 ul MgSO<sub>4</sub> (50 mM)<br />
* 37.3-x ul H<sub>2</sub>O<br />
<br />
The PCR program looks the same as mentioned above for Taq polymerase, only difference is the elongation temperature in step 4. This is 68ºC for ''Pfx''.<br />
<br />
===Gradient PCR===<br />
<br />
Gradient PCR is mainly used to determine the best annealing temperature for primers. This is done in this project with Taq polymerase mastermix, as this is cheaper than ''Pfx''. However, as long as a PCR machine capable of making gradients is present, a gradient PCR can be performed with any polymerase. During the annealing step (step 3 in the taq mastermix protocol) every column in the PCR machine has a different temperature, going up from left to right. The range of the gradient can be installed manually, however the actual temperatures cannot (at least not in our machine). An example of PCR products put on gel after a gradient PCR can be seen in the lab notebook at the 20th of August, where gradients of 5ºC in 12 steps were tested for the atoB, idi and ispA primer pairs.<br />
<br />
===Touchdown PCR===<br />
<br />
Some of the ordered primers had long sequences that are not supposed to bind to the target DNA (the pre- and suffix for forward and reverse primer, respectively). Here low annealing temperatures could lead to a lot of aspecific product formation, while high annealing temperatures could be too specific, causing very little product formation. To suppress this, a touchdown PCR can be performed. Again 50 - 100 ng of template DNA should be used and any polymerase. The PCR program used in this project, with ''Pfx'' polymerase, looked like this:<br><br />
1. 5' @ 94°C<br><br />
2. 1' @ 94°C<br><br />
3. 1' @ 65°C --> temperature is lowered with 0.5°C per cycle<br><br />
4. 3' @ 72°C<br><br />
5. go to 2, 20 cycles in total<br><br />
6. 1' @ 94°C<br><br />
7. 1' @ 94°C<br><br />
8. 3' @ 72°C<br><br />
9. go to 6, 20 cycles in total<br><br />
10. 7' @ 72°C<br><br />
11. ∞ @ 10°C<br><br><br />
<br />
==DNA gels==<br />
[[#Protocols | Back to top]]<br><br />
* Take a flask of 0.8% up to 1.5% molten agarose from the 70oC stove.<br />
* Pour a it in a taped gel tray.<br />
* Add ca. 5 ul of SYBRSafe (depending on size gel)<br />
* Add a comb and let the gel harden for ca. 15 minutes.<br />
* Remove the comb and the tape and put the gel tray in an electrophoresis tray.<br />
* Add enough 1x TBE to completely cover the gel.<br />
* Add DNA loading buffer to your samples and load them. <br />
* Let the gel run at a voltage between 60V and 120V, depending on desired resolution/time available.<br />
* Visualize the DNA by putting it in the imager for taking a picture, or if you want to cut out your DNA, put it on the blue light emitter.<br />
<br />
==Protein content measurement==<br />
<br />
===BC assay===<br />
* Make a dilution series of standard 2mg/ml bovine serum albumin (BSA). We used 2, 1, 0.75, 0.5, 0.25, 0.1, 0.02 and 0 mg/ml.<br />
* Pipet 25ul of every sample from the standard solutions to a well in a 96-wells plate to make a calibration curve. Also pipet 25ul of every sample with unknown protein content. Always load samples at least twice.<br />
* Add 1 ml of reagens B to 50 ml of reagens A and mix.<br />
* Add 200ul of AB mix to all wells that have a sample in them.<br />
* Incubate 30' @ 37ºC<br />
* Read out OD<sub>562</sub> in plate reader<br />
<br />
==Luciferase Assays==<br />
[[#Protocols | Back to top]]<br><br />
Due to some protocols not working as desired, we've used various different ones. The one listed here is the specific measurement protocol, other more detailed protocols can be found under the following links: [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol 25th of September protocol]; [https://2008.igem.org/Team:TUDelft/15th_of_October_protocol 15th of October protocol]<br />
===Measurements===<br />
The luminometer used is the BioTek Gen5 plate reader.<br><br />
The luciferase assay kit used is the Promega Renilla Luciferase Assay System.<br />
*Mix 1 ul of 100X luciferase substrate in 100 ul of assay buffer per sample in the luminometer's reagent bottle.<br />
*At least in duplo, put 20 ul of soluble fraction of cells in a well for all samples of a white opaque 96 wells plate. <br />
*Put the prime plate in the plate reader(usually on top of the plate reader and surprisingly labeled 'priming plate')<br />
*Put the bottle with assay buffer under reagent needle no. 1, making sure the tip of the needle is in a position to reach all the assay buffer (the lowest point in the bottle). Fix it in this position by the elastic rubber band.<br />
*Rinse the tubing by priming 5 ml of H<sub>2</sub>O on the priming plate.<br />
*Purge the tubing for 1.5 ml, leaving empty tubing.<br />
*Prime the luminometer with 1000 ul assay buffer in the priming plate, which should exactly fill the tubing. If not sure, you can prime 15 ul until you see a small spot of fluid on the priming plate. <br />
*Measure luciferase activity by: <br />
**Adding 100 ul of assay buffer to a well in the slowest possible fill rate (225 ul/s)<br />
**Delay 2 seconds <br />
**Measure/integrate luminescence for 10 seconds.<br />
**Repeat for every well<br />
**There is a standard protocol on the computer in which you only have to indicate the wells to be assayed.<br />
*When finished, purge the tubing (If there's any assay buffer left, it can be stored and frozen at -80ºC for short periods (1 week at most) according to the technical manual)<br />
*Rinse the tubing with 5000 ul of ethanol, and purge it for 1.5 ml.<br />
*Rinse the tubing with 5000 ul of H2O, and purge it for 1.5 ml. <br />
*The tubing and injector should be clean and empty now.<br />
*Clean your plate and mark the wells you've used/throw away the plate.<br />
<br />
==Protein Precipitation==<br />
[[#Protocols | Back to top]]<br><br />
During the project, several ways of protein precipitation were used. Here is an overview of all of them.<br />
<br />
===Perchloric Acid (PCA)===<br />
<br />
* Add 1 volume of 1M PCA to sample and mix<br />
* Spin for 20' @ 1,500g and 4ºC<br />
* Remove supernatant and spin again for 20' @ 1,500g and 4ºC<br />
* Remove the supernatant as much as possible and resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
===Acetone/Trichloric Acid (TCA)===<br />
<br />
* Mix 10 volumes of cold 10% TCA in acetone (stored @ -20ºC) with your samples, vortex, and incubate at -20ºC for at least 3h, but o/n is optimal<br />
* Spin samples 10' @ 15,000g and remove supernatant<br />
* Wash pellet with 10 volumes of acetone, vortex, and incubate for at least 10' at -20ºC<br />
* Spin 5' @ 15,000g, remove supernatant (carefully) and air dry pellets<br />
* Resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
===TCA/Deoxycholate (DOC)===<br />
<br />
* Add 1/100 volume of 2% DOC, mix, and incubate on ice for 30'<br />
* Add 100% TCA so that final concentration of TCA in the sample is 15%<br />
* Vortex immediately to avoid formation of large conglomerates that can trap contaminants<br />
* Keep the sample on ice for at least 1h to allow protein to precipitate, but prefarably o/n<br />
* Spin 10' @ 15,000g and remove supernatant as much as possible<br />
* Wash pellet with EtOH or Acetone (stored @ -20ºC)<br />
* Vortex and incubate at RT for 5'<br />
* Spin for 10' @ 15,000g and remove supernatant<br />
* Repeat the last three steps (wash pellet twice)<br />
* Dry pellet (we let it air dry, although the original protocol suggested to do it under a SLOW stream of nitrogen)<br />
* Resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
===Methanol (MeOH)/Chloroform===<br />
<br />
* Add 4 volumes of MeOH and vortex well<br />
* Add 1 volume of chloroform and vortex<br />
* Add 3 volumes of dH<sub>2</sub>O and vortex<br />
* Spin 2' @ 15,000g - the sample will divide in two phases, proteins should be at the liquid interface<br />
* Remove aqueous top layer, add 4 volumes of methanol and vortex<br />
* Spin 2' @ 15,000g<br />
* Remove supernatant as much as possible<br />
* Air dry pellet (again, original protocol mentioned drying under nitrogen or speed-vacuum)<br />
* Resuspend in wanted volume of H<sub>2</sub>O<br />
<br />
==Cell Lysis==<br />
[[#Protocols | Back to top]]<br><br />
===Promega lysis buffer===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x lysis buffer in H<sub>2</sub>O<br />
* Incubate for 30' on ice<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer supernatant (with protein) to a fresh eppendorf tube<br />
<br />
===Bead beater===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x PBS<br />
* Add 0.5g of small acid-washed glass beads<br />
* Add 20ul of 2uM lysozyme<br />
* Put samples in the bead beater for 1h in the cold room<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer 600ul of supernatant (with protein) to a fresh eppendorf tube<br />
<br />
===Fastprep===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x PBS<br />
* Add autoclaved glass bead (d=1mm) to the sample, the amount needed equals the amount filling the conical part at the bottom of a 2 ml Greiner Bio1 microcentrifuge tube<br />
* Shake the sample 5s at intensity 5 in the Thermo Savant FastPrep FP120 Homogenizer<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer 500 ul supernatant (with protein) to a fresh eppendorf tube<br />
<br />
===Sonication===<br />
<br />
* Spin off 1ml of culture for 5' @ 10,000 rpm and 4ºC<br />
* Decant sample and get out as much of the LB medium as possible<br />
* Resuspend pellet in 1ml of 1x PBS<br />
* Sonicate samples 2 times for 15 seconds with a 15 second pause in between. Make sure samples are kept on ice during sonication.<br />
* Spin off 2' @ max speed and 4ºC<br />
* Transfer supernatant (with protein) to a fresh eppendorf tube<br />
<br />
==Buffers & (Stock) Solutions==<br />
[[#Protocols | Back to top]]<br><br />
===Antibiotics (1000x stock solutions)===<br />
*Ampicillin: 100 mg/ml in H<sub>2</sub>O<br />
*Chloroamphenicol: 34 mg/ml in etOH<br />
*Kanamycin: 10 mg/ml in H<sub>2</sub>O<br />
*Tetracycline: 5 mg/ml etOH<br />
<br />
===SOB (Super Optimal Broth)===<br />
For 1 liter dissolve in H<sub>2</sub>O<br />
*20 g Bacto tryptone<br />
*5 g Bacto-Yeast extract<br />
*0.5 g NaCl<br />
*10 ml 250 mM KCl<br />
*adjust pH to 7.0<br />
*before use add 5 ml of 2mM MgCl<sub>2</sub><br />
<br />
===SOC (Super Optimal broth with Catabolite repression)===<br />
*add 20 mM glucose to 1L SOB.<br />
*You can also order small bottles from Invitrogen (which is what we did)<br />
<br />
===LB medium (Lysogeny Broth<sup>[http://jb.asm.org/cgi/content/full/186/3/595]</sup>, but better known as Luria-Bertani Medium)===<br />
In 950 mL H<sub>2</sub>O<br />
*10 g Bacto Tryptone<br />
*5 g Bacto-Yeast extract<br />
*10 g NaCl<br />
*adjust pH to 7.0<br />
<br />
===10x TBE (Tris, Boric Acid, EDTA)===<br />
To make 1L, dissolve in 950 ml H<sub>2</sub>O<br />
*54 g Tris<br />
*27.5 g Boric Acid<br />
*4.65 g EDTA or 20 ml 0.5M EDTA pH 8.0<br />
<br />
===6x DNA Gel loading buffer ===<br />
*Dissolve in H<sub>2</sub>O<br />
*0.25% Bromophenolblue<br />
*0.25% Xylene Cyanol FF<br />
*40% (w/v) Sucrose<br />
<br />
===10x PBS (Phosphate Buffered Saline)===<br />
In 950 mL H<sub>2</sub>O dissolve:<br />
*11.5g Na<sub>2</sub>HPO<sub>4</sub><br />
*2g KH<sub>2</sub>PO<sub>4</sub><br />
*80g NaCl<br />
*2g KCl<br />
Adjust volume to 1L<br><br />
The pH of 1x PBS should be 7.4<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_overviewTeam:TUDelft/Temperature overview2008-10-29T17:54:59Z<p>Ruudjorna: /* Temperature Overview */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Temperature Overview=<br />
<br />
We want to create an RNA-based system that is able to have differential gene expression when temperature changes take place (comparable to the [https://2006.igem.org/Berkeley2006-RiboregulatorsMain Berkeley iGEM 2006] riboregulator lock/key part). <br />
[[Image:Rna_thermometer.png|200px|right|thumb|'''Figure 1:''' RNA thermometer]]<br />
There are several systems suggested in literature that are based on RNA secondary structure <span id="cite_ref_1">[[Team:TUDelft/Temperature_overview#cite_note_1|[1]]]</span>. The idea in general is that if the temperature drops below a certain temperature, the RNA will form stable base-pairs on the Shine-Dalgarno sequence, disabling the ribosome to bind. The base-pairing of this RNA region will block the expression of the protein encoded behind it (figure 1). In this way gene expression can be regulated on the RNA level by temperature.<br />
<br />
At the beginning of the project, an [[Team:TUDelft/Temperature_analysis|analysis]] has been performed to get more insight into the functioning of an RNA thermometer. The design of the temperature sensitive switch is divided in two phases. In [[Team:TUDelft/Temperature_design|the first phase]] existing RNA thermometers have been turned into BioBrick Standard Biological Parts. In the [[Team:TUDelft/Temperature_design2|second phase]], an RNA thermometer has been redesigned in order to shift the switching temperature using the knowledge gained during the analysis.<br />
<br />
Also some [[Team:TUDelft/Temperature_software|software]] tools have been developed during the project. The first tool, the [[Team:TUDelft/Temperature_software#Stability_Profile_Plotter|Stability Profile Plotter]], has been used during the analysis, to produce plots that characterize the stability of an RNA hairpin structure. The second tool, the [[Team:TUDelft/Temperature_software#RNA_Hairpin_Designer|RNA Hairpin Designer]], provides a (partial) implementation of the design approach as proposed in the second design phase. This tool can be used for the design of temperature sensitive RNA hairpins.<br />
<br />
The results of the labwork indicate that sonication of our samples, obtained the most reliable results. These indicated, as displayed [[Team:TUDelft/Temperature_results#Luciferase_Measurements|here]], that our strain K115035 shows the temperature induced switch-like behavior which was the aim of our project.<br />
<br />
==References==<br />
<br />
<ol class="references"><br />
<br />
<li id="cite_note_1"> [[Team:TUDelft/Temperature_overview#cite_ref_1 | ^]] Narberhaus F. mRNA-mediated detection of environmental conditions. ''Archives of Microbiology'', 178(6):404-410, 2002. [http://www.ncbi.nlm.nih.gov/pubmed/16680139 PMID:16680139]</li><br />
<br />
</ol><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_overviewTeam:TUDelft/Temperature overview2008-10-29T17:54:25Z<p>Ruudjorna: /* Temperature Overview */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Temperature Overview=<br />
<br />
We want to create an RNA-based system that is able to have differential gene expression when temperature changes take place (comparable to the [http://parts.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Berkeley iGEM 2006] riboregulator lock/key part). <br />
[[Image:Rna_thermometer.png|200px|right|thumb|'''Figure 1:''' RNA thermometer]]<br />
There are several systems suggested in literature that are based on RNA secondary structure <span id="cite_ref_1">[[Team:TUDelft/Temperature_overview#cite_note_1|[1]]]</span>. The idea in general is that if the temperature drops below a certain temperature, the RNA will form stable base-pairs on the Shine-Dalgarno sequence, disabling the ribosome to bind. The base-pairing of this RNA region will block the expression of the protein encoded behind it (figure 1). In this way gene expression can be regulated on the RNA level by temperature.<br />
<br />
At the beginning of the project, an [[Team:TUDelft/Temperature_analysis|analysis]] has been performed to get more insight into the functioning of an RNA thermometer. The design of the temperature sensitive switch is divided in two phases. In [[Team:TUDelft/Temperature_design|the first phase]] existing RNA thermometers have been turned into BioBrick Standard Biological Parts. In the [[Team:TUDelft/Temperature_design2|second phase]], an RNA thermometer has been redesigned in order to shift the switching temperature using the knowledge gained during the analysis.<br />
<br />
Also some [[Team:TUDelft/Temperature_software|software]] tools have been developed during the project. The first tool, the [[Team:TUDelft/Temperature_software#Stability_Profile_Plotter|Stability Profile Plotter]], has been used during the analysis, to produce plots that characterize the stability of an RNA hairpin structure. The second tool, the [[Team:TUDelft/Temperature_software#RNA_Hairpin_Designer|RNA Hairpin Designer]], provides a (partial) implementation of the design approach as proposed in the second design phase. This tool can be used for the design of temperature sensitive RNA hairpins.<br />
<br />
The results of the labwork indicate that sonication of our samples, obtained the most reliable results. These indicated, as displayed [Team:TUDelft here], that our strain K115035 shows the temperature induced switch-like behavior which was the aim of our project.<br />
<br />
==References==<br />
<br />
<ol class="references"><br />
<br />
<li id="cite_note_1"> [[Team:TUDelft/Temperature_overview#cite_ref_1 | ^]] Narberhaus F. mRNA-mediated detection of environmental conditions. ''Archives of Microbiology'', 178(6):404-410, 2002. [http://www.ncbi.nlm.nih.gov/pubmed/16680139 PMID:16680139]</li><br />
<br />
</ol><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_overviewTeam:TUDelft/Temperature overview2008-10-29T17:53:24Z<p>Ruudjorna: /* Temperature Overview */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Temperature Overview=<br />
<br />
We want to create an RNA-based system that is able to have differential gene expression when temperature changes take place (comparable to the [http://parts.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Berkeley iGEM 2006] riboregulator lock/key part). <br />
[[Image:Rna_thermometer.png|200px|right|thumb|'''Figure 1:''' RNA thermometer]]<br />
There are several systems suggested in literature that are based on RNA secondary structure <span id="cite_ref_1">[[Team:TUDelft/Temperature_overview#cite_note_1|[1]]]</span>. The idea in general is that if the temperature drops below a certain temperature, the RNA will form stable base-pairs on the Shine-Dalgarno sequence, disabling the ribosome to bind. The base-pairing of this RNA region will block the expression of the protein encoded behind it (figure 1). In this way gene expression can be regulated on the RNA level by temperature.<br />
<br />
At the beginning of the project, an [[Team:TUDelft/Temperature_analysis|analysis]] has been performed to get more insight into the functioning of an RNA thermometer. The design of the temperature sensitive switch is divided in two phases. In [[Team:TUDelft/Temperature_design|the first phase]] existing RNA thermometers have been turned into BioBrick Standard Biological Parts. In the [[Team:TUDelft/Temperature_design2|second phase]], an RNA thermometer has been redesigned in order to shift the switching temperature using the knowledge gained during the analysis.<br />
<br />
Also some [[Team:TUDelft/Temperature_software|software]] tools have been developed during the project. The first tool, the [[Team:TUDelft/Temperature_software#Stability_Profile_Plotter|Stability Profile Plotter]], has been used during the analysis, to produce plots that characterize the stability of an RNA hairpin structure. The second tool, the [[Team:TUDelft/Temperature_software#RNA_Hairpin_Designer|RNA Hairpin Designer]], provides a (partial) implementation of the design approach as proposed in the second design phase. This tool can be used for the design of temperature sensitive RNA hairpins.<br />
<br />
The results of the labwork indicate that sonication of our samples, obtained the most reliable results. These indicated, as displayed here, that our strain K115035 shows the temperature induced switch-like behavior which was the aim of our project.<br />
<br />
==References==<br />
<br />
<ol class="references"><br />
<br />
<li id="cite_note_1"> [[Team:TUDelft/Temperature_overview#cite_ref_1 | ^]] Narberhaus F. mRNA-mediated detection of environmental conditions. ''Archives of Microbiology'', 178(6):404-410, 2002. [http://www.ncbi.nlm.nih.gov/pubmed/16680139 PMID:16680139]</li><br />
<br />
</ol><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:51:42Z<p>Ruudjorna: /* Results */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
Fast links to different parts of the results:<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!BBa_K115012!!BBa_K115035!<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:51:09Z<p>Ruudjorna: /* Results */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
# [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|Assembly of the temperature sensitive constructs]]<br />
# [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|Obtaining a correct working protocol to measure luminescence]]<br />
# [[Team:TUDelft/Temperature_results#Luciferase_Measurements|Actual luciferase measurements]]<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC</b><br />
!Temperature!!BBa_K115012!!BBa_K115035!<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_conclusionsTeam:TUDelft/Temperature conclusions2008-10-29T17:45:23Z<p>Ruudjorna: /* Temperature sensitivity - Results with sonication */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Conclusions Temperature=<br />
<br />
<br />
After a great summer of hard work, we've learned quite a few things. The most important about the thermometer RNA are listed below. <br />
<br />
===Temperature sensitivity - Protein measurements===<br />
Because lysis efficiency seems to vary during and in between experiments, it is not possible to take the cell density before lysis as a value for correcting luciferase activity. Protein content measurements of the soluble fraction after lysis should be conducted to reliably normalize luminescence. Total protein content determination was performed by Bicinchoninic acid assay (BC assay). However, the lysis buffer (of unknown composition) in the luciferase assay kit interfered with the protein measurements. To circumvent this interference we tried precipitating the protein in the samples using 4 different methods to get rid of the (unknown) interfering agent in the lysis buffer. Although calibration curves that were first treated with lysis buffer and then precipitated varied from quite linear (R<sup>2</sup>=0.983) to not linear at all (R<sup>2</sup><0), samples containing the soluble fraction of lysed cells usually gave protein contents of below 0 mg/ml.<br />
<br />
A different approach to solve the problem of lysis buffer interference was trying different lysis methods. Sonication, using glass beads in a FastPrep or using lysozyme and glass sand in a bead beater. Some luciferase activity was lost with all these methods, and time was lacking to optimize each method. The sonication protocol, although time consuming, seemed most reliable in our experiments. Still, this method is not optimal, as samples lysed with lysis buffer show a lot higher raw luciferase output.<br />
<br />
===Temperature sensitivity - Results with sonication===<br />
Using sonication of our samples, we obtained the most reliable results. These indicated, as displayed [https://2008.igem.org/Image:TUDelft221508a.png here], that our strain K115035 shows the temperature induced switch-like behavior which was the aim of our project. <br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_conclusionsTeam:TUDelft/Temperature conclusions2008-10-29T17:44:55Z<p>Ruudjorna: /* Temperature sensitivity - Protein measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Conclusions Temperature=<br />
<br />
<br />
After a great summer of hard work, we've learned quite a few things. The most important about the thermometer RNA are listed below. <br />
<br />
===Temperature sensitivity - Protein measurements===<br />
Because lysis efficiency seems to vary during and in between experiments, it is not possible to take the cell density before lysis as a value for correcting luciferase activity. Protein content measurements of the soluble fraction after lysis should be conducted to reliably normalize luminescence. Total protein content determination was performed by Bicinchoninic acid assay (BC assay). However, the lysis buffer (of unknown composition) in the luciferase assay kit interfered with the protein measurements. To circumvent this interference we tried precipitating the protein in the samples using 4 different methods to get rid of the (unknown) interfering agent in the lysis buffer. Although calibration curves that were first treated with lysis buffer and then precipitated varied from quite linear (R<sup>2</sup>=0.983) to not linear at all (R<sup>2</sup><0), samples containing the soluble fraction of lysed cells usually gave protein contents of below 0 mg/ml.<br />
<br />
A different approach to solve the problem of lysis buffer interference was trying different lysis methods. Sonication, using glass beads in a FastPrep or using lysozyme and glass sand in a bead beater. Some luciferase activity was lost with all these methods, and time was lacking to optimize each method. The sonication protocol, although time consuming, seemed most reliable in our experiments. Still, this method is not optimal, as samples lysed with lysis buffer show a lot higher raw luciferase output.<br />
<br />
===Temperature sensitivity - Results with sonication===<br />
Using sonication of our samples, we obtained our most reliable results. These indicated, as displayed [https://2008.igem.org/Image:TUDelft221508a.png here], that our strain K115035 shows the temperature induced switch-like behavior which was the aim of our project. <br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:36:06Z<p>Ruudjorna: /* PCR */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [https://2007.igem.org/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR. Table 1 gives an overview of the sequences of all primers designed.<br />
<br />
<div class="center"><br />
{| border="1"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br/><br />
<br />
===Expression system===<br />
<br/><br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:35:37Z<p>Ruudjorna: /* PCR */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR.<br />
<br />
<div class="center"><br />
{| border="1"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br/><br />
<br />
===Expression system===<br />
<br/><br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:35:24Z<p>Ruudjorna: /* Expression system */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR.<br />
<br />
<div class="center"><br />
{| border="1"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br/><br/><br />
<br />
===Expression system===<br />
<br/><br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:35:13Z<p>Ruudjorna: /* Expression system */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR.<br />
<br />
<div class="center"><br />
{| border="1"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br/><br/><br />
<br />
===Expression system===<br />
</br><br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:34:57Z<p>Ruudjorna: /* PCR */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR.<br />
<br />
<div class="center"><br />
{| border="1"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br/><br/><br />
<br />
===Expression system===<br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:34:14Z<p>Ruudjorna: /* PCR */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR.<br />
<br />
<div align="center"><br />
{| border="1"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br />
===Expression system===<br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Color_designTeam:TUDelft/Color design2008-10-29T17:33:43Z<p>Ruudjorna: /* PCR */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
<br />
=Parts Design=<br />
==Genes of the Color Pathway==<br />
The enzymes necessary to produce colored ''Escherichia coli'' colonies will be isolated from ''E. coli'' genomic DNA and ''Saccharomyces cerevisiae'' cDNA. A total of eight enzymes are needed to produce FPP, for the rest of the pathway we will make use of BioBrick [http://partsregistry.org/Part:BBa_I742152 I742152] and [http://partsregistry.org/Part:BBa_I742161 I742161] to make sure colonies will turn red. Other colors (orange and yellow also see the [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Wet_Lab Edinburgh 2007 wiki]) can be produced by adding other enzymes from the registry. Of the eight enzymes we will isolate three are ''E. coli'' enzymes (atoB, idi and ispA), while the other five are ''S. cerevisiae'' enzymes (ERG8, ERG12, ERG13, MVD1 and HMG2).<br />
<br />
==Design==<br />
To see all parts we are working on [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft click here]. All parts with number BBa_K115050 and higher are the parts involved in color synthesis. <br />
<br />
===PCR===<br />
To PCR the genes out of the ''E. coli'' genome, we've designed primers using the invitrogen website. These primers don't contain the biobrick prefix and suffix yet. When the first PCR on the genome has worked with ''Taq'' polymerase, we will try it with ''Pfx'' polymerase which has proofreading and is more reliable. On these products, we'll perform a new PCR, with attached biobrick prefix and suffix. This way we prevent interference of the prefix or suffix in our genomic PCR.<br />
<br />
<div align="center"><br />
{| class="wikitable"<br />
|+ <b>Table 1. Primers used for the PCRs during this project with the respective target genes. atoB2, idi2 and ispA2 are the primers used for touch down PCR with BioBrick pre- and suffix.</b><br />
|-<br />
! Target gene (name)<br />
! Sequence<br />
|-<br />
|idi2 F <br />
|GAATTCGCGGCCGCTTCTAGATGCAAACGGAACACGTCA<br />
|-<br />
|idi2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|atoB2 F <br />
|GAATTCGCGGCCGCTTCTAGATGAAAAATTGTGTCATCGTCAGT<br />
|-<br />
|atoB2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ispA2 F <br />
|GAATTCGCGGCCGCTTCTAGATGGACTTTCCGCAGCAA<br />
|-<br />
|ispA2 R <br />
|CTGCAGCGGCCGCTACTAGTATTATTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|atoB F <br />
|AAATCTAGAAATGAAAAATTGTGTCATCGTCAG<br />
|-<br />
|atoB R <br />
|TTTACTAGTTTAATTCAATCGTTCAATCACCAT<br />
|-<br />
|ERG13 F <br />
|AAATCTAGAAAAGGTGCAGCATGAAACTCTC<br />
|-<br />
|ERG13 R <br />
|TTTACTAGTTGGGGGAAGATTATTTTTTAACATC<br />
|-<br />
|HMG2 F <br />
|AAATCTAGAAATGTCACTTCCCTTAAAAACGATAG<br />
|-<br />
|HMG2 R <br />
|TTTACTAGTTTATAATAATGCTGAGGTTTTACAGGG<br />
|-<br />
|ERG12 F <br />
|AAATCTAGATATGTCATTACCGTTCTTAACTTCTGC<br />
|-<br />
|ERG12 R <br />
|TTTACTAGTTTATGAAGTCCATGGTAAATTCGTG<br />
|-<br />
|ERG8 F <br />
|AAATCTAGAAATGTCAGAGTTGAGAGCCTTCA<br />
|-<br />
|ERG8 R <br />
|TTTACTAGTTTATTTATCAAGATAAGTTTCCGGATC<br />
|-<br />
|MVD1 F <br />
|AAATCTAGAAATGACCGTTTACACAGCATCC<br />
|-<br />
|MVD1 R <br />
|TTTACTAGTTTATTCCTTTGGTAGACCAGTCTTTG<br />
|-<br />
|idi F <br />
|AAATCTAGATATGCAAACGGAACACGTCA<br />
|-<br />
|idi R <br />
|TTTACTAGTTTATTTAAGCTGGGTAAATGCAGAT<br />
|-<br />
|ispA F <br />
|AAATCTAGAAATGGACTTTCCGCAGCA<br />
|-<br />
|ispA R <br />
|TTTACTAGTTTATTTATTACGCTGGATGATGTAGTC<br />
|-<br />
|BB F <br />
|TGCCACCTGACGTCTAAGAA<br />
|-<br />
|BB R <br />
|ATTACCGCCTTTGAGTGAGC<br />
|}<br />
</div><br />
<br />
===Expression system===<br />
As we need to drain FPP constantly (FPP is toxic to the cell in high concentrations), the idea is to produce a color or the direct precursor (Phytoene) at all temperatures. We want to express the enzymes of the FPP producing pathway constitutively, independent of temperature. There is a need however to 'tune' this expression to the consumption of the color pathway. In practice this means the eight enzymes necessary for FPP production will be expressed in one operon under the same promotor. However, the required strength of the promotor and ribosome binding site will have to be determined experimentally. The color enzymes (from FPP to lycopene, B-carotene and zeaxanthin) will be expressed seperately and under regulation of the RNA thermometers. As we will obtain three colors, this would mean two switches, for instance at 27ºC and 37ºC in the case of constitutively induced lycopene production. This means red colonies will form at all temperatures below 27ºC. However the enzyme for B-carotene production would be switched on (by loss of secondary structure of the RNA element) at 27ºC and between 27ºC and 37ºC ''E. coli'' colonies will be orange. Above 37ºC the zeaxanthin enzyme will be turned on and colonies will have a yellow color. If the basic molecule will be phytoene, there is room for three RNA thermometers, for example 27ºC, 32ºC and 37ºC. This would give the temperature scheme of:<br />
* T < 27ºC: '<i>E. coli</i> color'<br />
* 27ºC < T < 32ºC: Red<br />
* 32ºC < T < 37ºC: Orange<br />
* 37ºC < T : Yellow<br />
<br />
==Results==<br />
The first gradient PCR have been performed on the genes, the ''E. coli'' genes all worked correctly (see lab notebook entry of [https://2008.igem.org/TUDelft/19_August_2008 August 19th]), while still some work has to be done on the ''S. cerevisiae'' primers ([https://2008.igem.org/TUDelft/20_August_2008 August 20th]). The next step will be to PCR the ''E. coli'' genes again, with the ideal annealing temperature, using ''Pfx'' polymerase instead of ''Taq''. The ''Pfx'' enzyme has proofreading and so is less likely to make a mistake within the genes. The gradient PCR on ''S. cerevisiae'' cDNA will be repeated and optimized.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:14:27Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC<br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:13:43Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. <br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:13:11Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 with respect to the amount of luminescence measured for the strains at 20ºC<br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:12:02Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00.<br/><br/><br />
<br />
<div class="center"><br />
{|border="1"<br />
|+ <b>Table 2. Fold increasement of luminescence for constructs BBa_K115012 and BBa_K115035 in respect to the amount of luminescence measured for the strains at 20ºC<br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:08:26Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00. <br />
<div class="center"><br />
{|border="1"<br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
</div><br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:07:40Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00. <br />
<br />
{|border="1"<br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|-<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T17:06:20Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC. Finally, table 2 shows the fold increasement of luminescence for BBa_K115012 and BBa_K115035 at 30 and 37ºC. These numbers are normalized for the amount of luminescence of these strains at 20ºC, so at 20ºC the strains have index number 1.00. <br />
<br />
{|border="1"|align="center"|<br />
!Temperature!!BBa_K115012!!BBa_K115035<br />
|20ºC<br />
|1.00<br />
|1.00<br />
|- <br />
|30ºC<br />
|2.44<br />
|1.92 <br />
|-<br />
|37ºC<br />
|4.66<br />
|17.6<br />
|}<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:53:09Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
The results obtained for 30ºC are consistent with the findings at 20 and 37ºC. Luminescence and thus luciferase expression goes up from 20 to 30ºC for both constructs, but going from 30 to 37ºC the increase is clearly higher for BBa_K115035 than for BBa_K115012. BBa_K115035 is supposed to switch at 32ºC and according to these data it is not switched on at 30ºC.<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:47:45Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br/><br/><br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:46:59Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Numbers in the legend represent the last two numbers of the construct name, e.g. 12 = BBa_K115012. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/File:TUDelftfinalpicture.pngFile:TUDelftfinalpicture.png2008-10-29T16:45:14Z<p>Ruudjorna: </p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:43:04Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. Due to time constraints, it was decided that we conduct one more experiment with only BBa_K115012 and BBa_K115035 as this construct has the highest probability of bearing a working RNA thermometer. One more experiment was conducted at 30ºC with only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 (that is supposed to switch at 32ºC). Figure 11 shows the results of measurements at 20 and 37ºC that were conducted before and 30ºC.<br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but another temperature, 30ºC, is added and only constructs BBa_K115012 and BBa_K115035 are shown. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:35:23Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. At the moment this construct has the highest probability of bearing an RNA thermometer. To have a clearer picture, luminescence per ug of total protein is again depicted in figure 11, but now only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 are shown.<br />
<br />
[[Image:TUDelftfinalpicture.png|thumb|550px|center|Figure 11. Luminescence per ug protein as shown in figure 9A, but now only constructs BBa_K115012 and BBa_K115035. Four samples were measured in duplo for every data point. Error bars represent two times SEM.]]<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:32:41Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
From figure 10 it is clear that we have one construct, BBa_K115035, that has an increase of luminescence that is significantly higher than the increase of BBa_K115012. At the moment this construct has the highest probability of bearing an RNA thermometer. To have a clearer picture, luminescence / ug of total protein is again depicted in figure 11, but now only the control non-temperature sensitive strain BBa_K115012 and BBa_K115035 are shown.<br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceno31.pngFile:TUDelftluminescenceno31.png2008-10-29T16:19:28Z<p>Ruudjorna: uploaded a new version of "Image:TUDelftluminescenceno31.png"</p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceno31.pngFile:TUDelftluminescenceno31.png2008-10-29T16:18:28Z<p>Ruudjorna: uploaded a new version of "Image:TUDelftluminescenceno31.png"</p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceno31.pngFile:TUDelftluminescenceno31.png2008-10-29T16:17:39Z<p>Ruudjorna: uploaded a new version of "Image:TUDelftluminescenceno31.png"</p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceallconstructs.pngFile:TUDelftluminescenceallconstructs.png2008-10-29T16:14:01Z<p>Ruudjorna: uploaded a new version of "Image:TUDelftluminescenceallconstructs.png"</p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceallconstructs.pngFile:TUDelftluminescenceallconstructs.png2008-10-29T16:08:14Z<p>Ruudjorna: uploaded a new version of "Image:TUDelftluminescenceallconstructs.png"</p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceallconstructs.pngFile:TUDelftluminescenceallconstructs.png2008-10-29T16:07:39Z<p>Ruudjorna: uploaded a new version of "Image:TUDelftluminescenceallconstructs.png"</p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T16:00:12Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as figure 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T15:59:44Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|250px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|250px|Figure 9B. Same as 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T15:59:16Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The results for the 20 and 37ºC measurements are depicted in figure 9A and B.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|260px|left|Figure 9A. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|260px|Figure 9B. Same as 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From these figures at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T15:58:18Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The result of the 20 and 37ºC measurements is depicted in figure 9.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|260px|left|Figure 9. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|260px|Figure 9B. Same as 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From this figure at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/File:TUDelftluminescenceno31.pngFile:TUDelftluminescenceno31.png2008-10-29T15:56:13Z<p>Ruudjorna: </p>
<hr />
<div></div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T15:55:30Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The result of the 20 and 37ºC measurements is depicted in figure 9.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|275px|left|Figure 9. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
[[Image:TUDelftluminescenceno31.png|thumb|275px|Figure 9B. Same as 9A, but BBa_K115031 is left out for clarity of the figure]]<br />
{{clear}}<br />
<br/><br/><br />
From this figure at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T15:53:15Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The result of the 20 and 37ºC measurements is depicted in figure 9.<br/><br/><br />
<br />
<gallery align="center"><br />
Image:TUDelftluminescenceallconstructs.png<br />
Image:TUDelftluminescenceno31.png<br />
</gallery><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|550px|center|Figure 9. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
{{clear}}<br />
<br/><br/><br />
From this figure at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjornahttp://2008.igem.org/Team:TUDelft/Temperature_resultsTeam:TUDelft/Temperature results2008-10-29T15:51:38Z<p>Ruudjorna: /* Luciferase Measurements */</p>
<hr />
<div>{{Template:TUDelftiGEM2008}}<br />
<br />
{{Template:TUDelftiGEM2008_menu_home}}<br />
=Results=<br />
<br />
==Assembly of BBa_K115012 and BBa_K115029 - BBa_K115036==<br />
<br />
The first challenge of this project was to assemble all the devices we wanted to measure. An overview of these devices can be found [https://2008.igem.org/Team:TUDelft/Temperature_testing here]. For the actual construction of all devices the 3A assembly strategy was chosen. A complete protocol of this strategy can be found on [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly OpenWetWare]. A schematic representation of this assembly method is depicted in figure 1A and 1B.<br/><br/> <br />
<br />
[[Image:TUDelft3Amixture.png|thumb|250px|left|Figure 1A. The mixture present in the ligation mix before it is ligated during 3A assembly. The black box indicates the [http://partsregistry.org/Part:BBa_P1010 CcdB 'death' gene]. The arrows in red, blue and green indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
<br />
[[Image:TUDelftschematic3A.png|thumb|250px|Figure 1B. Representation of the 3A assembly method. The black arrow indicates the CcdB gene. The arrows in other colors indicate different types of antibiotic resistance. Restriction sites are indicated by: E = ''Eco''R1; P = ''Pst''I; X = ''Xba''I; S = ''Spe''I. Picture taken from OpenWetWare, http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly]]<br />
{{clear}}<br />
<br />
For the succesful use of this assembly, it is essential that the DB3.1 ''Escherichia coli'' strain is not used as it tolerates the presence of the CcdB gene. Throughout the project we used commercial Top10 cells of Invitrogen that were made competent chemically. Furthermore, it is important to note that the ''Xba''I and ''Spe''I restriction enzymes generate compatible sticky ends. Assuming that we want to place two BioBrick parts behind each other in one plasmid, but these are present in seperate plasmids before assembly (as is the case in Figure 1A, parts are depicted in purple and yellow in the blue and green plasmid, respectively). 3A assembly can be conducted by taking an empty plasmid that has a different antibiotic resistence as the other two plasmids (red in figure 1A and B, CcdB is present). Three seperate restriction reactions should be started as shown in [https://2008.igem.org/Image:TUDelft3Amixture.png figure 1A]. After cleaning up the restriction reactions they are mixed and ligated together. Parts can be ligated in several ways:<br/><br />
<br />
#The CcdB gene can be ligated back in the vector - If this happens, cells will not grow after transfection, as the ''E. coli'' strain used should not be CcdB gene tolerant.<br/><br />
#Other parts can be ligated back in the vector - Other plasmids should not have the same antibiotic resistence as the red plasmid, in other words, these are selected for.<br/><br />
#Ligation as depicted in [https://2008.igem.org/Image:TUDelftschematic3A.png figure 1B] - This is the ligation we are looking for and it should yield colonies after transformation.<br/><br />
#Other combinations of backbones and/or parts - It is possible other combinations (e.g. the three backbones together) form a plasmid that yields colonies, these parts will be much larger as the ones formed in option 3. Colony PCR's are performed afterwards to screen for these.<br/><br/><br />
<br />
In the end, the result on the gel of the colony PCR product is conclusive in terms of the succes of the 3A assembly. For all our parts at least three of the 3A assemblies (first promoter + ribosome binding site and luciferase + terminators, afterwards the result of these two together) gave our final product. An overview of the result on the gels can be found [https://2008.igem.org/Team:TUDelft/Supplementary_Data_3Agels here]. We succeeded in getting colonies that gave the correct band size on the gel for [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=TUDelft BBa_K115012 and BBa_K115029 - BBa_K115036]. The parts constructed and the temperature at which they are supposed to switch are depicted in table 1 .<br />
<br />
{| border="1" align="center"<br />
|+ <b>Table 1. Constructs with thermosensitive regions and their switching temperature</b><br />
!align="center"|Part Name!!align="center"|Theoretical switching temperature (°C)<br />
|-<br />
|align="center"|BBa_K115029<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115030<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115031<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115032<br />
|align="center"|42<br />
|-<br />
|align="center"|BBa_K115033<br />
|align="center"|37<br />
|-<br />
|align="center"|BBa_K115034<br />
|align="center"|27<br />
|-<br />
|align="center"|BBa_K115035<br />
|align="center"|32<br />
|- <br />
|align="center"|BBa_K115036<br />
|align="center"|37<br />
<br />
|}<br />
<br />
==Setting up luciferase measurements==<br />
<br />
===Luminescence of luciferase can be measured in two strains===<br />
<br/><br />
The first two devices that were succesfully transformed were BBa_K115012 and BBa_K115034. First we wanted an indication whether it was possible to measure luciferase using these constructs, so an experiment was set up with these two strains. The exact protocol used can be found on the [https://2008.igem.org/TUDelft/19_September_2008 19th of September] of the lab notebook. In short, sonication and lysis buffer from the Promega Luciferase kit were used to lyse the cells and luciferase expression was normalized to OD<sub>600</sub> of the original sample (before lysis). Furthermore, we cells were grown with and without arabinose induction as an inducible promoter ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0080 BBa_R0080]) was used. Figure 3 is a graphical representation of the amount of luciferase measured for the two strains the conditions depicted.<br/><br/><br />
<br />
[[Image:TUDelftbargraph1.png|thumb|550px|center|Figure 3. Measured amount of luminescence corrected for OD, two different constructs (BBa_K115012 and BBa_K115034) were tested. Induction was achieved by adding arabinose. Sample conditions were as follows: <br />
<ol><br />
<li>1. Induced growth overnight at room temperature, lysis by sonication</li><br />
<li>2. Induced growth overnight at 37ºC, lysis by sonication</li><br />
<li>3. Induced growth two times overnight at room temperature, lysis by sonication</li><br />
<li>4. Induced growth two times overnight at room temperature, lysis by Promega lysis buffer</li><br />
<li>5. Non-induced growth overnight at 37ºC, lysis by sonication (no induction at all, only BBa_K115012)</li><br />
</ol>]]<br />
{{clear}}<br />
<br/><br />
Several conclusions can be drawn from figure 3, although it has to be noted that this result is only one measurement. Furthermore, room temperature was not controlled. It may have fluctuated between 20 and 27ºC. The first conclusion is that we are able to measure luciferase with these constructs. This means that all parts used work correctly, including our ribosome binding site. The second conclusion is that a differential amount of luminescence is measured between strains BBa_K115012 and BBa_K115034, although in these results we cannot see a difference that is temperature dependent. This can be seen when the bars in conditions 1 and 2 are compared, BBa_K115012 gives a larger difference in luminescence from room temperature to 37ºC than BBa_K115034. The second conclusion is that luminescence measured when lysis is performed with the provided buffer is much higher (compare bars of condition 4 to the rest). The condition measured is not optimal as room temperature is used rather than 37ºC, but even now luminescence is a multitude higher than any of the sonicated samples. The reason for this is not clear: it could be that the lysis buffer lyses cells more efficiently, alternatively it could be that sonication denaturates a large part of the luciferase in the cell. Another conclusion is that the arabinose promoter does not work; a similar amount of luminescence was measured in samples where arabinose was added as compared to non-induced samples (figure 3, compare 5 to 1, 2, and 3).<br />
<br />
===Total protein content in stead of OD measurements===<br />
<br/><br />
To compare the amount of luciferase expression measured, the total luminescence should be normalized. In the first experiment we normalized the luminescence to the OD<sub>600</sub> in the culture. The OD<sub>600</sub> is an indication for the amount of cells present. However, the amount of protein (total protein as well as luciferase) in the sample and thus the amount of luminescence is dependent on the lysis efficiency of the method used. Correcting total luminescence for total amount of protein would circumvent the lysis efficiency. After the first experiment it was decided that total protein content measurements would be conducted in the future. The OD<sub>600</sub> will still be measured and lysis efficiency calculated. If a constant lysis efficiency (OD/protein content) is observed, we could still decide to normalize for OD<sub>600</sub>.<br />
<br />
The protocol used for the next experiment measurements can be found [https://2008.igem.org/Team:TUDelft/25th_of_September_protocol here]. In figure 4 the results are depicted per construct in luminescence per mg of total protein. A word of caution is in order when interpreting these results, as we found out when performing BC assays (performed according to [http://www.interchim.com/interchim/bio/produits_uptima/tech_sheet/FT-UP40840(BCA).pdf manufacturer's protocol]). The lysis buffer of the Promega luciferase assay kit reacts with copper residues used to determine protein content during the BC assay. Measuring 1x lysis buffer in the BC assay give a higher read-out than any of the samples in the standard calibration curve. The results presented here are obtained by diluting the samples with lysis buffer 1,000 times so their read-out fits within a normal calibration curve, without lysis buffer. Protein content used to normalize luminescence may differ a lot from the actual protein content in the samples, but protein contents could still be proportional.<br/><br/><br />
<br />
[[Image:TUDelftbargraph2.png|thumb|550px|center|Figure 4. Luminescence of four construct and the control per ug total protein content. Note that there is no measurement for 26ºC for construct BBa_K115036.]]<br />
<br/><br/><br />
It can be seen in figure 4 that all constructs except BBa_K115012 show very little luminescence at 42ºC. OD readings were very low at this temperature, indicating that ''E. coli'' barely survives at that temperature. This is why we conclude that measurements at this temperature are not reliable. Although it is peculiar that BBa_K115012 does have a nice reading at 42ºC, especially since the 37ºC reading is lower than 30 and 42ºC (see figure 4, light blue bars). We think the 37ºC reading of BBa_K115012 was not a good reading, but to establish this we have to measure more samples in the same conditions and perform measurements at least in duplo to take into account biological variance. It was decided however to stop measuring at 42ºC. Further insight into these results is given by figure 5. Figure 5 gives an overview of the results presented in figure 4, but luminescence for each construct is normalized for the luminescence measured at the lowest temperature.<br/><br/><br />
<br />
[[Image:TUDelftbargraph3.png|thumb|550px|center|Figure 5. Luminescence of the four constructs and the control seen in figure 4, but normalized to the luminescence measured at the lowest temperature. BBa_K115036 is normalized for 30ºC, the rest of the constructs are normalized with respect to luminescence measured at 26ºC.]]<br />
<br/><br/><br />
To interpret figure 5 it is important to note that BBa_K115012 is our control, non-temperature sensitive construct. Any 'switching' effect in the other constructs should present itself by an increase of luminescence greater than the standard increase that follows from a higher temperature. So we are looking for an increase in luminescence greater than that of BBa_K115012. From figure 5 it follows that this seems only the case for construct BBa_K115036 going from 30 to 37ºC (see figure 5, compare the bars for BBa_K115012 and BBa_K115036 at 30 and 37ºC). However, lack of a measurement at lower temperature for BBa_K115036, the fact that we performed the measurements only once and shaky protein content measurements make these results unreliable. For now the main conclusions drawn for this experiment is that we devised a protocol that allow us to measure luminescence from the constructs in parallel. The second conclusion is that cell lysis performed with lysis buffer provides us with yet another challenge as lysis buffer reacts with BC assay reagents. We could either try to get rid of the lysis buffer by performing a protein precipitation on the samples before protein content is measured (but not before luminescence is measured, as precipitation denatures proteins), or alternatively we could look for other ways to lyse the cells.<br />
<br />
===Protein precipitation protocols===<br />
<br/><br />
Four different protein precipitation protocols were conducted to obtain protein content measurements without the disturbance of lysis buffer. The four protocols can be found [[Team:TUDelft/Protocols#Protein_Precipitation|here]], they are PCA, TCA/acetone, TCA/DOC and methanol/chloroform precipitation. For each of these precipitation methods four samples of constructs BBa_K115012, BBa_K115035 and BBa_K115036 and the calibration curve (bovine serum albumin in H<sub>2</sub>O) were resuspended in 1x lysis buffer. After OD<sub>562</sub> was measured, standard calibration curves were made for all four precipitation protocols together with a 'normal' calibration curve for comparative reasons. The result can be seen in figure 6.<br/><br/><br />
<br />
[[Image:TUDelftcalibrationprecip.png|thumb|550px|center|Figure 6. Calibration curves of OD<sub>562</sub> against known protein content before precipitation was conducted. R<sup>2</sup> values are depicted next to the protocol name in the legend. Results shown are averages of three seperate measurements]]{{clear}}<br />
<br/><br/><br />
It is clear from figure 6 that the PCA and acetone/TCA calibration curves are really bad. This can be due to incomplete removal of the lysis buffer and/or differences in precipitation efficiency from sample to sample. The methanol/chloroform standard curve is already much better, but still not good enough for accurate experimentation. The TCA/DOC standard curve can be considered all right. However, a lot of the construct samples measured in this experiment for all precipitation methods gave back negative protein contents. A reason for this could be that protein precipitation in complex (cell extracts) samples takes longer than for simple (calibration curve) samples. During the experiments the shortest incubation periods possible were taken, this could be the reason we did not measure protein content. We started looking for other ways to lyse the cells because we were not able to measure protein content with any of these protocols.<br />
<br />
===Alternative cell lysis: bead beater, FastPrep and sonication===<br />
<br/><br />
When protein precipitation methods did not work out, alternative methods of cell lysis were conducted. The protocols for cell lysis (including lysis buffer) can be found [[Team:TUDelft/Protocols#Cell_Lysis|here]]. FastPrep and bead beater protocols were obtained from research groups at Delft UT, while experiments were conducted to determine the best sonication time for our sample. Results of that experiment can be found [[TUDelft/7_October_2008#Sonication_optimization|here]]. For three constructs, BBa_K115012, BBa_K115035 and BBa_K115036 protein contents were measured in duplo of 4 samples with similar OD<sub>600</sub> to compare lysis of the cells. Results are shown in figure 7.<br/><br/><br />
<br />
[[Image:TUDelftproteincontentlysis.png|thumb|550px|center|Figure 7. Protein content measured for different constructs and cell lysis methods. Results shown were measured for eight measurements with similar OD<sub>600</sub>. Error bars were calculated with standard error of the mean (SEM) times two.]]<br />
{{clear}}<br />
<br/><br/><br />
Sonication is the most time consuming lysis method, but it also gives the best result according to figure 7. Although succesful alternative cell lysis protocols were set up, we stil needed to know whether these new lysis methods kept at least part of the luciferase in its native state. To measure this, luciferase measurements were conducted on the samples that were used to make figure 7. The results of this measurement are shown in figure 8.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceprotein.png|thumb|550px|center|Figure 8. Luminescence calculated per ug total protein. Samples used were the same as those used for figure 7. Results shown are averaged for eight measurements, error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
Figure 8 confirms that sonication is the best way to go for the luciferase measurements. In the construct BBa_K115012 measurement the difference between bead beater and sonication is not significant, but for the other two constructs it is. FastPrep did not yield any luminescence, probably because the FastPrep denaturates protein, at least at the intensity and time we used. The final protocol we settled on for the project can be found [[Team:TUDelft/15th_of_October_protocol|here]].<br />
<br/><br />
<br />
==Luciferase Measurements==<br />
<br />
Luciferase measurements on [[Team:TUDelft/Temperature_results#Assembly_of_BBa_K115012_and_BBa_K115029_-_BBa_K115036|all constructs]] and four different temperatures were conducted according to the protocol that was deviced [[Team:TUDelft/Temperature_results#Setting_up_luciferase_measurements|before]]. However, while performing the experiment the sonicator broke down. At the time we already sonicated samples of two temperatures, 20 and 37ºC. But unfortunately all samples of 25 and 30ºC were lost for the measurement. The result of the 20 and 37ºC measurements is depicted in figure 9.<br/><br/><br />
<br />
[[Image:TUDelftluminescenceallconstructs.png|thumb|550px|center|Figure 9. Luminescence per ug protein for all constructs at 20 and 37ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]] <br />
{{clear}}<br />
<br/><br/><br />
From this figure at least two conclusions can be drawn. Firstly, the luminescence reading of BBa_K115031 is very high compared to the other constructs. Secondly, BBa_K115033 does not work at all. This could be due to incorrect assembly of the construct. For further insight in the experiment figure 10 was made. Figure 10 shows the fold increasement of luminescence from 20ºC to 37ºC for all constructs.<br/><br/><br />
<br />
[[Image:TUDelftfoldincrease.png|thumb|550px|center|Figure 10. Fold increase of luminescence per ug of total protein of each construct in respect to luminescence measured at 20ºC. Four samples were measured in duplo for every data point. Error bars represent two times SEM]]<br />
{{clear}}<br />
<br/><br/><br />
<br />
<br />
{{Template:TUDelftiGEM2008_sidebar}}</div>Ruudjorna