Team:Hawaii/Biobrick conversions

From 2008.igem.org

(Difference between revisions)
(→Transformed into DH5α)
(→Ligated insert and vector)
Line 89: Line 89:
====Ligated insert and vector====
====Ligated insert and vector====
 +
* Ran 20 μl ligation reactions
 +
:* 7 μl BioBrick segment (~2.8 ng) + 0.5 μl pRL1383a vector (~0.95 ng)
 +
:* 7 μl GFP fusion (~7 ng) + 2 μl C0012 derived vector (~1.8 ng)
 +
====Transformed into DH5α====
====Transformed into DH5α====
* Used 10 μl of ligation reaction to transform.  
* Used 10 μl of ligation reaction to transform.  

Revision as of 01:59, 19 July 2008

Contents

Objectives

  • Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
  • Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS

Protocol

PCR mutagenesis of GFP

  • Combined:
  • 0.5 μl BBa_E0040 plasmid
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3.5 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 60 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
GFP fusion brick (site directed mutagenesis)
Primer Sequence Length G/C content Tm Notes
GFP fusion foward GCCGCTTCTAGAcgtaaaggag 22 bp 54.55% 60.2 C PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
GFP fusion reverse cgagtcagtgagcgaggaag 20 bp 60% 59.6 C PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')

Extraction of Biobrick MCS

  • Combined:
  • 0.5 μl BBa_B0034 plasmid
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3.5 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 90 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR
Primer Sequence Length G/C content Tm Notes
HindIII+VF2 cctAAGCTTtgccacctgacgtctaagaa 29 bp (20 bp) 48.3% (50.0%) 65.9 C (58.6 C) Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
BamHI+VR ccaGGATCCattaccgcctttgagtgagc 29 bp (20 bp) 55.2% (50.0%) 67.9 C (58.0 C) Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.

Subcloning of GFP fusion brick and pRL1383a Biobrick vector

Restriction digest

  • GFP fusion
  • BBa_C0012
  • BBa_B0034 derived MCS
  • pRL1383a

Ligated insert and vector

  • Ran 20 μl ligation reactions
  • 7 μl BioBrick segment (~2.8 ng) + 0.5 μl pRL1383a vector (~0.95 ng)
  • 7 μl GFP fusion (~7 ng) + 2 μl C0012 derived vector (~1.8 ng)

Transformed into DH5α

  • Used 10 μl of ligation reaction to transform.
  • Incubated 10 min. on ice after addition of DNA.
  • Plated GFP fusion + vector on LB + amp100
  • Plated MCS + pRL1383a on LB + sp100

Results

Discussion

Retrieved from "http://2008.igem.org/Team:Hawaii/Biobrick_conversions"