Template:Team:UC Berkeley/Notebook/DV construction
From 2008.igem.org
(Difference between revisions)
(→K112705) |
Dirkvandepol (Talk | contribs) m |
||
(8 intermediate revisions not shown) | |||
Line 5: | Line 5: | ||
Construction of [<Phns>] Basic Part K112701 | Construction of [<Phns>] Basic Part K112701 | ||
- | PCR dv001/dv006 on Phns from E. coli K12 MG1655 ( | + | PCR dv001/dv006 on Phns from E. coli K12 MG1655 (~342 bp, gp = A) |
PCR dv005/dv003 on Phns from E. coli K12 MG1655 (225 bp, gp = B) | PCR dv005/dv003 on Phns from E. coli K12 MG1655 (225 bp, gp = B) | ||
- | PCR dv004/dv002 on Phns from E. coli K12 MG1655 ( | + | PCR dv004/dv002 on Phns from E. coli K12 MG1655 (~149 bp, gp = C) |
--------------------------------------------------- | --------------------------------------------------- | ||
PCR dv001/dv003 on A+B (355 bp, gp = D) | PCR dv001/dv003 on A+B (355 bp, gp = D) | ||
Line 101: | Line 101: | ||
Construction of <PfhuA> basic part K112708 | Construction of <PfhuA> basic part K112708 | ||
- | PCR of dv019/dv020 on | + | PCR of dv019/dv020 on MG1655 (225bp, EcoRI/BamHI/DpnI) |
Sub into pBca1256 (EcoRI/BamHI, 2472+225, L) | Sub into pBca1256 (EcoRI/BamHI, 2472+225, L) | ||
Product is pBca1256-K112708 | Product is pBca1256-K112708 | ||
Line 133: | Line 133: | ||
Construction of <Bca1041> basic part K112710 | Construction of <Bca1041> basic part K112710 | ||
- | PCR of dv023/dv024 Bca1041 (122bp, EcoRI/BamHI/DpnI) | + | PCR of dv023/dv024 pSB1AG0-Bca1041 (122bp, EcoRI/BamHI/DpnI) |
Sub into pBca1256 (EcoRI/BamHI, 2472+122, L) | Sub into pBca1256 (EcoRI/BamHI, 2472+122, L) | ||
Product is pBca1256-K112710 | Product is pBca1256-K112710 | ||
Line 143: | Line 143: | ||
dv024 Reverse biobricking of Bca1041 | dv024 Reverse biobricking of Bca1041 | ||
cgttaGGATCCatttcttttgggtatagcgtcgtgg | cgttaGGATCCatttcttttgggtatagcgtcgtgg | ||
+ | |||
+ | </pre> | ||
+ | |||
+ | ==K112711== | ||
+ | <pre> | ||
+ | Construction of rbs.SpvR! basic part K112711 | ||
+ | |||
+ | PCR of rbs.SpvR! al0027 and al0028 (933bp, EcoRI, BamHI, DpnI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+933bp, L) | ||
+ | Product is pBca1256-K112711 | ||
+ | |||
+ | ------------------------------------------------ | ||
+ | al0027 Forward Biobricking of rbs.spvR! CCATAGAATTCatgAGATCTAAAAAAGGAGATATTATGGATTTCTTG | ||
+ | |||
+ | al0028 Reverse Biobricking of rbs.spvR! CGttaGGATCCaggtcagaaggtggactg | ||
+ | |||
+ | </pre> | ||
+ | |||
+ | ==K112703 again== | ||
+ | <pre> | ||
+ | Construction of His-tag> basic part K112703, 2nd attempt | ||
+ | |||
+ | EIPCR of His-tag> dv025 and ca1246R on pBca1256 (2704bp EcoRI/BamHI,) | ||
+ | Cyclize pBca1256-K112703 (EcoRI) | ||
+ | Product is pBca1256-K112703 | ||
+ | |||
+ | dv025 Forward Biobricking of His-tag> ctagtGAATTCatgGGATCCtaaCTCGAcgtgcagg | ||
+ | ca1246R Reverse EIPCR from mRFP to facilitate Biobricking of His-tag> GACCTTCACCTTCACCTTCG | ||
+ | |||
</pre> | </pre> |
Latest revision as of 21:57, 7 July 2008
Contents |
K112701
Construction of [<Phns>] Basic Part K112701 PCR dv001/dv006 on Phns from E. coli K12 MG1655 (~342 bp, gp = A) PCR dv005/dv003 on Phns from E. coli K12 MG1655 (225 bp, gp = B) PCR dv004/dv002 on Phns from E. coli K12 MG1655 (~149 bp, gp = C) --------------------------------------------------- PCR dv001/dv003 on A+B (355 bp, gp = D) --------------------------------------------------- PCR dv001/dv002 on C+D (697bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+697) Product is pBca1256-K112701 ----------------------------------------------- dv001 Forward Biobricking of [<Phns>] CgATAgaattcATGagatctGAAATATAGCTGTGCCATCAGCC dv002 Reverse Biobricking of [<Phns>] cagtcggatccGCACGAAGAGTACGGATG dv003 Removing the 2nd EcoRI site in [<Phns>] (R) GCCAGGAATGTAAGGgATTCAAAATTGTTC dv004 Removing the 2ND EcoRI site in [<Phns>] (F) GAACAATTTTGAATcCCTTACATTCCTGGC dv005 Removing the FIRST EcoRI site in [<Phns>] (F)CGCTTAATAGGGgATTCTCGTAAACAC dv006 Removing the FIRST EcoRI site in [<Phns>] (R)GTGTTTACGAGAATcCCCTATTAAGCG
K112703
Construction of His-Tag> basic part K112703 Mix dv009/dv010 (41bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+41, L) Product is pBca1256-K112703 ----------------------------------------------- dv009 Forward Biobricking of His-Tag> cgataGAATTCatgAGATCTatgCATCATCATCATCATCATGGATCCtaacg dv010 Reverse Biobricking of His-Tag> cgttaGGATCCATGATGATGATGATGATGcatAGATCTcatGAATTCtatgg
K112704
Construction of <S-tag! basic part K112704 Wobble PCR of dv011/dv012 (60 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112704 ---------------------------------------- dv011 Forward Biobricking of <S-Tag! cgataGAATTCatgAGATCTaaagaaaccgctgctgctaaattcgaacgcc dv012 Reverse Biobricking of <S-Tag! cgttaGGATCCttagctgtccatgtgctggcgttcgaatttagcagc
K112705
Construction of S-tag> basic part K112705 Wobble PCR dv013/dv014 (47 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+47, L) Product is pBca1256-K112705 ----------------------------------------------- dv013 Forward Biobricking of S-Tag> cgataGAATTCatgAGATCTatgaaagaaaccgctgctgctaaattcg dv014 Reverse Biobricking of S-Tag> cgttaGGATCCgctgtccatgtgctggcgttcgaatttagcagcagcgg
K112706
Construction of <Pspv2> basic part K112706 PCR of dv015/dv016 on pBca1037 (500bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 500, L) Product is pBca1256-K112706 ----------------------------------------------- dv015 Forward biobricking of <Pspv2> cgataGAATTCatgAGATCTccttatgcagcgtaagggccgcaac dv016 Reverse biobricking of <Pspv2> cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG
K112707
Construction of <Pspv> basic part K112707 PCR of dv017/dv016 on pBca1037 (499bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+499, L) Product is pBca1256-K112707 ----------------------------------------------- dv017 Forward biobricking of <Pspv> cgataGAATTCatgAGATCTaGATCCTGTGATGTTTGGCG dv016 Reverse biobricking of <Pspv> cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG
K112708
Construction of <PfhuA> basic part K112708 PCR of dv019/dv020 on MG1655 (225bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+225, L) Product is pBca1256-K112708 ----------------------------------------------- dv019 Forward biobricking of <PfhuA> cgataGAATTCatgAGATCTgctaagcgtgaaataccggatgg dv020 Reverse biobricking of <PfhuA> cgttaGGATCCactctgatgtaaagtgaatgataacg
K112709
Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt
K112710
Construction of <Bca1041> basic part K112710 PCR of dv023/dv024 pSB1AG0-Bca1041 (122bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+122, L) Product is pBca1256-K112710 ----------------------------------------------- dv023 Forward biobricking of Bca1041 cgataGAATTCatgAGATCTgCcggcttatcGgtcagtttc dv024 Reverse biobricking of Bca1041 cgttaGGATCCatttcttttgggtatagcgtcgtgg
K112711
Construction of rbs.SpvR! basic part K112711 PCR of rbs.SpvR! al0027 and al0028 (933bp, EcoRI, BamHI, DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+933bp, L) Product is pBca1256-K112711 ------------------------------------------------ al0027 Forward Biobricking of rbs.spvR! CCATAGAATTCatgAGATCTAAAAAAGGAGATATTATGGATTTCTTG al0028 Reverse Biobricking of rbs.spvR! CGttaGGATCCaggtcagaaggtggactg
K112703 again
Construction of His-tag> basic part K112703, 2nd attempt EIPCR of His-tag> dv025 and ca1246R on pBca1256 (2704bp EcoRI/BamHI,) Cyclize pBca1256-K112703 (EcoRI) Product is pBca1256-K112703 dv025 Forward Biobricking of His-tag> ctagtGAATTCatgGGATCCtaaCTCGAcgtgcagg ca1246R Reverse EIPCR from mRFP to facilitate Biobricking of His-tag> GACCTTCACCTTCACCTTCG