Team:Illinois/Antibody GPCR Fusion Notebook

From 2008.igem.org

Image:GPCRnotebookpic.png


Contents

Recipes

  • Tris-Cl, 1M
    • Dissolve 121g Tris base in 800ml H2O
    • Adjust to desired pH with concentrated HCl
    • Mix and add H2O to 1 liter
    • (Approximately, 20ml HCl for pH 7.4 and 42ml for pH 8.0)


  • EDTA, 0.5M (pH 8.0)
    • Dissolve 186.1g Na2 EDTA-2H2O in 700ml H20
    • Adjust pH to 8.0 with 10M NaOH(~50ml)
    • Add H2O to 1 liter


  • Breaking buffer - 100ml
    • 2ml Triton X-100
    • 1ml Sodium dodecyl sulfate (SDS)
    • 0.5844g NaCl (100mM)
    • 1ml 1M Tris-Cl pH 8.0 (10mM)
    • 200uL 0.5M EDTA (1mM)


Primers

PGK promoter Fwd:5'TTTT GAATTC AAAGATGCCGATTTGGGCGC Rev:5'TTTT GAGCTC GTTTTATATTTGTTGTAAAA

PGK terminator Fwd:5'TTAT GGGCCC GAAATAAATTGAATTGAATT Rev:5'TTTTG AAGCTT CAGCTTTAACGAACGCAGA

Ste2 Fwd:5'GCCC TCTAGA ATGTCTGATGCGGCTCCTTC Rev:5'TTAT GGGCCC TCATAAATTATTATTATCTT

Fus1 upstream Fwd:5'GTGG GAATTC TAATAATCAGAACTCCAACA Rev:5'GGCG TCTAGA TTTGATTTTCAGAAACTTGA

Fus1 downstream: Fwd:5'GCGA GGTACC TGAAAATAATATTGACGTTC Rev:5'TTAT GCGGCCGC TATTCACCAGACCCGCTCCT

22nd July

  • Yeast obtained from Dr. Zhao
    • W303a S. Cerevisiae

24th July

  • Prepared liquid culture for DNA extraction
  • Made 1M Tris. Cl pH 8.0
  • Made 4M ammonium acetate


22nd August

  • Attempted DNA extraction of W303a genomic DNA
    • Protocol from Wiley's Current Protocols in Molecular Biology
    • Result: Failed to finish protocol
  • Obtained more yeast from Dr. Zhao
    • W303a S. cerevisiae

25th August

  • Prepared overnight culture for DNA extraction (3:27pm)


26th August

  • Attempted DNA extraction
  • Prepped overnight culture


27th August

  • Performed PCR: PGK Terminator
Buffer G 12.5uL x4 50uL
Forward Primer 0.5uL x4 2uL
Reverse Primer 0.5uL x4 2uL
H2O 10.8uL x4 43.2uL
Taq 0.2uL x4 0.8uL
template 0.5ul
Negative control 3 H2O


  • PCR program:
    • 4 min 94 degrees
    • 25-30x 30s 94 degrees
    • 30s Tm primers
    • 1 min/KB 72 degrees
    • 7 min 72 degrees
  • For the gel: 5uL loading dye gel is in cold room
  • Prepped 3 overnight cultures

28th August

  • Extracted DNA from 4 cultures
  • Ran gel of PCR products (1.5% agarose, 200V)
    • Result: No bands present

2nd September

  • PCR: PGK Terminator
5 PRIME Mastermix 10uL x3 30uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 10uL x3 30uL
H2O 10.8uL x4 43.2uL
Negative control 25uL H2O

3rd September

  • Ran gel
    • Ladder lane 7
    • Sample 7 spilled
    • 1% agarose
    • 120V
      • Too low
    • 50 minutes
  • Poor results--no bands present

8th September

  • PCR: PGK Terminator
5PRIME Mastermix 10uL x3 30uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 14uL x3 42uL
  • Prepped 4 overnight cultures
    • Yeast dried out again

9th September

  • Signs of life in 3 of the cultures
    • Wait until tomorrow
  • Ran gel on PCR from 8th September--no bands present
    • 150V, 50 minutes
    • No sign of DNA
  • Ladder from Courtney

10th September

  • Split culture
  • Ran gel from 8th September again--no bands present
    • 150V, 50 minutes
    • 0.75% gel
    • Ladder from Courtney

11th September

  • PCR: PGK Terminator
5 PRIME Mastermix 10uL x3 30uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 14uL x3 42uL

12th September

  • Isolated genomic DNA from 8 cultures of W303a yeast cells
    • Protocol from Wiley's Current Protocols in Molecular Biology
    • Labeled templates 1,2,3,4 and 1a,2a,3a,4a


  • Ran gel of PCR from 11th September
    • 1% agarose
    • 150V
    • 38 mins
      • Poor results

15th September

  • PCR PGK Promotor
    • Finnzymes Phusion High Fidelity DNA Polymerase
      • F-530, 20V (2V/uL)
5x Phusion HF Buffer 10uL x3 30uL
10mM dNTPs 1uL x3 3uL
Primer A(Forward) 1uL x3 3uL
Primer B(Reverse) 1uL x3 3uL
Template 1 10uL x3 30uL
Phusions DNA polymerase 0.5uL x3 1.5uL
H2O 26.5uL x3 79.5uL

18th September

  • Ran reaction mentioned on 15th September
  • Extracted DNA from gel from 8th September (PGK Terminator)
Tube Gel(g)
1 0.332
2 0.278
3 0.307
4 0.349
5 0.385

19th September

  • Gel of PGK Promotor from 15th September has no DNA present

23rd September

  • PCR: Fus1 Downstream
  • EPICENTRE Bioetechnologies - MasterAmp(TM) Taq DNA Polymerase
  • Per 50uL of reaction,
MasterAmp Taq 10x PCR Buffer 5uL
1mM dNTPs 1uL
Primer 1 0.5uL
Primer 2 0.5uL
25mM MgCl2 2uL
Taq DNA Polymerase 0.25uL
Template 2 20uL
Water 20.75uL
  • PCR Settings:
    • 4mins, 94 degree celcius
    • 30s, 94 degree celcius
    • 30s, 5 degrees below primer melting temperature
    • 1 min, 72 degree celcius -- to step 2 -- 30x
    • 7 min, 72 degree celcius

24th September

  • Ran gel of Fus1 Downstream from 23rd September
    • Result: No DNA present on gel

25th September

  • PCR: Fus1 Upstream
Mastermix 8.25uL x3 24.75uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 3 20uL x3 60uL
Water 20.75uL x3 62.25uL
    • same protocol as 23rd September
    • The master mix contains the buffer, dNTPs, MgCl, and Taq
    • Template 3 (3 reactions run)

30th September

  • PCR: Fus1 Upstream
Mastermix 8.25uL x3 24.75uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 3 20uL x3 60uL
Water 20.75uL x3 62.25uL
    • same protocol as 23rd September
    • Template 4 and 1a (3 reactions each)
    • Gel: 1% agarose, 150V, 35 minutes -> poor results
    • lanes 2,3 -> faint smear

1st October

  • PCR: Ste2
Mastermix 8.25uL x3 24.75uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 3 20uL x3 60uL
Water 20.75uL x3 62.25uL
    • same protocol as 23rd September
    • Templates 2a, 3a, 4a used (3 reactions each)

3rd October

  • Ran Ste2 gel from 1st October

8th October

  • PCR: PGK Terminator
PCR Buffer 5uL
10mM dNTPs 1uL
Forward Primer 1uL
Reverse Primer 1uL
MgCl2 5uL
Taq DNA Polymerase 0.25uL
Template 25uL
Water 11.75uL
    • same protocol as 23rd September
    • Use DNA extracted from gel on 18th September (5 reactions)
  • Also extracted DNA from gel from 30th September (Fus1 Upstream)

9th October

  • PCR: Ste2
    • Protocol is the same as 23rd September
    • Template used is product from 1st October (9 reactions total)
  • PCR: Fus1 Upstream
    • Protocal matches 23rd September
    • Template used was DNA extracted from the gel from the 8th October, which came from the PCR run on 30th September (5 reactions total)


  • Ran Ste2 gel from today

  • Ran PGK terminator gel from yesterday

12th October

  • PCR: Fus1 (3 reactions each)
    • Template is products from 9th October

13th October

  • Ran gel of PCR with Fus1
  • Used 25uL or product, 5uL of loading dye

14th October

  • Fus1 PCR
MasterAmp Taq 10x PCR Buffer 5uL
1mM dNTPs 1uL
Primer 1 0.5uL
Primer 2 0.5uL
25mM MgCl2 5uL
Taq DNA Polymerase 0.25uL
Template 25uL
Water 11.75uL
  • Template is reaction from 12th October

15th October

  • PCR PGK Terminator
5 PRIME MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 25uL
Water 4uL
  • Ran gel of Ste2 from 10/14

  • Ran gel of Fus1 upstream from 10/14 (no ladder, oops)

16th October

  • PCR: Fus1 Downstream, PGK Promoter
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • Tube 1: Template 4 - Fus1
    • Tube 2: Template 4a - Fus1
    • Tube 3: Template 4 - PGK Promoter
    • Tube 4: Template 4a - PGK Promoter
  • ran Gel of above

  • ran Gel of PGK terminator from 10/15


  • Extracted Ste2 from 10/15 and re-amplified:
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL

17th October

  • Ran gel of Ste2 from 10/16
    • Tube 1 - lane 2,3
    • Tube 2 - lane 5,6

  • PCR: Fus1 upstream
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • template is products from 10/14
  • PCR: PGK Terminator
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • Template is products from 10/15
  • Extracted Ste2(Gel from today)

18th October

Ran gel of Fus1 upstream and PGK terminator from yesterday

20th October

  • Extracting chromosomal DNA from yeast cells
    • W303A - Yellow
    • YPD DL
    • YHP1 YPD HD - One is orange (YHP1)(Cap was removed in incubator), Other is Yellow
    • Orange - YHP1 YPD HD
    • Green - YHP2 YPD HD
    • Pink - W303A YPA DL
    • Yellow - WD303A YPD DL

21st October

  • PCR: Ste2
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
  • 2 tubes
  • Block B of black machine
  • Annealing temperature: 31 degrees celcius
  • Ran gel on Ste2 from today

22nd October

  • New primers for biobricks are here
    • Brought to standard concentration, 30uM
    • Added 33.3uL of water per nmol primer
  • PCR: Fus1 and PGK Terminator
MasterMix 20uL
Primer Fwd 0.75uL
Primer Rev 0.75uL
Template 25uL
Water 3.5uL
    • Forward and Reverse primers are new biobrick primers that arrived today
    • Template is PCR product from 17th October
    • A,B,C -> Fus1 Upstream -> 1,2,3
    • 1,2 -> PGK Terminator -> 4,5
    • Annealing temperature: 38 degrees celcius
    • In freezer in yellow case
  • PCR: Ste2
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 25uL
Water 4uL
    • Forward primer, Reverse Primer are new primers that arrived today
    • Template is PCR product from 21st October
    • Two tubes in block B
  • The 3 gels in the cold room do not have EtBr

23rd October

  • Ran gel of Fus1 Upstream, PGK Terminator, Ste2 from yesterday
    • 1% Agarose

  • PCR: Fus1 Downstream, PGK Promoter
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • 4 reactions each of Fus1 Upstream(1,2,3,4) and PGK Promoter(A,B,C,D)
  • Gel shows no bands.


  • PCR: Fus1 Downstream, Fus1 Upstream, PGK Promoter, PGK Terminator, Ste2
    • Template genomic DNA from 20th October (x4 different reactions)
    • Used all Template
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
  • Gel shows no bands

24th October

  • Ran gel of Fus1 upstream(lanes 3,4,5), PGK terminator(lanes6,7), and Ste2(lanes 8,9) from 10/22
    • ladder is lane 2; 1 and 10 are nothing

  • PCR of Fus1 downstream, Fus1 upstream, PGK promoter, PGK terminator, Ste2
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 29uL
    • The templates were the rest of the genomic DNA extracts from 9/12
    • Three reactions of each gene were run
  • Gel from above:

  • (on left)Fus1 downstream lanes 2,3,4; Fus1 upstream lanes 5,6,7; PGK promoter lanes 8,9,10;
  • (on right)PGK terminator lanes2,3,10; Ste2 lanes 4,5,6; Fus1 downstream lanes 7,8,9;

25th October

  • Extracted DNA from the gel from 10/24
    • FUS1 upstream from the higher bands of lanes 3 and 4
    • PGK terminator from the lower bands of lanes 6 and 7
  • DNA ligation
DNA 5uL
buffer 5uL
Re1 (Pst1) 1uL
Re2 (EcoR1) 1uL
Water 37.5uL

26th October

  • Incubate for 20mins at 80 degrees celcius
Ligation Buffer 4uL
DNA Ligase 1uL
DNA 3uL
Plasmid 9uL
Water 3uL
  • Let sit for 5 min.
  • 5uL of above mixture to competent cells
    • 30 min. on ice
  • Heat shock 30s (42 degrees)
  • Add SOC Media (200uL)
    • Incubate 60 min.(37 degrees)
  • Plate 200uL
    • Incubate 37 degrees celcius overnight

27th October

The transformation failed; try again with the same protocol:

  • Using extracts 3 and 7 (+Ligation buffers, Ligase, Plasmid, and Water)
  • Failed again.