Team:Freiburg/Parts
From 2008.igem.org
Parts |
_parts
basic parts
Part Name: Bba_K157001 Description: This sequence mediates transportation of the protein to a translocational pore by an RNA–multiprotein complex, the signal recognition particle (SRP) when fused to the n-terminus of a fusion protein with a transmembrane region[1]. There, after a pause of translation, the signal sequence is released and translation and translocation of the nascent chain are restarted[2]. Source: Human EGFR (ErbB-1) signal sequence; originally mediating membrane integration of the EGF-receptor (ErbB-1). Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. References:
[1] Walter P, Johnson AE: “Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane.” Annu Rev Cell Biol 1994, 10:87-119 AA sequence: MRPSGTAGAALLALLAALCPASRA DNA-Sequence: ATGGCCGGCATGAGACCATCTGGTACTGCTGGAGCCGCATTGCTGGCACTTTTGGCTGCGCTGTGCCCTGCAAGCAGAGCAACCGGTTAA
Part Name: Bba_K157002 Description: Helical, single-span transmembrane region of the human EGF-Receptor type ErbB-1, sequence taken from UniProtKB/Swiss-Prot entry P00533. source: Transmembrane region of the human EGF-Receptor type ErbB-1. Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. AA sequence: IATGMVGALLLLLVVALGIGLFM DNA-Sequence: ATGGCCGGCATAGCTACCGGAATGGTGGGTGCACTTTTGCTCCTTTTGGTCGTTGCCCTGGGGATAGGACTCTTTATGACCGGTTAA composite parts |