Team:NYMU-Taipei/Project/pH Sensor

From 2008.igem.org

(Difference between revisions)
(New page: == Motivation == * When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work. * In this subsystem, we are going to create a pH sensor which senses...)
Line 1: Line 1:
 +
{{:Team:NYMU-Taipei/Header}}
== Motivation ==
== Motivation ==
* When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
* When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
Line 11: Line 12:
* [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)
* [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)
-
[[Image:IGEM08 NhaA regulation.png]]
+
[[Image:NYMU_IGEM08_NhaA_regulation.png]]
-
[[Image:NhaA protein expression and activity regulated by pH.png|400px]]
+
[[Image:NYMU_NhaA_protein_expression_and_activity_regulated_by_pH.png|400px]]
=== Structure of '''''nhaA''''' gene promoter ===
=== Structure of '''''nhaA''''' gene promoter ===
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
-
[[Image:Promoter elements of nhaA.png]]
+
[[Image:NYMU_Promoter_elements_of_nhaA.png]]
* 17,189 -17,488 in ''E.coli'' K12 genome from Ecocyc (300 bp upstream of ''nhaA'' gene)
* 17,189 -17,488 in ''E.coli'' K12 genome from Ecocyc (300 bp upstream of ''nhaA'' gene)
  <font size=4>
  <font size=4>
Line 48: Line 49:
* [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
* [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
 +
{{:Team:NYMU-Taipei/Footer}}

Revision as of 17:39, 1 August 2008

NYMU Banner-wider 965px.png

Contents

Motivation

  • When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
  • In this subsystem, we are going to create a pH sensor which senses high pH's.

Goal

  • The pH sensor can sense a high pH condition and start gene expression.

Circuit Design

Regulation of nhaA gene expression

NYMU IGEM08 NhaA regulation.png NYMU NhaA protein expression and activity regulated by pH.png

Structure of nhaA gene promoter

NYMU Promoter elements of nhaA.png

  • 17,189 -17,488 in E.coli K12 genome from Ecocyc (300 bp upstream of nhaA gene) 

00000000011111111112222222222344444444455555555556666666666777777777788888888889
12345678901234567890123456789012345678901234567890123456789012345678901234567890
ACGACAAGCTGGATTATTTTTGAAATATTGGCCTAACAAGCATCGCCGACTGACAACAAATTAATTATTACTTTTCCTAA
TTAATCCCTCAGGAATCCTCACCTTAAGCTATGATTATCTAGGCTTAGGGTCACTCGTGAGCGCTTACAGCCGTCAAAAA
CGCATCTCACCGCTGATGGCGCAAATTCTTCAATAGCTCGTAAAAAACGAATTATTCCTACACTATAATCTGATTTTAAC
GATGATTCGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCTGAAAGAGAAATAAAAA
  • G is the start of NhaR binding site
  • TTTTAA is the first -35 of P1
  • ATGATT is the second -35 of P1
  • TAAAAT is the first -10 of P1
  • TAAAAA is the second -10 of P1; A in the TAAAAA is the first TSS of P1
  • AAGAGA is the S.D. (Shine-Dalgarno) sequence in RBS
  • There are 3 nhaA promoter sequences protected by NhaR from DNase I digestion
    • AATAGCTCGTAAAAAACGAATTATTCC
    • CACTATAATCTGATTTTAACGATG
    • CGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCT; T in TTCACCT is the second TSS of P1
  • The extracted DNA sequence should include the NhaR binding site
    • The NhaR binding site defined in (Nir Dover and Etana Padan et al.,2001) is 120 bp long
    • The PCR product derived from primers designed by Henry is 274 bp long

References

Retrieved from "http://2008.igem.org/Team:NYMU-Taipei/Project/pH_Sensor"