Team:Hawaii/Project

From 2008.igem.org

(Difference between revisions)
(→Step 3: Conversion of pRL1383a into a Biobrick plasmid)
(→Implications and future plans)
 
(33 intermediate revisions not shown)
Line 12: Line 12:
:::3) a nitrate-inducible cyanobacterial promoter BioBrick.  
:::3) a nitrate-inducible cyanobacterial promoter BioBrick.  
-
:Our toolkit was designed for conjugative gene transfer from ''Escherichia coli'' to ''Synechocystis'' to achieve the controlled production and recovery or bioproducts, demonstrable by induced secretion of green fluorescent protein. Though our parts were targeted for work in cyanobacteria, they may be compatible with other Gram-negative systems including ''Agrobacterium'', which is capable of plant transformation.
+
:Our toolkit was designed for conjugative gene transfer from ''Escherichia coli'' to ''Synechocystis'' to achieve the controlled production and recovery of bioproducts, demonstrable by induced secretion of green fluorescent protein. Though our parts were targeted for work in cyanobacteria, they may be compatible with other Gram-negative systems including ''Agrobacterium'', which is capable of plant transformation.
== Project Details==
== Project Details==
===<onlyinclude>[[Team:Hawaii/Project/Part A|Part A]]: Mobilizable Broad-Host-Range Plasmid </onlyinclude>===
===<onlyinclude>[[Team:Hawaii/Project/Part A|Part A]]: Mobilizable Broad-Host-Range Plasmid </onlyinclude>===
-
:RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (oriT) and rep genes with an associated origin of vegetative replication (oriV), respectively.  We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks.  The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. [[Team:Hawaii/Project/Part A|(''read more...'')]]
+
:RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (''oriT'') and rep genes with an associated origin of vegetative replication (''oriV''), respectively.  We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks.  The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. [[Team:Hawaii/Project/Part A|(''read more...'')]]
-
 
+
===<onlyinclude>[[Team:Hawaii/Project/Part B|Part B]]: Cyanobacterial protein secretion system</onlyinclude>===
===<onlyinclude>[[Team:Hawaii/Project/Part B|Part B]]: Cyanobacterial protein secretion system</onlyinclude>===
Line 23: Line 22:
==Materials, Methods, and Results==
==Materials, Methods, and Results==
-
===Part A: Mobilizable Broad-Host-Range Plasmid===
+
===[[Team:Hawaii/Project/Part_A_MaterialsMethodsResults |Part A:]] Mobilizable Broad-Host-Range Plasmid===
-
===Part B: Expression system for ''Synechocystis'' sp. PCC 6803===
+
-
====Step 1: Synthesis and assembly of the ''nirA'' promoter and ''pilA'' and ''slr2016'' signal sequences====
+
-
:The ''nir'' promoter and the ''pilA'' and ''slr2016'' secretion signal sequences were syntheized with the standard Biobrick sites. Oligonucleotide fragments of each were hybridized with its complement and ligated together to form whole, fully functional promoters and signal sequences. Assembly of these new Biobricks were verified by gel electrophoresis and sequencing. <br>
+
-
'''''nir'' promoter'''
+
-
{| class="wikitable" align="center" border="1"
+
-
! Oligonucleotide
+
-
! Sequence
+
-
! Length
+
-
|-
+
-
| pnir1_fb.syn.1
+
-
| CTAGAGCTAAATGCGTAAACTGCATATGCCTTCGCTGAGTGTAATTTACGTTACA
+
-
| 55
+
-
|-
+
-
| pnir2_fb.syn.1
+
-
| AATTTTAACGAAACGGGAACCCTATATTGATCTCTACTACTAGTAGCGGCCGCTGCA
+
-
| 57
+
-
|-
+
-
|pnir2_rb.syn.1
+
-
| GCGGCCGCTACTAGTAGTAGAGATCAATATAGGGTTCCCGTTTCGTTAAAATTTGTAAC
+
-
| 59
+
-
|-
+
-
|pnir1_rb.syn.1
+
-
| GTAAATTACACTCAGCGAAGGCATATGCAGTTTACGCATTTAGCT
+
-
| 45
+
-
|}
+
-
'''Signal sequences'''
+
:The ''aada'' BioBrick containing the ''lac'' promoter and rbs and the origin of transfer have been successfully constructed. The ''aada'' BioBrick was confirmed by sequencing and was tested in ''E.coli''. The construct was shown to confer resistance to streptomycin and spectinomycin. The origin of transfer was confirmed by sequencing and will be tested in ''E. coli'' using the construct with ''oriT'' inserted into the ''lacZ'' BioBrick (J33207) plasmid.  
-
{| class="wikitable" align="center" border="1"
+
-
! Oligonucleotide
+
-
! Sequence
+
-
! Length
+
-
|-
+
-
|pilA1_fp.syn.1
+
-
| CTAGATGGCTAGTAATTTTAAATTCAAACTCCTCTCTCAAC
+
-
| 41
+
-
|-
+
-
|pilA2_ff.syn.1
+
-
| TCTCCAAAAAACGGGCAGAAGGTGGTACTAGTAGCGGCCGCTGCA
+
-
| 45
+
-
|-
+
-
|pilA2_rf.syn.1
+
-
| GCGGCCGCTACTAGTACCACCTTCTGCCCGTTTTTTGGAGAGTTGAG
+
-
| 47
+
-
|-
+
-
|pilA1_rp.syn.1
+
-
| AGAGGAGTTTGAATTTAAAATTACTAGCCAT
+
-
| 31
+
-
|-
+
-
|slr2016-1_fp.syn.1
+
-
| CTAGATGGCAGCAAAACAACTATGGAAAATTTTCAATC
+
-
| 38
+
-
|-
+
-
|slr2016-2_ff.syn.1
+
-
| CTAGACCGATGAAGGGTGGAACTAGTAGCGGCCGCTGCA
+
-
| 39
+
-
|-
+
-
|slr2016-2_rf.syn.1
+
-
| GCGGCCGCTACTAGTTCCACCCTTCATCG
+
-
| 29
+
-
|-
+
-
|slr2016-1_rp.syn.1
+
-
| GTCTAGGATTGAAAATTTTCCATAGTTGTTTTGCTGCCAT
+
-
| 40
+
-
|}<br>
+
-
[[Image:071008.jpg|left|thumb|150px|Ligation products. Ten microliters of ligation product were loaded into each well of a 3% agarose gel stained with EtBr and ran at 95V for 1 hour.]]
+
-
Three different constructs of the full ''nir'' promoter and ''slr2016'' and ''pilA'' signal sequences were created. The first followed ligation and restriction digest [[Team:Hawaii/Protocols |protocols]] using full concentrations of annealed products. The second was a ligation and restriction digest carried out using 10<sup>-1</sup> dilutions of annealed product. It was suggested by Dr. Sean Callahan that if too much DNA was added to the ligation mixture, "DNA hairballs" would form between ssDNA (unannealed) and dsDNA, resulting in smears and multiple bands in the gel. The last method of construction simply placed equal concentrations of annealed products together. In theory, DNA overhangs would anneal appropriately, yielding an unligated but full promoter or signal sequence.<br>
+
-
Ligation at full concentrations of annealed product worked best. The strongest bands were observed for this method. Multiple bands were still observed, above and below the expected band length (80-100bp) indicating both unligated DNA fragments and incompletely digested DNA or hairball structures. However, the strongest band for all three constructs corresponded to the desired product. The 10<sup>-1</sup> ligations were barely visible on the gel, and multiple bands were still observed, so ligation and restriction digest efficiency was not improved by the addition of less DNA. The last method of annealing but not ligating yielded two bands in the gel corresponding to the two original DNA fragments.<br>
+
:The Broad-Host-Range plasmid is still under construction. Currently the complete set of parts -- replication proteins, the origin of vegetative replication, the ''aadA'' gene and the origin of transfer are in pSB1A3 plasmid and are currently being tested. We plan to place this construct in the BioBrick Base Vector, though as it is in pSB1A3, all of the parts necessary to verify that the plasmid is transferred through conjugation, and is autonomously replicating in ''Synechocystis'' are present. [[Team:Hawaii/Project/Part_A_MaterialsMethodsResults|''(Details...)'']]
-
The purified DNA was then ligated to a Biobrick vector, [http://www.partsregistry.org/Part:pSB1A2 pSB1A2], for subcloning in ''E. coli.'' Ligations were carried out using 3:1 molar concentrations of insert to vector.
+
===[[Team:Hawaii/Project/Part_B_MaterialsMethodsResults |Part B:]] Expression system for ''Synechocystis'' sp. PCC 6803===
-
<br><br>
+
:The nitrate inducible ''nir'' promoter and the ''pilA'' and ''slr2016'' secretion signal sequences were successfully constructed from synthesized oligonucleotide fragments. GFP, BBa_E0040, was converted into a fusion brick through site-directed mutagenesis. Though ligation of ''pilA'' to any BioBrick part was unsuccessful, we were able to ligate ''slr2016'' to GFP fusion to eventually create a constitutive GFP secretion device under the control of a ''lac'' promoter. ''E. coli'' strain DH5&alpha; transformed with this device was observed to glow green. However, GFP secretion was not observed since the signal sequence is specific to ''Synechocystis'' sp. PCC 6803.
-
:Sequencing by the Greenwood Molecular Biology Facility returned the following results:
+
: The mobilizable broad host range plasmid, pRL1383a, was successfully converted into a BioBrick plasmid. The original pRL1383a MCS was replaced by the BioBrick part J33207 and the full pSB1A2 flanking regions. J33207, a ''lac'' promoter-''lacZ'' construct, allows for blue-white selection of transformants. However, when J33207 was inserted into pRL1383a, no blue colonies were observed though the insert was confirmed by sequencing. Sequencing revealed a single base pair transversion in the CAP binding site of the ''lac'' promoter. It is unknown whether this mutation causes the lost of blue/white screening capabilities, or if the plasmid itself is affecting transcription or translation of the ''lacZ'' gene.
-
:'''''nir'' promoter'''
+
-
:[[Image:nirsequence.jpeg|410px]]
+
-
:'''''slr2016'' signal sequence'''
+
-
:[[Image:slr2016sequence.jpeg|280px]]
+
-
:'''''pilA'' signal sequence'''
+
-
:[[Image:pilasequence.jpeg|280px]]
+
-
====Step 2: Site-directed mutagenesis of GFP (BBa_E0040) into a fusion brick====
+
:The constitutive secretion device has been placed in the converted pRL1383a plasmid and is currently being conjugated into ''Synechocystis'' sp. PCC 6803.
-
:GFP, as it currently exists in the Biobrick [http://www.partsregistry.org Registry of Parts], is a protein Biobrick, meaning that it will ligate out of frame with our signal sequence Biobricks. A primer was designed for site-directed mutagenesis of the GFP start codon to convert BBa_E0040 into a fusion Biobrick.
+
-
[[Image:071808pcrgel.jpg|thumb|right|200 px|Colony PCR. Ten microliters of colony PCR reactions were loaded into each well of an EtBr stained 4% agarose gel ran at 95V for 50 min.]]
+
-
{| class="wikitable" border="1" align="center"
+
-
! Primer
+
-
! Sequence
+
-
! Length
+
-
! G/C content
+
-
! T<sub>m</sub>
+
-
|-
+
-
| GFP (BBa_E0040) fusion / foward primer
+
-
| GCCGCTTCTAGAcgtaaaggag
+
-
| 22 bp
+
-
| 54.55%
+
-
| 60.2 C
+
-
|-
+
: The intended nitrate-inducible GFP secretion device and controls are in the process of being constructed. When completed, these devices will also be conjugated into ''Synechocystis'' sp. PCC 6803 for testing. [[Team:Hawaii/Project/Part_B_MaterialsMethodsResults |''(Details...)'']]
-
| GFP (BBa_E0040) fusion / reverse primer
+
-
| cgagtcagtgagcgaggaag
+
-
| 20 bp
+
-
| 60%
+
-
| 59.6
+
-
|-
+
-
|}
+
-
<br>
+
-
:Following standard PCR protocol, [http://www.partsregistry.org/Part:BBa_E0040 GFP] was converted into the fusion brick, GFP fusion. GFP fusion was ligated into pSB1A2 and a colony PCR was conducted on a transformed colony. Following gel verification of the part, GFP fusion was sent out for sequencing.
+
-
:Sequencing by the Greenwood Molecular Biology Facility returned the following sequence:
+
==Implications and future plans==
 +
:The availability of an additional broad-host range plasmid allows for testing of additional BioBrick constructs in other gram-negative organisms transformable by pRL1383a. Genes coding for proteins of industrial value can be converted into fusion brick format and ligated to either of the signal sequence bricks we have created.  The resulting construct can be introduced into the organism of interest using the plasmid K125000 or K125010.  ''Synechocystis'' transformants should be capable of secreting the protein into culture media, optimizing production since multiple yields can be collected over time from the living cell culture.
-
:[[Image:gfpfusionsequence.jpeg|left|700px]]
+
:Further testing is still necessary to fully characterize the plasmids we have produced.  We also need to work out the protocol for blue-white selection in DH5&alpha; using K125000.  Though the correct BioBrick part is included in the plasmid, colonies do not appear blue.  In addition, transformed E.coli colonies grow slowly and do not appear uniform in size.
-
====Step 3: Conversion of pRL1383a into a Biobrick plasmid====
+
:Since the plasmid pRL1383a is a low copy number plasmid, it may be useful in the future to supplement the plasmid with an inducible high copy number origin of replication. An appropriate promoter could be selected so the plasmid replicates as a high copy number plasmid when placed in ''E.coli'' but reverts to a low copy number when transferred to cyanobacteria or other gram-negative organisms.
-
:[[Team:Hawaii/Project/Part_A | Part A]] of our project focuses on converting the RSF1010 based plasmid, pRL1383a into a sophisticated broad-host Biobrick plasmid. While we aim to ultimately express our secretion system in this new plasmid as part of a cyanobacterial expression system, we needed a workable shuttle vector between ''E. coli'' (where constructs will be made) and PCC6803 (the ultimate host). Converting pRL1383a into a much simpler Biobrick plasmid fulfilled this requirement. Verification regions, transcriptional terminators, and the Biobrick multiple cloning site (MCS) was be isolated from the [http://www.partsregistry.org/Part:pSB1A2 plasmid (pSB1A2)]  containing BBa_J33207 via PCR. PCR primers also included ''Hind''III and ''Bam''HI restriction sites for ligation into pRL1383a. This ligation replaced the original pRL1383a MCS which includes Biobrick and Biobrick compatible restriction sites. The MCS replacement was verified by restriction digest and plasmid sequencing.
+
   
-
 
+
-
{| class="wikitable" border="1" align="center"
+
-
! Primer
+
-
! Sequence
+
-
! Length
+
-
! G/C content
+
-
! T<sub>m</sub>
+
-
! Notes
+
-
|-
+
-
| HindIII-VF2BB
+
-
| cctAAGCTTtgccacctgacgtctaagaa
+
-
| 29 bp (20 bp)
+
-
| 48.3% (50.0%)
+
-
| 65.9 C (58.6 C)
+
-
| Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
+
-
|-
+
-
| BamHI-VRBB
+
-
| ccaGGATCCattaccgcctttgagtgagc
+
-
| 29 bp (20 bp)
+
-
| 55.2% (50.0%)
+
-
| 67.9 C (58.0 C)
+
-
| Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.
+
-
|}<br>
+
-
:In theory, transformants should be blue when plated on X-gal because of the &alpha; complementation of [[http://partsregistry.org/Parts:BBa_J33207 J33207 (''lac promoter'' + ''lac Z'')] in DH5&alpha;. Transformation of DH5&alpha; with part [[http://partsregistry.org/Parts:BBa_J33207 J33207]] as provided in pSB1A2 yields blue colonies. However, none of the transformants obtained were blue, despite having the J33207 insert as confirmed by gel electrophoresis. The plasmid was sent for sequencing to verify the insert.
+
-
 
+
-
:Sequencing of the converted plasmid by the Greenwood Molecular Biology Facility returned the following sequence:
+
-
:There appeared to be a single base pair transversion in the CAP binding site of the ''lac'' promoter. The ligation was repeated but no blue colonies were observed, yet again. Sequencing results of this new ligation is pending.
+
-
 
+
-
'''Need a picture of RE digested BBpRL and sequencing'''
+
-
 
+
-
====Step 4: Device construction====
+
-
[[Image:Construct.jpg |right|thumb|200px|Figure 1: Construct of proposed GFP secretion device.]]
+
-
:The synthesized signal peptides and nirA promoter BioBricks will be combined with at least three existing BioBricks to create two (or more) nitrate-regulated protein secretion devices according to the scheme detailed in Figure 1.  The resulting devices will be placed in a ''Synechocystis'' compatible BioBrick vector derived from the RSF1010 derived plasmid pRL1383a. In the proposed devices, the signal peptides will be situated so they are in-frame with GFP.  The translated polypeptide should consist of a N-terminal signal polypeptide leader sequence attached to a fluorescent protein.
+
-
 
+
-
====Step 5: Testing for protein secretion====
+
-
:The BioBrick vector can be inserted into ''Synechocystis'' sp. PCC6803 by triparental conjugation with ''E. coli'' harboring a transmissible plasmid (like RP1) and another ''E. coli'' containing our engineered plasmid. Plated ''Synechocystis'' sp. PCC6803 colonies successfully transformed wwill exhibit a glowing  halo of secreted GFP.  Transformed ''Synechocystis'' sp. PCC6803 grown in liquid media will result in fluorescent culture media.  The efficacy of the signal peptides in transporting GFP into the extracellular media can be measured using a spectrofluorometer.
+
-
 
+
-
====Controls====
+
-
:A number of controls will also be constructed in parallel with our device to test device assembly and function.
+
-
{| align="center" border="1"
+
-
!Construct
+
-
!Control
+
-
!Test
+
-
|-
+
-
|align="center"| ''nirA'' + [http://partsregistry.org/Part:BBa_B0030:Design rbs (BBa_B0034)] + GFP [http://partsregistry.org/Part:BBa_E0040:Design (BBa_E0040)] + txn term. [http://partsregistry.org/Part:BBa_B1006:Design (BBa_B1006)]
+
-
| align="center"| [http://partsregistry.org/Part:BBa_I14032:Design ''lac'' promoter (BBa_I14032)] + [http://partsregistry.org/Part:BBa_B0030:Design rbs (BBa_B0034)] + [http://partsregistry.org/Part:BBa_E0040:Design GFP (BBa_E0040)] + [http://partsregistry.org/Part:BBa_B1006:Design txn term. (BBa_B1006)]
+
-
|align=center|Inducibility of ''nirA'' promoter
+
-
|-
+
-
|align="center"| ''nirA'' promoter + [http://partsregistry.org/Part:BBa_B0034:Design rbs (BBa_B0034)] + ''pilA'' or ''slr2016'' signal sequence + GFP fusion brick + txn term. [http://partsregistry.org/Part:BBa_B1006:Design txn term.  (BBa_B1006)]
+
-
| align="center"|''nirA'' or lac promoter + rbs [http://partsregistry.org/Part:BBa_B0034:Design (BBa_B0034)] + GFP [http://partsregistry.org/Part:BBa_E0040:Design (BBa_E0040)] + txn term. [http://partsregistry.org/Part:BBa_B1006:Design (BBa_B1006)]
+
-
|align=center|Functionality of secretion peptides and GFP fusion
+
-
|}
+
-
 
+
-
== Results ==
+
-
===Part A: Mobilizable Broad-Host-Range Plasmid===
+
-
===Expression system for ''Synechocystis'' sp. PCC 6803===
+
-
==Implications and future plans==
+
{{Team:Hawaii/Footer}}
{{Team:Hawaii/Footer}}
__NOTOC__
__NOTOC__

Latest revision as of 03:46, 30 October 2008

Projects Events Resources
Sponsors Experiments Milestones Protocols
Notebook (t) Meetings (t)

Overall Project

A BioBrick toolkit for cyanobacteria

We aim to extend the current BioBrick registry to a greater range of organisms, including cyanobacteria. Cyanobacteria are studied for their ability to produce useful compounds, including biofuels and biopolymers. These "little green factories" require only salts, light, water, and carbon dioxide for photoautotrophic growth. A cyanobacterial "toolkit" would enhance our ability to utilize this system.
We designed:
1) mobilizable broad-host range BioBrick vectors derived from RSF1010,
2) a cassette for protein secretion from Synechocystis sp. PCC 6803, and
3) a nitrate-inducible cyanobacterial promoter BioBrick.
Our toolkit was designed for conjugative gene transfer from Escherichia coli to Synechocystis to achieve the controlled production and recovery of bioproducts, demonstrable by induced secretion of green fluorescent protein. Though our parts were targeted for work in cyanobacteria, they may be compatible with other Gram-negative systems including Agrobacterium, which is capable of plant transformation.

Project Details

Part A: Mobilizable Broad-Host-Range Plasmid

RSF1010 is a naturally occurring broad-host-range plasmid capable of conjugative transfer and stable replication due to the presence of mob genes with an associated origin of transfer (oriT) and rep genes with an associated origin of vegetative replication (oriV), respectively. We aim to compartmentalize a derivative of the RSF1010 plasmid, namely pRL1383a, into BioBricks. The resulting BioBricks can be inserted into a BioBrick base vector to create a plasmid that transfers genetic elements via conjugation. (read more...)

Part B: Cyanobacterial protein secretion system

Photosynthetic cyanobacteria provide the opportunity for autotrophic production of practically any biomolecule. The ability to extract engineered biomolecules would make this bacterium a renewable, nearly self-sustaining "factory"- a potentially valuable tool in bioengineering. For Part B, we will create BioBricks encoding naturally occurring signal peptides that can be combined with a protein coding sequence in order to express the protein of interest extracellularly. (read more...)

Materials, Methods, and Results

Part A: Mobilizable Broad-Host-Range Plasmid

The aada BioBrick containing the lac promoter and rbs and the origin of transfer have been successfully constructed. The aada BioBrick was confirmed by sequencing and was tested in E.coli. The construct was shown to confer resistance to streptomycin and spectinomycin. The origin of transfer was confirmed by sequencing and will be tested in E. coli using the construct with oriT inserted into the lacZ BioBrick (J33207) plasmid.
The Broad-Host-Range plasmid is still under construction. Currently the complete set of parts -- replication proteins, the origin of vegetative replication, the aadA gene and the origin of transfer are in pSB1A3 plasmid and are currently being tested. We plan to place this construct in the BioBrick Base Vector, though as it is in pSB1A3, all of the parts necessary to verify that the plasmid is transferred through conjugation, and is autonomously replicating in Synechocystis are present. (Details...)

Part B: Expression system for Synechocystis sp. PCC 6803

The nitrate inducible nir promoter and the pilA and slr2016 secretion signal sequences were successfully constructed from synthesized oligonucleotide fragments. GFP, BBa_E0040, was converted into a fusion brick through site-directed mutagenesis. Though ligation of pilA to any BioBrick part was unsuccessful, we were able to ligate slr2016 to GFP fusion to eventually create a constitutive GFP secretion device under the control of a lac promoter. E. coli strain DH5α transformed with this device was observed to glow green. However, GFP secretion was not observed since the signal sequence is specific to Synechocystis sp. PCC 6803.
The mobilizable broad host range plasmid, pRL1383a, was successfully converted into a BioBrick plasmid. The original pRL1383a MCS was replaced by the BioBrick part J33207 and the full pSB1A2 flanking regions. J33207, a lac promoter-lacZ construct, allows for blue-white selection of transformants. However, when J33207 was inserted into pRL1383a, no blue colonies were observed though the insert was confirmed by sequencing. Sequencing revealed a single base pair transversion in the CAP binding site of the lac promoter. It is unknown whether this mutation causes the lost of blue/white screening capabilities, or if the plasmid itself is affecting transcription or translation of the lacZ gene.
The constitutive secretion device has been placed in the converted pRL1383a plasmid and is currently being conjugated into Synechocystis sp. PCC 6803.
The intended nitrate-inducible GFP secretion device and controls are in the process of being constructed. When completed, these devices will also be conjugated into Synechocystis sp. PCC 6803 for testing. (Details...)

Implications and future plans

The availability of an additional broad-host range plasmid allows for testing of additional BioBrick constructs in other gram-negative organisms transformable by pRL1383a. Genes coding for proteins of industrial value can be converted into fusion brick format and ligated to either of the signal sequence bricks we have created. The resulting construct can be introduced into the organism of interest using the plasmid K125000 or K125010. Synechocystis transformants should be capable of secreting the protein into culture media, optimizing production since multiple yields can be collected over time from the living cell culture.
Further testing is still necessary to fully characterize the plasmids we have produced. We also need to work out the protocol for blue-white selection in DH5α using K125000. Though the correct BioBrick part is included in the plasmid, colonies do not appear blue. In addition, transformed E.coli colonies grow slowly and do not appear uniform in size.
Since the plasmid pRL1383a is a low copy number plasmid, it may be useful in the future to supplement the plasmid with an inducible high copy number origin of replication. An appropriate promoter could be selected so the plasmid replicates as a high copy number plasmid when placed in E.coli but reverts to a low copy number when transferred to cyanobacteria or other gram-negative organisms.


Sponsor_UHM.gifSponsor_OVCRGE.gifSponsor_CTAHR.gif


Retrieved from "http://2008.igem.org/Team:Hawaii/Project"