"

 

From 2008.igem.org

Contents 1 Motivation 2 Goal 3 Circuit Design 3.1 Regulation of nhaA gene expression 3.2 Structure of nhaA gene promoter 4 References

Motivation

• When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
• In this subsystem, we are going to create a pH sensor which senses high pH's.

Goal

• The pH sensor can sense a high pH condition and start gene expression.

Circuit Design

Regulation of nhaA gene expression

• Na1-Induced Transcription of nhaA, Which Encodes an Na1/H1 Antiporter in Escherichia coli, Is Positively Regulated by nhaR and Affected by hns (N. DOVER etc.,1996)
• Molecular physiology of the Na+/H+ antiporter in Escherichia coli (E Padan and S Schuldiner, 1994)

File:IGEM08 NhaA regulation.png 400px

Structure of nhaA gene promoter

• Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase (Nir Dover and Etana Padan et al.,2001)

File:Promoter elements of nhaA.png

• 17,189 -17,488 in E.coli K12 genome from Ecocyc (300 bp upstream of nhaA gene)

00000000011111111112222222222344444444455555555556666666666777777777788888888889
12345678901234567890123456789012345678901234567890123456789012345678901234567890
ACGACAAGCTGGATTATTTTTGAAATATTGGCCTAACAAGCATCGCCGACTGACAACAAATTAATTATTACTTTTCCTAA
TTAATCCCTCAGGAATCCTCACCTTAAGCTATGATTATCTAGGCTTAGGGTCACTCGTGAGCGCTTACAGCCGTCAAAAA
CGCATCTCACCGCTGATGGCGCAAATTCTTCAATAGCTCGTAAAAAACGAATTATTCCTACACTATAATCTGATTTTAAC
GATGATTCGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCTGAAAGAGAAATAAAAA 

• G is the start of NhaR binding site
• TTTTAA is the first -35 of P1
• ATGATT is the second -35 of P1
• TAAAAT is the first -10 of P1
• TAAAAA is the second -10 of P1; A in the TAAAAA is the first TSS of P1
• AAGAGA is the S.D. (Shine-Dalgarno) sequence in RBS
• There are 3 nhaA promoter sequences protected by NhaR from DNase I digestion
  • AATAGCTCGTAAAAAACGAATTATTCC
  • CACTATAATCTGATTTTAACGATG
  • CGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCT; T in TTCACCT is the second TSS of P1
• The extracted DNA sequence should include the NhaR binding site
  • The NhaR binding site defined in (Nir Dover and Etana Padan et al.,2001) is 120 bp long
  • The PCR product derived from primers designed by Henry is 274 bp long

References

• Molecular physiology of the Na+/H+ antiporter in Escherichia coli (E Padan and S Schuldiner, 1994)
• Histidine-226 is part of the pH sensor of NhaA, a Na+/H+ antiporter in Escherichia coli (Y Gerchman etc., 1993)
• Structure of a Na+/H+ antiporter and insights into mechanism of action and regulation by pH (Carola Hunte etc., 2005)
• Na1-Induced Transcription of nhaA, Which Encodes an Na1/H1 Antiporter in Escherichia coli, Is Positively Regulated by nhaR and Affected by hns (N. DOVER etc.,1996)
• Molecular physiology of the Na+/H+ antiporter in Escherichia coli (E Padan and S Schuldiner, 1994)
• NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter (E. Padan etc., 2004)
• Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase (Nir Dover and Etana Padan et al.,2001)

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Printable version
• Permanent link
• Privacy policy
• Disclaimers