Team:CityColSanFrancisco/Notebook/LabBooks/Colby
From 2008.igem.org
6/25
Lab book created. All future work done by me will be posted on this document.
Following yesterday's plating of S. oneidensis plates were observed to search for growth. No growth was detected. This is rather disturbing as oneidensis is supposed to be our fastest grower. What went wrong? Perhaps our media is bad or maybe our incubator is running too hot/cold.
We will test our media first. New media was made using same procedure as previous batch (the only difference being that 20g of agar was used instead of 15g). Plates were poured using this new batch. We will determine if our LB (from the previous batch) is defective by plating 1 plate from our previous LB, 1 from a plate borrowed from the Btech program, and 1 plate from our new batch of LB. Hopefully there will be some growth by tomorrow on at least one plate.
6/26
No growth in Shewanella plates, again. Thermometer reads 38C, a full 8 degrees hotter than our bacteria prefers. This may be responsible for our fledgling shewanella. Plates were moved to a new incubator, this one set at 29C. The plates will be left in there over the weekend, with Nicola checking on them.
6/29
Growth found in several Shewanella plates. Temperature seems to have been a factor. Growth was found in all but the Btech plate. A gram stain was preformed, to determine the identity of the bacterial strain. Results: a gram negative rod shaped microbe. Shewanella matches this, but we are still unsure if Shewanella is really there We will design a primer using a unique sequence, or a sequence of a unique length, known for Shewanella. This will determine our bacteria’s true identity.
One such primer possibility is O-succinylbenzoate synthase
ATGATCTTAACTTCACTTAGCTTGTATTTATATCGCCTGCCCTTAGACAGCTTTTTGCCTGTGGGCAAACAACGCATTGACCATAGAAAAGGCTTAGTGCTGCAAGCCAAGGCCACTGCT
GACGGTGAAGTTTGCGACACCGAAATATCCAATGCTGAAGTGACTGACAGTGAAGTCACTGAGGGTGAAGTGAAGGAGTCCCATGTTGAAATCGCGCCACTCTCAGGGTTCGATATCGAC
CAACAGCCATTATCCGGCTTTAGCCGCGAAAGCCTCGATGAAGTACAGCAAGCCTTAACAGTGTTATTACCCAAGCTGCAAAACCAATCTATTGATTGCTTGCTCGAGCAGGCCGAAGCG
AGTCCCTATCCATCCATTGCCTTTGGCTTAAGCCTATTGCATGCCAAACTCAGCGGAAAACTCGATGCGGTGCGCCCACTCACCACCGCTGTACCTTTAATTTATCAACCAACTGATGCG
CCTAAAGCTGAATTAATAGCAAAAATTGCCAGCCTCAAACCTAGTGTGCGCTCAGTTAAAGTGAAGGTTGCACAAACCTCCATGGAAGATGAGTTGAGTTTGATTTATGGCATCTTAAGC
CAAAGGCCCGATCTCAAGCTGCGCTTAGATGCCAATTGCGGATTTAGTCTAGAACAGGCCCTCGACTTTGCCGCCTGCTTGCCACTAGATAGCATTGAATACATTGAAGAACCTTGCCAA
CATCCGCAGGATAATCACACTCTGTATCGCGCCATTCCACTGCCCTACGCCTTAGATGAATCCCTCAATGATCCCGATTATCAATTTGTGATGCATGAGGGACTCACGGCGCTCATCATC
AAACCCATGCTACTGGGCAGTATCGAAAAACTTCAGCGCCTTATCGATGAAGCCCACAACCATGGCGTGCGCTGTATCTTAAGTTCCAGCCTTGAAAGCAGTTTAGGCATCAATGATTTG
GCCCATTTAGCCGCCATACTAACGCCCGATGAAATCCCCGGGCTTGATACCTTAACGGCCTTTAGTCAAGACTTATTAGTCCCATCGGGCAAACTACAATGTCTTACGCTTCAATGCCTG
ACACTGAATCAACTCGAACGAGTCGCCAGCACTGTACAGGATTGAT
Sequence (5'->3') Strand on template Length Start Stop Tm GC%
Forward primer GGTGAAGTGAAGGAGTCCCA Plus 20 184 203 60.09 55.00%
Reverse primer TCGAGTTTTCCGCTGAGTTT Minus 20 425 406 59.99 45.00%
Product length 242
Template 4769986 .................... 4769967
Product length: 242
Construction of the primer will continue tomorrow.
From S. oneidensis 6/25, streak one plate using (new) LB media, 1 (old) LB media, and inoculate liquid culture.
From P. aeruginosa 6/26, streak one plate using 1 (new) LB plate, 1 (old), inoculate liquid culture.
Fro mutant S. oneidensis freezer stock , steak on 1 LB plate (new) and 1 LB plate (old).
Inoculate palustris in liquid YP culture.
6/30
No growth was found on: S. oneidensis OMCB (new media), S. oneidensis MTRB (new media), S. oneidensis WT from freezer stock (old media), S. oneidensis WT from freezer stock (new media), S. oneidensis WT liquid culture, TIE 1 palustris liquid culture, TIE 1 palustris liquid culture.
There is suspected contamination in the S. oneidensis WT 5/21 plate (the plate all our later WT’s are streaked from). At least two cultures can be visualized. One has colonies of a white color that are small and slightly dispersed. The other culture is orange, clustered and faster growing.
Other S. oneidensis WT plates with an orange culture: S. oneidensis WT 6/25, Shewie freezer 1 MTRB 6/26.
Plates with white culture: MTRB S. oneidensis from freezer stock (old media) 6/29, 6/29 S. oneidensis OMCB (old media).
Liquid cultures inoculated today: 2 tubes of P. aeruginosa, 3 TIE 1 palustris.
New LB plates streaked: 1 from 5/21 culture of S. oneidensis WT, 1 from S. oneidensis WT (taken from fridge stock).
7/2
We will begin isolating P. aeruginosa DNA and TIE 1 palustris DNA.
Procedure for DNA purification from .5 mL Gram-Negative bacterial culture. Expected Yield: 10-35 ug DNA
Cell Lysis
1. Add 500 uL cell suspension (e.g. overnight culture containing .5-1.5 billion cells) to a 1.5 mL microfuge tube on ice.
2. Centrifuge at 13000-16000 x g for 5 seconds to pellet cells. Carefully remove as much supernatant as possible with a pipette.
3. Add 300 uL Cell Lysis Solution and pipette up and down until cells are suspended.
4. Incubate sample at 80 degrees for 5 minutes to lyse cells. Samples are stable in Cell Lysis Solution for at least 2 years at room temperature.
RNase Treatment
1. Add 1.5 uL RNase A solution to the cell lysate.
2. Mix the sample by inverting the tube 25 times and incubate at 37 degrees for 15-60 minutes
Protein Precipitation
1. Cool sample to room temperature by placing on ice for 1 minute.
2. Add 100 uL Protein Precipitation Solution to the cell lysate.
3. Vortex vigorously at high speed for 20 seconds to mix the Protein Precipitation Solution uniformly with the cell lysate. ,br>
4. Centrifuge at 13000-16000 x g for 3 minutes. The precipitated proteins will form a tight pellet. If the protein pellet is not tight, repeat step 3 followed by incubation on ice for 5 minutes, then repeat step 4.
DNA Precipitation
1. Pour the supernatant containing the DNA (leaving behind the precipitated protein pellet) into a clear 1.5 mL microfuge tube containing 30 uL 100% Isopropanol (2 propanol).
2. Mix the sample by inverting gently 50 times.
3. Centrifuge at 13000-16000 x g for 1 minute; the DNA should be visiable as a small white pellet.
4. Discard supernatant and drain tube on clean absorbent paper and allow to air dry 5-10 minutes
DNA Hydration
1. Add 50 uL DNA Hydration Solution (50 uL will give a DNA concentration of 500 mg/ml if the yield is 25ug).
2. Rehydrate DNA by incubation sample for 1 hour at 65 degrees and/or overnight at room temperature. Tap tube periodically to aid in dispersing the DNA.
3. Store DNA at 4 degrees. For long term storage, place sample at -20 degrees or -80 degrees.
OBS
1. Step 2 in Cell Lysis required a longer centrifuge time, 10 minutes was sufficient.
2. Due to time contraints, procedure was halted at the end of cell lysis. Samples will be stored at room temperature over the weekend and resume on Monday.
4 more TIE 1 palustris liquid cultures were inoculated.
7/6
DNA purification of TIE 1 palustris and P. aeruginosa continues.
OBS
Centrifuge does not perform as needed.
7/7
DNA purification procedure was repeated, this time using a sample of P. aeruginosa given to us by Dirk. Once again, we had trouble pelleting due to the slow speed of the centrifuge. DNA hydration solution will be left overnight. Fingers crossed…
PCR run on S. oneidensis
2nd test run on new machine (PCR) for Nicola lab manager with 2nd set PCR Run prepared by Bowen and Nick, test machine programmed by Angela Brock.
Program called Tß; 95 degrees for 4min, 92 degrees for 30 seconds, 50 degrees for 30seconds, 72 degrees for 1 minute, 28 times to step 2, 72 degrees for 5 minutes, 4 degrees for 24 hours (Do not see hold command) Machine “Programmable Thermal Controller” MG Research Inc. Serial # 1758
-Angela Brock
7/8
PCR Run for Pseudomonas…
1. Mastermix: Create two microfuge tubes with the following in each: 40.75 uL water, 1 uL 10mM dNTP, 5 uL 10x buffer 2*. Add .75 uL Expand Polymerase to each microfuge.
- Note: Dirk’s PCR Buffer was used instead.
7/9
Test genomic DNA of P. aeruginosa and TIE1 palustris through an electrophoreses gel.
Gel Run Results
• For Gel Run 1 TIE1 and λ DNA. Both showed bands (however, there is heavy smearage). P. aeurginosa did not show bands... the DNA has not been purifies, or something went wrong with our gels.
•For Gel Run 2: Neither TIE1 or P. aeruginosa showed bands. Something probably went wtrong with our PCR Reaction
7/10
The Genomic DNA purified for our gel run used the same purification procedure as previously written, however there was a slight deviation. Bacterial cells were boiled at 100C before being spun and had lysate solution added to it. The hope is that the additional step of boiling will allow more DNA to hydrate and show up in our Gel Runs...
Results: Success, P. aeurginosa can confirmed.
2 reactions using DMSO, Taq, 2 using Invitrogen Taq
7/14
Products of Nick's miniprep, TIE1 genomic DNA, and P. aeurginosa genomic DNA were all prepared for a diagnostic gel run for tomorrow. The dye + product of interst were all stored in the fridge along with the poured gel.
7/21
Plasmid Miniprep
•Spin 1.5 ml of bacteria. Pour off supernatant. Add 1 ml of bacteria. Spin again and pour off.
Note: 12/2006 protocol was used instead of 5/2004.
•Altogether, about 3 ml of plasmid culture was used.
Note: Step 7 from procedure (“Recommended: Wash the QIA prep spin column by addding .5ml Buffer PB and centrifuging for 30-60 seconds) was followed.
•Step 8 calls for addition of .75 ml Buffer PE. There were two options for Buffer PE- with ethanol and without ethanol. The Buffer PE with ethanol was used.
7/24
Gel Run #1
To load: λ DNA, plasmid digests, PCR Products, Suicide Plasmid. Gel was run at 100V for 1 hour.
Results
•Highly dissapointing as only the undigested suicide plasmid gave visable bands.
•Possible inadequate ethidium boromide staining could have caused this.
•It is strange that the digested pseudomonas DNA with X and Echo failed to produce bands as there were visible bands in the gel run from 7/21. This gel used the digested DNA from the same sample.
•None of the PCR products provided visible bands. This could have resulted from bad PCR technique, or improper amounts of sample loaded before the run.
7/27/09
CO2 and N2 tank have arrived.
8/26/09</u>
IGEM Restart
New Lab location: We have moved from Rm 30 to the green house on top of the science building.
9/04/09
PCR Run #1
Well 1, Oligo 1, 6
Well2 Oligo5, 7
9/10/09
OD readings for competent R. palustris from 9/4/09
@A600
1st Reading -.293 A<-2ml
2nd Reading -.4417 A<-4ml
3d Reading - .3295 A <-6-7ml
9/28/09
Sample taken from anaerobic palustris culture. 1ml was rumored and placed on 1 plate. Results will determine whether palstris is actually growing in anaerobic environment.
3 plates of S. oneidensis WT were streaked from freezer stocks.
"

