Team:Freiburg/Parts

From 2008.igem.org

(Difference between revisions)

Revision as of 01:42, 27 October 2008

Parts

_parts

All of our parts feature our expanded Pre- and Suffix for in frame cloning of fusion proteins [http://parts.mit.edu/igem07/index.php/Freiburg07/report_fusion_parts (more)]. A complete, detailed list of all parts submitted to the registry in this year´s project can be found [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=Freiburg here], as well as the respective DNA-Sequences.

basic parts

Signal peptide

Part Name:
Bba_K157001

Description:
This sequence mediates transportation of the protein to a translocational pore by an RNA–multiprotein complex, the signal recognition particle (SRP) when fused to the n-terminus of a fusion protein with a transmembrane region[1]. There, after a pause of translation, the signal sequence is released and translation and translocation of the nascent chain are restarted[2].

Source:
Human EGFR (ErbB-1) signal sequence; originally mediating membrane integration of the EGF-receptor (ErbB-1). Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008.

References:
[1] Walter P, Johnson AE: “Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane.” Annu Rev Cell Biol 1994, 10:87-119
[2] Robert M Stroud, Peter Walter: “Signal sequence recognition and protein targeting”, Current Opinion in Structural Biology 1999, 9:754–759

AA sequence:
MRPSGTAGAALLALLAALCPASRA

DNA-Sequence:
ATGGCCGGCATGAGACCATCTGGTACTGCTGGAGCCGCATTGCTGGCACTTTTGGCTGCGCTGTGCCCTGCAAGCAGAGCAACCGGTTAA

Erbb1-transmembrane region

Part Name:
Bba_K157002

Description:
Helical, single-span transmembrane region of the human EGF-Receptor type ErbB-1, sequence taken from UniProtKB/Swiss-Prot entry P00533.

source:
Transmembrane region of the human EGF-Receptor type ErbB-1. Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008.

AA sequence:
IATGMVGALLLLLVVALGIGLFM

DNA-Sequence:
ATGGCCGGCATAGCTACCGGAATGGTGGGTGCACTTTTGCTCCTTTTGGTCGTTGCCCTGGGGATAGGACTCTTTATGACCGGTTAA

Sc-Fv anti NIP

Part Name:
Bba_K157003

Description:
Singlechain Fv.Fragment of the Anti-Nitro-Iodo-Phenol-antibody B1-8. Binds the hapten NIP (Nitro-Iodo-Phenole) with an affinity of 2.0 uM[1,2]. Designed for fusion to proteins or peptides via in frame cloning.

source:
Gene synthesis by GeneArt, optimized for expression in homo sapiens.

References:
[1]Ana Cumano and Klaus Rajewski: “Clonal recruitment and somatic mutation in the generation of immunological memory to the hapten NP”, The EMBO Journal vol. 5 no.10 pp. 2459-2468, 1986
[2]D. Allen, T. Simon, F. Sablitzky, K. Rajewski and A. Cumano: “Antibody engineering for the analysis of affinity maturation of an anti-hapten response”, The EMBO Journal vol. 7 no.7 pp. 1995-2001, 1988

@@ Line 4: / Line 4: @@
 <font face="Arial Rounded MT Bold" style="color:#010369">_parts</font></div>
 <br><br>
-You can find detailed description of our parts at the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=Freiburg registry].
+All of our parts feature our expanded Pre- and Suffix for in frame cloning of fusion proteins [http://parts.mit.edu/igem07/index.php/Freiburg07/report_fusion_parts (more)]. A complete, detailed list of all parts submitted to the registry in this year´s project can be found [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=Freiburg here], as well as the respective DNA-Sequences.
 ==basic parts==
 *'''Signal peptide'''
-Part Name:
+'''Part Name:'''<br>
 Bba_K157001
-'''Description:'''
+'''Description:'''<br>
 This sequence mediates transportation of the protein to a translocational pore by an RNA–multiprotein complex, the signal recognition particle (SRP) when fused to the n-terminus of a fusion protein with a transmembrane region[1].
 There, after a pause of translation, the signal sequence is released and translation and translocation of the nascent chain are restarted[2].
-'''Source:'''
+'''Source:'''<br>
 Human EGFR (ErbB-1) signal sequence; originally mediating membrane integration of the EGF-receptor (ErbB-1).  Sequence taken from UniProtKB/Swiss-Prot entry P00533.
 Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008.
-'''References:'''
+'''References:'''<br>
 [1] Walter P, Johnson AE: “Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane.” Annu Rev Cell Biol 1994, 10:87-119<br>
 [2] Robert M Stroud, Peter Walter: “Signal sequence recognition and protein targeting”, Current Opinion in Structural Biology 1999, 9:754–759
-'''AA sequence:'''
+'''AA sequence:'''<br>
 MRPSGTAGAALLALLAALCPASRA
-'''DNA-Sequence:'''
+'''DNA-Sequence:'''<br>
 ATGGCCGGCATGAGACCATCTGGTACTGCTGGAGCCGCATTGCTGGCACTTTTGGCTGCGCTGTGCCCTGCAAGCAGAGCAACCGGTTAA
+<br><br>
 *'''Erbb1-transmembrane region'''
-'''Part Name:'''
+'''Part Name:'''<br>
 Bba_K157002
-'''Description:'''
+'''Description:'''<br>
 Helical, single-span transmembrane region of the human EGF-Receptor type ErbB-1, sequence taken from UniProtKB/Swiss-Prot entry P00533.
-'''source:'''
+'''source:'''<br>
 Transmembrane region of the human EGF-Receptor type ErbB-1.  Sequence taken from UniProtKB/Swiss-Prot entry P00533.
 Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008.
-'''AA sequence:'''
+'''AA sequence:'''<br>
- IATGMVGALLLLLVVALGIGLFM
+IATGMVGALLLLLVVALGIGLFM
-'''DNA-Sequence:'''
+'''DNA-Sequence:'''<br>
 ATGGCCGGCATAGCTACCGGAATGGTGGGTGCACTTTTGCTCCTTTTGGTCGTTGCCCTGGGGATAGGACTCTTTATGACCGGTTAA
+<br><br>
+*'''Sc-Fv anti NIP'''
+'''Part Name:'''<br>
+Bba_K157003
+'''Description:'''<br>
+Singlechain Fv.Fragment of the Anti-Nitro-Iodo-Phenol-antibody B1-8. Binds the hapten NIP (Nitro-Iodo-Phenole) with an affinity of 2.0 uM[1,2]. Designed for fusion to proteins or peptides via in frame cloning.
+'''source:'''<br>
+Gene synthesis by GeneArt, optimized for expression in homo sapiens.
+'''References:'''<br>
+[1]Ana Cumano and Klaus Rajewski: “Clonal recruitment and somatic mutation in the generation of immunological memory to the hapten NP”, The EMBO Journal vol. 5 no.10 pp. 2459-2468, 1986<br>
+[2]D. Allen, T. Simon, F. Sablitzky, K. Rajewski and A. Cumano: “Antibody engineering for the analysis of affinity maturation of an anti-hapten response”, The EMBO Journal vol. 7 no.7 pp. 1995-2001, 1988
 ==composite parts==
 }}