Team:Freiburg/Parts
From 2008.igem.org
m |
|||
Line 4: | Line 4: | ||
<font face="Arial Rounded MT Bold" style="color:#010369">_parts</font></div> | <font face="Arial Rounded MT Bold" style="color:#010369">_parts</font></div> | ||
<br><br> | <br><br> | ||
+ | You can find detailed description of our parts at the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=Freiburg registry]. | ||
==basic parts== | ==basic parts== | ||
+ | |||
+ | *'''Signal peptide''' | ||
+ | |||
+ | Part Name: | ||
+ | Bba_K157001 | ||
+ | |||
+ | '''Description:''' | ||
+ | This sequence mediates transportation of the protein to a translocational pore by an RNA–multiprotein complex, the signal recognition particle (SRP) when fused to the n-terminus of a fusion protein with a transmembrane region[1]. | ||
+ | There, after a pause of translation, the signal sequence is released and translation and translocation of the nascent chain are restarted[2]. | ||
+ | |||
+ | '''Source:''' | ||
+ | Human EGFR (ErbB-1) signal sequence; originally mediating membrane integration of the EGF-receptor (ErbB-1). Sequence taken from UniProtKB/Swiss-Prot entry P00533. | ||
+ | Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. | ||
+ | |||
+ | '''References:''' | ||
+ | [1] Walter P, Johnson AE: “Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane.” Annu Rev Cell Biol 1994, 10:87-119<br> | ||
+ | [2] Robert M Stroud, Peter Walter: “Signal sequence recognition and protein targeting”, Current Opinion in Structural Biology 1999, 9:754–759 | ||
+ | |||
+ | '''AA sequence:''' | ||
+ | MRPSGTAGAALLALLAALCPASRA | ||
+ | |||
+ | '''DNA-Sequence:''' | ||
+ | ATGGCCGGCATGAGACCATCTGGTACTGCTGGAGCCGCATTGCTGGCACTTTTGGCTGCGCTGTGCCCTGCAAGCAGAGCAACCGGTTAA | ||
+ | |||
+ | *'''Erbb1-transmembrane region''' | ||
+ | '''Part Name:''' | ||
+ | Bba_K157002 | ||
+ | |||
+ | '''Description:''' | ||
+ | Helical, single-span transmembrane region of the human EGF-Receptor type ErbB-1, sequence taken from UniProtKB/Swiss-Prot entry P00533. | ||
+ | |||
+ | '''source:''' | ||
+ | Transmembrane region of the human EGF-Receptor type ErbB-1. Sequence taken from UniProtKB/Swiss-Prot entry P00533. | ||
+ | Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. | ||
+ | |||
+ | '''AA sequence:''' | ||
+ | IATGMVGALLLLLVVALGIGLFM | ||
+ | |||
+ | '''DNA-Sequence:''' | ||
+ | ATGGCCGGCATAGCTACCGGAATGGTGGGTGCACTTTTGCTCCTTTTGGTCGTTGCCCTGGGGATAGGACTCTTTATGACCGGTTAA | ||
+ | |||
==composite parts== | ==composite parts== | ||
}} | }} |
Revision as of 01:23, 27 October 2008
Parts |
_parts
basic parts
Part Name: Bba_K157001 Description: This sequence mediates transportation of the protein to a translocational pore by an RNA–multiprotein complex, the signal recognition particle (SRP) when fused to the n-terminus of a fusion protein with a transmembrane region[1]. There, after a pause of translation, the signal sequence is released and translation and translocation of the nascent chain are restarted[2]. Source: Human EGFR (ErbB-1) signal sequence; originally mediating membrane integration of the EGF-receptor (ErbB-1). Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. References:
[1] Walter P, Johnson AE: “Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane.” Annu Rev Cell Biol 1994, 10:87-119 AA sequence: MRPSGTAGAALLALLAALCPASRA DNA-Sequence: ATGGCCGGCATGAGACCATCTGGTACTGCTGGAGCCGCATTGCTGGCACTTTTGGCTGCGCTGTGCCCTGCAAGCAGAGCAACCGGTTAA
Part Name: Bba_K157002 Description: Helical, single-span transmembrane region of the human EGF-Receptor type ErbB-1, sequence taken from UniProtKB/Swiss-Prot entry P00533. source: Transmembrane region of the human EGF-Receptor type ErbB-1. Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. AA sequence: IATGMVGALLLLLVVALGIGLFM DNA-Sequence: ATGGCCGGCATAGCTACCGGAATGGTGGGTGCACTTTTGCTCCTTTTGGTCGTTGCCCTGGGGATAGGACTCTTTATGACCGGTTAA composite parts |