"
Template:Team:UC Berkeley/Notebook/CC construction
From 2008.igem.org
(Difference between revisions)
Cicikashou (Talk | contribs) (→K112504) |
Cicikashou (Talk | contribs) |
||
| Line 1: | Line 1: | ||
__TOC__ | __TOC__ | ||
| - | == | + | ==K112500== |
<pre> | <pre> | ||
Construction of {<HA>} basic part K112501 | Construction of {<HA>} basic part K112501 | ||
| Line 7: | Line 7: | ||
Wobble PCR of cc001/cc002 ( 60 bp, EcoRI/BamHI) | Wobble PCR of cc001/cc002 ( 60 bp, EcoRI/BamHI) | ||
Sub into pBca1256 (EcoRI/BamHI) | Sub into pBca1256 (EcoRI/BamHI) | ||
| - | Product is pBca1256- | + | Product is pBca1256-K112500 |
-------------------------------------------- | -------------------------------------------- | ||
cc001 Forward Biobricking of {<HA>} | cc001 Forward Biobricking of {<HA>} | ||
| Line 16: | Line 16: | ||
</pre> | </pre> | ||
| - | == | + | ==K112501== |
<pre> | <pre> | ||
Construction of {<HA!} basic part K112502 | Construction of {<HA!} basic part K112502 | ||
| Line 22: | Line 22: | ||
Wobble PCR of cc001/cc003 ( 63 bp, EcoRI/BamHI) | Wobble PCR of cc001/cc003 ( 63 bp, EcoRI/BamHI) | ||
Sub into pBca1256 (EcoRI/BamHI) | Sub into pBca1256 (EcoRI/BamHI) | ||
| - | Product is pBca1256- | + | Product is pBca1256-K112501 |
-------------------------------------------- | -------------------------------------------- | ||
cc001 Forward Biobricking of {<HA>} | cc001 Forward Biobricking of {<HA>} | ||
| Line 31: | Line 31: | ||
</pre> | </pre> | ||
| - | == | + | ==K112502== |
<pre> | <pre> | ||
Construction of {<myc>} basic part K112503 | Construction of {<myc>} basic part K112503 | ||
| Line 37: | Line 37: | ||
Wobble PCR of cc004/cc005 ( 61 bp, EcoRI/BamHI) | Wobble PCR of cc004/cc005 ( 61 bp, EcoRI/BamHI) | ||
Sub into pBca1256 (EcoRI/BamHI) | Sub into pBca1256 (EcoRI/BamHI) | ||
| - | Product is pBca1256- | + | Product is pBca1256-K112502 |
-------------------------------------------- | -------------------------------------------- | ||
cc004 Forward Biobricking of {<myc>} | cc004 Forward Biobricking of {<myc>} | ||
| Line 45: | Line 45: | ||
</pre> | </pre> | ||
| - | == | + | ==K112503== |
<pre> | <pre> | ||
Construction of {<myc!} basic part K112503 | Construction of {<myc!} basic part K112503 | ||
| Line 51: | Line 51: | ||
Wobble PCR of cc004/cc006 ( 64 bp, EcoRI/BamHI) | Wobble PCR of cc004/cc006 ( 64 bp, EcoRI/BamHI) | ||
Sub into pBca1256 (EcoRI/BamHI) | Sub into pBca1256 (EcoRI/BamHI) | ||
| - | Product is pBca1256- | + | Product is pBca1256-K112503 |
-------------------------------------------- | -------------------------------------------- | ||
cc004 Forward Biobricking of {<myc>} | cc004 Forward Biobricking of {<myc>} | ||
Revision as of 18:46, 24 June 2008
Contents |
K112500
Construction of {<HA>} basic part K112501
Wobble PCR of cc001/cc002 ( 60 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI)
Product is pBca1256-K112500
--------------------------------------------
cc001 Forward Biobricking of {<HA>}
CgATAgaattcATGagatcttacccatacgacgtcccagac
cc002 Reverse biobricking of {<HA>}
ccagtggatccccagcgtagtctgggacgtcgtatggg
K112501
Construction of {<HA!} basic part K112502
Wobble PCR of cc001/cc003 ( 63 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI)
Product is pBca1256-K112501
--------------------------------------------
cc001 Forward Biobricking of {<HA>}
CgATAgaattcATGagatcttacccatacgacgtcccagac
cc003 Reverse biobricking of {<HA!}
ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag
K112502
Construction of {<myc>} basic part K112503
Wobble PCR of cc004/cc005 ( 61 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI)
Product is pBca1256-K112502
--------------------------------------------
cc004 Forward Biobricking of {<myc>}
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG
cc005 Reverse Biobricking of {<myc>}
ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG
K112503
Construction of {<myc!} basic part K112503
Wobble PCR of cc004/cc006 ( 64 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI)
Product is pBca1256-K112503
--------------------------------------------
cc004 Forward Biobricking of {<myc>}
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG
cc006 Reverse Biobricking of {<myc!}
ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC
