Team:Hawaii/Project

From 2008.igem.org

(Difference between revisions)
(Part B: Expression system for Synechocystis sp. PCC 6803)
(Implications and future plans)
 
(44 intermediate revisions not shown)
Line 4: Line 4:
===A BioBrick toolkit for cyanobacteria===
===A BioBrick toolkit for cyanobacteria===
-
We aim to extend the current BioBrick registry to a greater range of organisms, including cyanobacteria. Cyanobacteria are studied for their ability to produce useful compounds, including biofuels and biopolymers. These "little green factories" require only salts, light, water, and carbon dioxide for photoautotrophic growth. A cyanobacterial "toolkit" would enhance our ability to utilize this system.  
+
:We aim to extend the current BioBrick registry to a greater range of organisms, including cyanobacteria. Cyanobacteria are studied for their ability to produce useful compounds, including biofuels and biopolymers. These "little green factories" require only salts, light, water, and carbon dioxide for photoautotrophic growth. A cyanobacterial "toolkit" would enhance our ability to utilize this system.  
-
:We designed:  
+
::We designed:  
-
::1) mobilizable broad-host range BioBrick vectors derived from RSF1010, <br>
+
:::1) mobilizable broad-host range BioBrick vectors derived from RSF1010, <br>
-
::2) a cassette for protein secretion from ''Synechocystis'' sp. PCC 6803, and <br>
+
:::2) a cassette for protein secretion from ''Synechocystis'' sp. PCC 6803, and <br>
-
::3) a nitrate-inducible cyanobacterial promoter BioBrick.  
+
:::3) a nitrate-inducible cyanobacterial promoter BioBrick.  
-
Our toolkit was designed for conjugative gene transfer from ''Escherichia coli'' to ''Synechocystis'' to achieve the controlled production and recovery or bioproducts, demonstrable by induced secretion of green fluorescent protein. Though our parts were targeted for work in cyanobacteria, they may be compatible with other Gram-negative systems including ''Agrobacterium'', which is capable of plant transformation.
+
:Our toolkit was designed for conjugative gene transfer from ''Escherichia coli'' to ''Synechocystis'' to achieve the controlled production and recovery of bioproducts, demonstrable by induced secretion of green fluorescent protein. Though our parts were targeted for work in cyanobacteria, they may be compatible with other Gram-negative systems including ''Agrobacterium'', which is capable of plant transformation.
== Project Details==
== Project Details==
===<onlyinclude>[[Team:Hawaii/Project/Part A|Part A]]: Mobilizable Broad-Host-Range Plasmid </onlyinclude>===
===<onlyinclude>[[Team:Hawaii/Project/Part A|Part A]]: Mobilizable Broad-Host-Range Plasmid </onlyinclude>===
-
:RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (oriT) and rep genes with an associated origin of vegetative replication (oriV), respectively.  We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks.  The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. [[Team:Hawaii/Project/Part A|(''read more...'')]]
+
:RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (''oriT'') and rep genes with an associated origin of vegetative replication (''oriV''), respectively.  We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks.  The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. [[Team:Hawaii/Project/Part A|(''read more...'')]]
-
 
+
===<onlyinclude>[[Team:Hawaii/Project/Part B|Part B]]: Cyanobacterial protein secretion system</onlyinclude>===
===<onlyinclude>[[Team:Hawaii/Project/Part B|Part B]]: Cyanobacterial protein secretion system</onlyinclude>===
:Photosynthetic cyanobacteria provide the opportunity for autotrophic production of practically any biomolecule. The ability to extract engineered biomolecules would make this bacterium a renewable, nearly self-sustaining "factory"- a potentially valuable tool in bioengineering. For Part B, we will create BioBricks encoding naturally occurring signal peptides that can be combined with a protein coding sequence in order to express the protein of interest extracellularly. [[Team:Hawaii/Project/Part B|(''read more...'')]]
:Photosynthetic cyanobacteria provide the opportunity for autotrophic production of practically any biomolecule. The ability to extract engineered biomolecules would make this bacterium a renewable, nearly self-sustaining "factory"- a potentially valuable tool in bioengineering. For Part B, we will create BioBricks encoding naturally occurring signal peptides that can be combined with a protein coding sequence in order to express the protein of interest extracellularly. [[Team:Hawaii/Project/Part B|(''read more...'')]]
-
==Materials and Methods==
+
==Materials, Methods, and Results==
-
===Part A: Mobilizable Broad-Host-Range Plasmid===
+
===[[Team:Hawaii/Project/Part_A_MaterialsMethodsResults |Part A:]] Mobilizable Broad-Host-Range Plasmid===
-
===Part B: Expression system for ''Synechocystis'' sp. PCC 6803===
+
-
====Step 1: Synthesis and assembly of the ''nirA'' promoter and ''pilA'' and ''slr2016'' signal sequences====
+
-
:The ''nir'' promoter and the ''pilA'' and ''slr2016'' secretion signal sequences will be syntheized with the standard Biobrick sites. Oligonucleotide fragments of each will be hybridized with its complement and ligated together to form whole, fully functional promoters and signal sequences. Assembly of these new Biobricks will be verified by gel electrophoresis as well as sequencing. <br>
+
-
'''''nir'' promoter'''
+
-
{| class="wikitable" align="center" border="1"
+
-
! Oligonucleotide
+
-
! Sequence
+
-
! Length
+
-
|-
+
-
| pnir1_fb.syn.1
+
-
| CTAGAGCTAAATGCGTAAACTGCATATGCCTTCGCTGAGTGTAATTTACGTTACA
+
-
| 55
+
-
|-
+
-
| pnir2_fb.syn.1
+
-
| AATTTTAACGAAACGGGAACCCTATATTGATCTCTACTACTAGTAGCGGCCGCTGCA
+
-
| 57
+
-
|-
+
-
|pnir2_rb.syn.1
+
-
| GCGGCCGCTACTAGTAGTAGAGATCAATATAGGGTTCCCGTTTCGTTAAAATTTGTAAC
+
-
| 59
+
-
|-
+
-
|pnir1_rb.syn.1
+
-
| GTAAATTACACTCAGCGAAGGCATATGCAGTTTACGCATTTAGCT
+
-
| 45
+
-
|}
+
-
'''Signal sequences'''
+
:The ''aada'' BioBrick containing the ''lac'' promoter and rbs and the origin of transfer have been successfully constructed. The ''aada'' BioBrick was confirmed by sequencing and was tested in ''E.coli''. The construct was shown to confer resistance to streptomycin and spectinomycin. The origin of transfer was confirmed by sequencing and will be tested in ''E. coli'' using the construct with ''oriT'' inserted into the ''lacZ'' BioBrick (J33207) plasmid.  
-
{| class="wikitable" align="center" border="1"
+
-
! Oligonucleotide
+
-
! Sequence
+
-
! Length
+
-
|-
+
-
|pilA1_fp.syn.1
+
-
| CTAGATGGCTAGTAATTTTAAATTCAAACTCCTCTCTCAAC
+
-
| 41
+
-
|-
+
-
|pilA2_ff.syn.1
+
-
| TCTCCAAAAAACGGGCAGAAGGTGGTACTAGTAGCGGCCGCTGCA
+
-
| 45
+
-
|-
+
-
|pilA2_rf.syn.1
+
-
| GCGGCCGCTACTAGTACCACCTTCTGCCCGTTTTTTGGAGAGTTGAG
+
-
| 47
+
-
|-
+
-
|pilA1_rp.syn.1
+
-
| AGAGGAGTTTGAATTTAAAATTACTAGCCAT
+
-
| 31
+
-
|-
+
-
|slr2016-1_fp.syn.1
+
-
| CTAGATGGCAGCAAAACAACTATGGAAAATTTTCAATC
+
-
| 38
+
-
|-
+
-
|slr2016-2_ff.syn.1
+
-
| CTAGACCGATGAAGGGTGGAACTAGTAGCGGCCGCTGCA
+
-
| 39
+
-
|-
+
-
|slr2016-2_rf.syn.1
+
-
| GCGGCCGCTACTAGTTCCACCCTTCATCG
+
-
| 29
+
-
|-
+
-
|slr2016-1_rp.syn.1
+
-
| GTCTAGGATTGAAAATTTTCCATAGTTGTTTTGCTGCCAT
+
-
| 40
+
-
|}
+
-
====Step 2: Site-directed mutagenesis of GFP (BBa_E0040) into a fusion brick====
+
:The Broad-Host-Range plasmid is still under construction. Currently the complete set of parts -- replication proteins, the origin of vegetative replication, the ''aadA'' gene and the origin of transfer are in pSB1A3 plasmid and are currently being tested. We plan to place this construct in the BioBrick Base Vector, though as it is in pSB1A3, all of the parts necessary to verify that the plasmid is transferred through conjugation, and is autonomously replicating in ''Synechocystis'' are present. [[Team:Hawaii/Project/Part_A_MaterialsMethodsResults|''(Details...)'']]
-
:GFP, as it currently exists in the Biobrick [http://www.partsregistry.org Registry of Parts], is a protein Biobrick, meaning that it will ligate out of frame with our signal sequence Biobricks. A primer will be designed for site-directed mutagenesis of the GFP start codon to convert BBa_E0040 into a fusion Biobrick.
+
-
{| class="wikitable" border="1" align="center"
+
-
! Primer
+
-
! Sequence
+
-
! Length
+
-
! G/C content
+
-
! T<sub>m</sub>
+
-
|-
+
-
| GFP (BBa_E0040) fusion / foward primer
+
-
| GCCGCTTCTAGAcgtaaaggag
+
-
| 22 bp
+
-
| 54.55%
+
-
| 60.2 C
+
-
|-
+
===[[Team:Hawaii/Project/Part_B_MaterialsMethodsResults |Part B:]] Expression system for ''Synechocystis'' sp. PCC 6803===
-
| GFP (BBa_E0040) fusion / reverse primer
+
:The nitrate inducible ''nir'' promoter and the ''pilA'' and ''slr2016'' secretion signal sequences were successfully constructed from synthesized oligonucleotide fragments. GFP, BBa_E0040, was converted into a fusion brick through site-directed mutagenesis. Though ligation of ''pilA'' to any BioBrick part was unsuccessful, we were able to ligate ''slr2016'' to GFP fusion to eventually create a constitutive GFP secretion device under the control of a ''lac'' promoter. ''E. coli'' strain DH5&alpha; transformed with this device was observed to glow green. However, GFP secretion was not observed since the signal sequence is specific to ''Synechocystis'' sp. PCC 6803.
-
| cgagtcagtgagcgaggaag
+
-
| 20 bp
+
-
| 60%
+
-
| 59.6
+
-
|-
+
-
|}
+
-
====Step 3: Conversion of pRL1383a into a Biobrick plasmid====
+
: The mobilizable broad host range plasmid, pRL1383a, was successfully converted into a BioBrick plasmid. The original pRL1383a MCS was replaced by the BioBrick part J33207 and the full pSB1A2 flanking regions. J33207, a ''lac'' promoter-''lacZ'' construct, allows for blue-white selection of transformants. However, when J33207 was inserted into pRL1383a, no blue colonies were observed though the insert was confirmed by sequencing. Sequencing revealed a single base pair transversion in the CAP binding site of the ''lac'' promoter. It is unknown whether this mutation causes the lost of blue/white screening capabilities, or if the plasmid itself is affecting transcription or translation of the ''lacZ'' gene.
-
:[[Team:Hawaii/Project/Part_A | Part A]] of our project focuses on converting the RSF1010 based plasmid, pRL1383a into a sophisticated broad-host Biobrick plasmid. While we aim to ultimately express our secretion system in this new plasmid as part of a cyanobacterial expression system, we need a workable shuttle vector between ''E. coli'' (where constructs will be made) and PCC6803 (the ultimate host). Converting pRL1383a into a much simpler Biobrick plasmid will fulfill this requirement. Verification regions, transcriptional terminators, and the Biobrick multiple cloning site (MCS) will be isolated from the plasmid containing BBa_J33207 via PCR. PCR primers will also include ''Hind''III and ''Bam''HI restriction sites for ligation into pRL1383a. This ligation will replace the original pRL1383a MCS which includes Biobrick and Biobrick compatible restriction sites. The MCS replacement will be verified by restriction digest and plasmid sequencing.
+
-
{| class="wikitable" border="1" align="center"
+
:The constitutive secretion device has been placed in the converted pRL1383a plasmid and is currently being conjugated into ''Synechocystis'' sp. PCC 6803.
-
! Primer
+
-
! Sequence
+
-
! Length
+
-
! G/C content
+
-
! T<sub>m</sub>
+
-
! Notes
+
-
|-
+
-
| HindIII-VF2BB
+
-
| cctAAGCTTtgccacctgacgtctaagaa
+
-
| 29 bp (20 bp)
+
-
| 48.3% (50.0%)
+
-
| 65.9 C (58.6 C)
+
-
| Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
+
-
|-
+
-
| BamHI-VRBB
+
-
| ccaGGATCCattaccgcctttgagtgagc
+
-
| 29 bp (20 bp)
+
-
| 55.2% (50.0%)
+
-
| 67.9 C (58.0 C)
+
-
| Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.
+
-
|}
+
-
====Step 4: Device construction====
+
: The intended nitrate-inducible GFP secretion device and controls are in the process of being constructed. When completed, these devices will also be conjugated into ''Synechocystis'' sp. PCC 6803 for testing. [[Team:Hawaii/Project/Part_B_MaterialsMethodsResults |''(Details...)'']]
-
[[Image:Construct.jpg |right|thumb|200px|Figure 1: Construct of proposed GFP secretion device.]]
+
-
:The synthesized signal peptides and nirA promoter BioBricks will be combined with at least three existing BioBricks to create two (or more) nitrate-regulated protein secretion devices according to the scheme detailed in Figure 1. The resulting devices will be placed in a ''Synechocystis'' compatible BioBrick vector derived from the RSF1010 derived plasmid pRL1383a. In the proposed devices, the signal peptides will be situated so they are in-frame with GFP. The translated polypeptide should consist of a N-terminal signal polypeptide leader sequence attached to a fluorescent protein.
+
-
====Step 5: Testing for protein secretion====
+
==Implications and future plans==
-
:The BioBrick vector can be inserted into ''Synechocystis'' sp. PCC6803 by triparental conjugation with ''E. coli'' harboring a transmissible plasmid (like RP1) and another ''E. coli'' containing our engineered plasmid. Plated ''Synechocystis'' sp. PCC6803 colonies successfully transformed wwill exhibit a glowing halo of secreted GFPTransformed ''Synechocystis'' sp. PCC6803 grown in liquid media will result in fluorescent culture media.  The efficacy of the signal peptides in transporting GFP into the extracellular media can be measured using a spectrofluorometer.
+
:The availability of an additional broad-host range plasmid allows for testing of additional BioBrick constructs in other gram-negative organisms transformable by pRL1383a. Genes coding for proteins of industrial value can be converted into fusion brick format and ligated to either of the signal sequence bricks we have createdThe resulting construct can be introduced into the organism of interest using the plasmid K125000 or K125010.  ''Synechocystis'' transformants should be capable of secreting the protein into culture media, optimizing production since multiple yields can be collected over time from the living cell culture.  
-
====Controls====
+
:Further testing is still necessary to fully characterize the plasmids we have produced.  We also need to work out the protocol for blue-white selection in DH5&alpha; using K125000Though the correct BioBrick part is included in the plasmid, colonies do not appear blueIn addition, transformed E.coli colonies grow slowly and do not appear uniform in size.
-
:A number of controls will also be constructed in parallel with our device to test device assembly and function.
+
-
{| align="center" border="1"
+
-
!Construct
+
-
!Control
+
-
!Test
+
-
|-
+
-
|align="center"| ''nirA'' + [http://partsregistry.org/Part:BBa_B0030:Design rbs (BBa_B0034)] + GFP [http://partsregistry.org/Part:BBa_E0040:Design (BBa_E0040)] + txn term. [http://partsregistry.org/Part:BBa_B1006:Design (BBa_B1006)]
+
-
| align="center"| [http://partsregistry.org/Part:BBa_I14032:Design ''lac'' promoter (BBa_I14032)] + [http://partsregistry.org/Part:BBa_B0030:Design rbs (BBa_B0034)] + [http://partsregistry.org/Part:BBa_E0040:Design GFP (BBa_E0040)] + [http://partsregistry.org/Part:BBa_B1006:Design txn term. (BBa_B1006)]
+
-
|align=center|Inducibility of ''nirA'' promoter
+
-
|-
+
-
|align="center"| ''nirA'' promoter + [http://partsregistry.org/Part:BBa_B0034:Design rbs (BBa_B0034)] + ''pilA'' or ''slr2016'' signal sequence + GFP fusion brick + txn term. [http://partsregistry.org/Part:BBa_B1006:Design txn term(BBa_B1006)]
+
-
| align="center"|''nirA'' or lac promoter + rbs [http://partsregistry.org/Part:BBa_B0034:Design (BBa_B0034)] + GFP [http://partsregistry.org/Part:BBa_E0040:Design (BBa_E0040)] + txn term. [http://partsregistry.org/Part:BBa_B1006:Design (BBa_B1006)]
+
-
|align=center|Functionality of secretion peptides and GFP fusion
+
-
|}
+
-
== Results ==
+
:Since the plasmid pRL1383a is a low copy number plasmid, it may be useful in the future to supplement the plasmid with an inducible high copy number origin of replication.  An appropriate promoter could be selected so the plasmid replicates as a high copy number plasmid when placed in ''E.coli'' but reverts to a low copy number when transferred to cyanobacteria or other gram-negative organisms.
-
===Part A: Mobilizable Broad-Host-Range Plasmid===
+
-
===Expression system for ''Synechocystis'' sp. PCC 6803===
+
-
==Implications and future plans==
+
{{Team:Hawaii/Footer}}
{{Team:Hawaii/Footer}}
__NOTOC__
__NOTOC__

Latest revision as of 03:46, 30 October 2008

Projects Events Resources
Sponsors Experiments Milestones Protocols
Notebook (t) Meetings (t)

Overall Project

A BioBrick toolkit for cyanobacteria

We aim to extend the current BioBrick registry to a greater range of organisms, including cyanobacteria. Cyanobacteria are studied for their ability to produce useful compounds, including biofuels and biopolymers. These "little green factories" require only salts, light, water, and carbon dioxide for photoautotrophic growth. A cyanobacterial "toolkit" would enhance our ability to utilize this system.
We designed:
1) mobilizable broad-host range BioBrick vectors derived from RSF1010,
2) a cassette for protein secretion from Synechocystis sp. PCC 6803, and
3) a nitrate-inducible cyanobacterial promoter BioBrick.
Our toolkit was designed for conjugative gene transfer from Escherichia coli to Synechocystis to achieve the controlled production and recovery of bioproducts, demonstrable by induced secretion of green fluorescent protein. Though our parts were targeted for work in cyanobacteria, they may be compatible with other Gram-negative systems including Agrobacterium, which is capable of plant transformation.

Project Details

Part A: Mobilizable Broad-Host-Range Plasmid

RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (oriT) and rep genes with an associated origin of vegetative replication (oriV), respectively. We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks. The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. (read more...)

Part B: Cyanobacterial protein secretion system

Photosynthetic cyanobacteria provide the opportunity for autotrophic production of practically any biomolecule. The ability to extract engineered biomolecules would make this bacterium a renewable, nearly self-sustaining "factory"- a potentially valuable tool in bioengineering. For Part B, we will create BioBricks encoding naturally occurring signal peptides that can be combined with a protein coding sequence in order to express the protein of interest extracellularly. (read more...)

Materials, Methods, and Results

Part A: Mobilizable Broad-Host-Range Plasmid

The aada BioBrick containing the lac promoter and rbs and the origin of transfer have been successfully constructed. The aada BioBrick was confirmed by sequencing and was tested in E.coli. The construct was shown to confer resistance to streptomycin and spectinomycin. The origin of transfer was confirmed by sequencing and will be tested in E. coli using the construct with oriT inserted into the lacZ BioBrick (J33207) plasmid.
The Broad-Host-Range plasmid is still under construction. Currently the complete set of parts -- replication proteins, the origin of vegetative replication, the aadA gene and the origin of transfer are in pSB1A3 plasmid and are currently being tested. We plan to place this construct in the BioBrick Base Vector, though as it is in pSB1A3, all of the parts necessary to verify that the plasmid is transferred through conjugation, and is autonomously replicating in Synechocystis are present. (Details...)

Part B: Expression system for Synechocystis sp. PCC 6803

The nitrate inducible nir promoter and the pilA and slr2016 secretion signal sequences were successfully constructed from synthesized oligonucleotide fragments. GFP, BBa_E0040, was converted into a fusion brick through site-directed mutagenesis. Though ligation of pilA to any BioBrick part was unsuccessful, we were able to ligate slr2016 to GFP fusion to eventually create a constitutive GFP secretion device under the control of a lac promoter. E. coli strain DH5α transformed with this device was observed to glow green. However, GFP secretion was not observed since the signal sequence is specific to Synechocystis sp. PCC 6803.
The mobilizable broad host range plasmid, pRL1383a, was successfully converted into a BioBrick plasmid. The original pRL1383a MCS was replaced by the BioBrick part J33207 and the full pSB1A2 flanking regions. J33207, a lac promoter-lacZ construct, allows for blue-white selection of transformants. However, when J33207 was inserted into pRL1383a, no blue colonies were observed though the insert was confirmed by sequencing. Sequencing revealed a single base pair transversion in the CAP binding site of the lac promoter. It is unknown whether this mutation causes the lost of blue/white screening capabilities, or if the plasmid itself is affecting transcription or translation of the lacZ gene.
The constitutive secretion device has been placed in the converted pRL1383a plasmid and is currently being conjugated into Synechocystis sp. PCC 6803.
The intended nitrate-inducible GFP secretion device and controls are in the process of being constructed. When completed, these devices will also be conjugated into Synechocystis sp. PCC 6803 for testing. (Details...)

Implications and future plans

The availability of an additional broad-host range plasmid allows for testing of additional BioBrick constructs in other gram-negative organisms transformable by pRL1383a. Genes coding for proteins of industrial value can be converted into fusion brick format and ligated to either of the signal sequence bricks we have created. The resulting construct can be introduced into the organism of interest using the plasmid K125000 or K125010. Synechocystis transformants should be capable of secreting the protein into culture media, optimizing production since multiple yields can be collected over time from the living cell culture.
Further testing is still necessary to fully characterize the plasmids we have produced. We also need to work out the protocol for blue-white selection in DH5α using K125000. Though the correct BioBrick part is included in the plasmid, colonies do not appear blue. In addition, transformed E.coli colonies grow slowly and do not appear uniform in size.
Since the plasmid pRL1383a is a low copy number plasmid, it may be useful in the future to supplement the plasmid with an inducible high copy number origin of replication. An appropriate promoter could be selected so the plasmid replicates as a high copy number plasmid when placed in E.coli but reverts to a low copy number when transferred to cyanobacteria or other gram-negative organisms.


Sponsor_UHM.gifSponsor_OVCRGE.gifSponsor_CTAHR.gif