User contributions
From 2008.igem.org
(Latest | Earliest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 02:53, 29 October 2008 (diff | hist) Team:The University of Alberta/26 October 2008 (→Jason)
- 02:53, 29 October 2008 (diff | hist) N Team:The University of Alberta/25 October 2008 (New page: ==David== today winnie and me poured some Kan plates. i transformed the ligations i had set up from yesterday (pSB103+laqIQ-ERE-TetR-pTET-RFP, pSB103+pTET-BisdA-pTET-BisdB, pUC57-laqIQ-ER...)
- 02:51, 29 October 2008 (diff | hist) N Team:The University of Alberta/26 October 2008 (New page: ==Jason== I performed a mini-prep of pUC57-ER, subsequently digesting it with XbaI and PstI, gel purifying the fragment and using it one of the following ligations. I set up ligations fo...)
- 02:46, 29 October 2008 (diff | hist) N Team:The University of Alberta/27 October 2008 (New page: ==David== today i transformed ligations of pSB103+ER, pSB103+laqIQ-ERE-TetR-pTET-RFP, pSB103+pTET-BisdA-pTET-BisdB, pUC57-laqIQ-ERE-TetR-pTET-RFP+pTET-BisdA-pTET-BisdB. i also started per...)
- 02:42, 29 October 2008 (diff | hist) N Team:The University of Alberta/28 October 2008 (New page: ==David== today i did a pcr check of candidate colonies for pSB103-ER, pSB103-laqIQ-ERE-TetR-pTET-RFP, pSB103-pTET-BisdA-pTET-BisdB, pUC57-laqIQ-ERE-TetR-pTET-RFP-pTET-BisdA-pTET-BisdB. ...)
- 01:38, 23 July 2008 (diff | hist) Team:The University of Alberta/22 July 2008 (top)
- 23:59, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008 (→David's Crusade) (top)
- 23:51, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008
- 16:45, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:10, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:09, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:08, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:07, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta
- 16:06, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 16:06, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 17:07, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (Removing all content from page)
- 17:06, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008
- 17:05, 12 June 2008 (diff | hist) N Team:The University of Alberta/12 June 2008 (New page: Prefix/suffix ''TetR Binding Site/Promoter'' '''GENE and HIS tag and Double Stop''' BisdA gaattcgcggccgcttctagag''tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac'''''atgcctcatatc...)
- 01:22, 11 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008 (→Not so Strange Things) (top)
- 18:29, 2 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 18:29, 2 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 17:24, 30 May 2008 (diff | hist) David Lee Lancaster (top)
- 17:15, 30 May 2008 (diff | hist) David Lee Lancaster (→The Life and Times of David Lancaster)
- 16:41, 30 May 2008 (diff | hist) N David Lee Lancaster (New page: == The Life and Times of David Lancaster == David was born in Calgary, Alberta, Canada to some really awesome parents. Seriously. The best.)
- 15:14, 30 May 2008 (diff | hist) N File:Profile pic 1.jpg (top)
- 15:14, 30 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
(Latest | Earliest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)