"

 

From 2008.igem.org

Contents 1 Objectives 2 Protocol 2.1 PCR mutagenesis of GFP 2.2 Extraction of Biobrick MCS 2.3 Subcloning of GFP fusion brick and pRL1383a Biobrick vector 2.3.1 Restriction digest 2.3.2 Ligated insert and vector 2.3.3 Transformed into DH5α 2.4 Verification of parts 2.4.1 Colony PCR 2.4.2 Sequencing 3 Results 3.1 Transformation into DH5α 3.2 Verification of transformants 3.3 Sequencing 4 Discussion

Objectives

• Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
• Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS

Protocol

PCR mutagenesis of GFP

• Combined:

• 0.5 μl BBa_E0040 plasmid
• 0.5 μl 10mM forward primer
• 0.5 μl 10mM reverse primer
• 3.5 μl nanopure water
• 5 μl Taq (we used EconoTaq Green Taq)

• Ran for 30 cycles of denaturing, annealing, extension

• Initial denature @ 94C for 2 min.
• Denature @ 94C for 30 sec.
• Anneal @ 55C for 30 sec.
• Extend @ 72C for 60 sec.
• Final extension @ 72C for 10 min.
• Held @ 4C inifinitly.

Primer	Sequence	Length	G/C content	Tm	Notes
GFP fusion foward	GCCGCTTCTAGAcgtaaaggag	22 bp	54.55%	60.2 C	PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
GFP fusion reverse	cgagtcagtgagcgaggaag	20 bp	60%	59.6 C	PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')

Extraction of Biobrick MCS

• Combined:

• 0.5 μl BBa_B0034 plasmid
• 0.5 μl 10mM forward primer
• 0.5 μl 10mM reverse primer
• 3.5 μl nanopure water
• 5 μl Taq (we used EconoTaq Green Taq)

• Ran for 30 cycles of denaturing, annealing, extension

• Initial denature @ 94C for 2 min.
• Denature @ 94C for 30 sec.
• Anneal @ 55C for 30 sec.
• Extend @ 72C for 90 sec.
• Final extension @ 72C for 10 min.
• Held @ 4C inifinitly.

Primer	Sequence	Length	G/C content	Tm	Notes
HindIII+VF2	cctAAGCTTtgccacctgacgtctaagaa	29 bp (20 bp)	48.3% (50.0%)	65.9 C (58.6 C)	Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
BamHI+VR	ccaGGATCCattaccgcctttgagtgagc	29 bp (20 bp)	55.2% (50.0%)	67.9 C (58.0 C)	Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.

Subcloning of GFP fusion brick and pRL1383a Biobrick vector

Restriction digest

• GFP fusion
• BBa_C0012
• BBa_B0034 derived MCS
• pRL1383a

Ligated insert and vector

• Ran 20 μl ligation reactions

• 7 μl BioBrick segment (~2.8 ng) + 0.5 μl pRL1383a vector (~0.95 ng)
• 7 μl GFP fusion (~7 ng) + 2 μl C0012 derived vector (~1.8 ng)

Transformed into DH5α

• Used 10 μl of ligation reaction to transform.
• Incubated 10 min. on ice after addition of DNA.
• Plated GFP fusion + vector on LB + amp₁₀₀
• Plated MCS + pRL1383a on LB + sp₁₀₀

Verification of parts

Colony PCR

Sequencing

• 5 μl of the PCR products were digested with 2 μl ExoSAP.
• Samples were sent to CORE Hawaii for sequencing.

• 12 μl sample with 3.2 pmol primer and 20ng/100bp concentration of PCR product

Results

Transformation into DH5α

Sixty colonies were observed for GFP fusion and there were too many colonies to count (>300) for the modified pRL1383a.

Verification of transformants

A colony PCR was conducted to verify the presence of the GFP fusion brick containing plasmid and the modified pRL1383a. PCR products observed on the gel were of the expected size.

Sequencing

Discussion

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Printable version
• Permanent link
• Privacy policy
• Disclaimers