"
Team:Hawaii/Project/Part A MaterialsMethodsResults
From 2008.igem.org
This expression vector will pull parts from the RSF1010 derived broad-host-range plasmid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the original DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.
The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, BBa_I51020. The mobility of this vector will be tested by first transforming into E. coli then conjugatively transferred to SynechocystisPCC6803, followed by the final test of cloning in genes and testing their expression in both E. coli and SynechocystisPCC6803.
Contents |
Step 1: Synthesis and PCR Amplification of Individual Parts
Synthesis and assembly of the oriT, the lac promoter and the RBS
- The origin of conjugative transfer will be synthetically constructed using the Overlapping Oligonucleotides method from the Silver Lab [1]. Parts were verified with sequencing.
RP4 Origin of Transfer Sequences for Oligonucleotide Extension
| name | oligonucleotide set | Notes |
|---|---|---|
| oriT1_ob._na.1 | ctagaggaataagggacagtgaagaaggaacacccgctcg | complement oriT4 |
| oriT2_ob._na.1 | cgggtgggcctacttcacctatcctgcccggctgacgccg | complement of oriT5 |
| oriT3_ob._na.1 | ttggatacaccaaggaaagtctacatactagtagcggccgctgca | complement of oriT6 |
| oriT4_ob._na.1 | GCGGCCGCTACTAGTAtgtagactttccttggtg | |
| oriT5_ob._na.1 | tatccaacggcgtcagccgggcaggataggtgaagtaggcc | |
| oriT6_ob._na.1 | cacccgcgagcgggtgttccttcttcactgtcccttattcCT |
Sequencing by the Greenwood Molecular Biology Facility returned the following results:
Promoter and RBS Sequences for Oligonucleotide Extension
| name | oligonucleotide set | Notes |
|---|---|---|
| B0034-RBS-BkIn_fb._sb.1 | CTAGA G aaagaggagaaa T ACTAGT A GCGGCCG CTGCA | De novo synthesis of BBa_B0034 as back insert, RBS 1.0 |
| B0034-RBS-BkIn_rb._sb.1 | GCGGCCGCTACTAGTAtttctcctctttCT | complement to B0034-RBS-BkIn_fb._sb.1 |
| I14032-PLac-FrIn_fb._sb.1 | AATTC GCGGCCGC T TCTAGA G tggtgcaaaacctttcgcggtatggcatgatagcgcc T A | De novo synthesis of BBa_I14032 as front insert |
| I14032-PLac-FrIn_rb._sb.1 | CTAGTAggcgctatcatgccataccgcgaaaggttttgcaccaCTCTAGAAGCGGCCGCG | complement to I14032-PLac-FrIn_fb._sb.1 |
The Promoter and RBS were ligated and used for further constructions. The sequence and order of the Promoter and RBS were verified later during sequencing of the aadA construct.
PCR amplification of the oriV, rep, and aadA from pRL1383a
Several regions of pRL1383a will be amplified with BioBrick based primers. These components will be used later in the construction of a pRL1383a BioBrick based vector. These parts include the aadA region from pRL1383a and from the BioBrick Registry, the origin of vegetative replication (oriV), and the replication proteins.
pRL1383a Genes w/ BioBrick Ends
| name | primer | Tm | Notes |
|---|---|---|---|
| aadA_fp._sb.1 | cctTTCTAGatgagggaagcggtgatcg | 59.4/65.7 C | isolates aadA from ATG to TAA-TAA |
| aadA_rp._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg | 55.4/74.5 | isolates aadA from ATG to TAA-TAA |
| pRL1383aOriV_fb._sb.1 | cctTTCTAGAGgaacccctgcaataactgtc | 56.3/65.9 | |
| pRL1383aOriV_rb._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac | 58/76.2 | |
| pRL1383aRep_fp._sp.1 | cctTTCTAGatgaagaacgacaggactttgc | 58.9/64.9 | Begins with RepB |
| pRL1383aRep_rb._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca | 62.2/78.5 | Ends RepC terminator.8/2:the terminator is missing the last C. |
- Each of these parts were ligated into pSB1A3 and transformed into DB3.1 cells. The resulting colonies were verified with PCR using VF2 and VR primers. Any positive results were then further verified with sequencing at the Greenwood facility.
Step 2: Construction of Plasmid
- The BioBricked parts were then assembled two at a time into pSB1A3. The ligation product was then transformed into DH5-a cells, and the colonies were verified using PCR. Positive PCR results were then sent in to the Greenwood facility for sequencing.
Order of Construction
- Ligation 1:
- The promoter/rbs construct was ligated to aadA--> promoter/rbs/aada
- The promoter/rbs construct was ligated to rep --> promoter/rbs/rep
- Ligation 2:
- promoter/rbs/aada was ligated to oriT --> promoter/rbs/aada/oriT
- promoter/rbs/rep was ligated to oriV --> promoter/rbs/rep/oriV
- Ligation 3:
- promoter/rbs/aada/oriT was ligated to promoter/rbs/rep/oriV --> promoter/rbs/aada/oriT/promoter/rbs/rep/oriV.
