Team:Heidelberg/Notebook/Killing I/Notebook/week3

From 2008.igem.org

(Difference between revisions)
(overview of the first phage cloning strategy)
 
Line 634: Line 634:
-
===overview of the first phage cloning strategy===
+
===overview of the phage cloning strategy one===
<br>
<br>
[[Image:Hd-phage-Klonierungsstrategie_Page_1.jpg]]
[[Image:Hd-phage-Klonierungsstrategie_Page_1.jpg]]
Line 686: Line 686:
AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC
AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC
-
 
-
 
-
 
-
 
-
 
==Thursday, 08/21/08==
==Thursday, 08/21/08==

Latest revision as of 11:34, 29 October 2008

<< Week 2 Overview Week 4 >>


Week 3

Contents

Monday, 08/18/08

chloramphenicol resistance cassette

  • Maxiprep of P1000, P1004, B0014, B0015
    • P1000 1672 ng/µl 1,92
    • P1004 1153 ng/µl 1,92
    • B0014 2040,4 ng/µl 1,92
    • B0015 1053,6 ng/µl 1,92
  • Analytical digestions
    • lambda DNA with XbaI and XhoI
2µl DNA
5µl NEB2
5µl BSA
1µl XbaI
1µl XhoI
26µl water 
    • Analytical digestion of P1000
1µl DNA
2µl NEB3
2µl NcoI
15µl water
    • Analytical digestion of P1004
1µl DNA
2µl NEB4
1,5µl DraI
15,5µl water
    • Analytical digestion of B0014 / B0015
1µl DNA
2µl NEB4
2µl BSA
2,5µl SfcI
12,5µl water
    • Analytical digestion of cI "green", cI "black" and T9002
  • Gel

Hd-phage-08-08-19-digestion.jpg

    • Lane 0: DNA ladder mix
    • Lane 1: lambda DNA
    • Lane 2: lambda DNA (XbaI, XhoI --> large frament ~ 40kb, small fragment ~ 9kb)
    • Lane 3: P1000
    • Lane 4: P1000 (NcoI-->1473,2374)
    • Lane 5: P1004
    • Lane 6: P1004 (DraI-->19,339,692,1067,1360)
    • Lane 7: cI green
    • Lane 8: cI green (NdeI - expected fragments?)
    • Lane 9: cI black
    • Lane 10: cI black (NdeI)
    • Lane 11: T9002
    • Lane 12: T9002 (NdeI - expected fragments?)


lamda phage

Infectiontest

  • inoculation of 20ml medium with over night culture (MG1655)
  • after 1h plaque added --> 37C for 2h + inoculation of ZMBH phage (100ql 10^-2 in 20ml MG1655)
  • incubation at 42C for 2 more hours
  • sterilefiltration + mix with growing bacteria (MG1655 and MG1655+cI)
  • incubate in soft agar at 37C for 2h, than at 42C for another 4h (altogether 24 plates)
  • phage DNA was also isolated from filtrate
  • results:
    • same amount of plaques on plates with MG1655 as with MG1655+cI
    • nearly no plaques on plates with own phage --> very low phage concentration
    • --> cI does not work!!!!
  • growing curve

Hd-phage-wachstumskurve errorbars small.jpg

    • the values are the average of all four cultures


Tuesday, 08/19/08

lambda phage

  • Digestion of lambda DNA with XbaI and XhoI
    • very nice separation of the small fragment from the two large fragments (one band) picture of the gel was not saved but it looked very nice
    • cutting out of the small and large fragment --> gel purification kit
    • small fragment: 30,3 ng/µl; 1,86
    • large fragment1: 19,5 ng/µl; 2,11
    • large fragment2: 61,5ng/µl; 1,90


GFP

  • inoculation of three overnight cultures from the two I20260 glycerol stocks



chloramphenicol resistance cassette

  • Transformation of P1000, P1004 (both chloramphenicol resistances) and CI
    • no success


project planning

Guys, we received this email by another professor in the states. sounds good. we should get this helper plasmids in the end :)

I have sent pUB307, RSF1010, pED350, pED361, which are described in our two MGG papers. Also two clones I made of the oriT from RP1; pED369 and pED374. There are 10microl of each. The DNAs are old (1983!) and so I would transform and make fresh plasmid preps.

pED350 is oriT+ and Mob+, so it is efficiently mobilised by RPI or its derivative pUB307. pED361 is oriT+ only. It cannot be mobilised by pUB307 as it lacks mob functions. If RSF1010 is also in the cell pKD361 is very efficiently mobilised by pUB307.

pED369 and pED374 are two subclones I made of the RP1 oriT into pED825 (Amp resistant described in MGG papers). pED374 contains a single 690 bp HaeII fragment containing the RP1 oriT. PED369 contains the 690 bp oriT fragment plus additional HaeII fragments. I sent both just in case the pED374 DNA does not check out. These are efficiently mobilised by pUB307.

I would think cloning this 690 bp fragment into your lambda vector would be the simplest solution; its small and will mobilise in the presence of just pUB307.

Keith



Wednesday, 08/20/08

GFP

  • Miniprep of reference promotor I20260
    • Concentrations:
      • Epi1 9,8 ng/ul; 2,52
      • Epi2 15,7 ng/ul; 2,28
      • Epi3 19,7 ng/ul; 1,93
  • Digestion of I20260
10 µl DNA (from Epi3)
2ul SmlI
12µl NEB4
2ul BSA 10x
4 µl water
  • Digestion of the XbaI-XhoI fragment with AgeI
18 µl DNA (from gel purification kit)
5 µl AgeI
5 µl NEB4
22 µl water
  • Gel

Hd-phage-08-08-20-digestion.jpg

  • Lane 0: DNA ladder mix
  • Lane 1: I20260 (SmlI-->251bp, 373bp, 843bp, 918bp, 1284bp)
  • Lane 2: XbaI-XhoI fragment (AgeI-->1.7kb, 7.3kb)
  • Lane 3: large lambda DNA fragments 3µl (15kb, 24.5kb)
  • Results:
    • I20260 seems not to be correct, inoculate overnight cultures from the glycerol stocks again
    • digestion of the XbaI-XhoI fragment with AgeI did not work good, only the 7.3kb fragment can be seen, reasons: wrong buffer concentration, too much enzyme (glycerol) in the reaction
    • large lambda DNA fragment is looking good


lambda phage

  • concentrations of lambda-DNA extractions
    • from Fermentas Phage - plaque 1: 7.5 ng/ul; 1.86
    • from Fermentas Phage - plaque 2: 61.5 ng/ul 1.90
    • from ZMBH phage 19,7 ng/ul 2,11


overview of the phage cloning strategy one


Hd-phage-Klonierungsstrategie Page 1.jpg


Hd-phage-Klonierungsstrategie Page 2.jpg





Hd-phage-Klonierungsstrategie Page 3.jpg






Used primer sequences:


oriT_RP4_fw (Tm=62°C):

CTCGTTTCTAGAACTAGTgacaggctcatgccggccgc


oriT_RP4_rv: (Tm=58°C)

TATTCGGGTACCgtcccctcagttcagtaatttcctgc


GFP_CmR_fw: (Tm=56°C)

CTCGTTGGTACCTCTAGAtttacagctagctcagtcctagg


GFP_CmR_rv: (Tm=55°C)

TATTCGACCGGTACTAGTtataaacgcagaaaggcccacc


GAM_fw: (Tm=55°C)

AGTGCTTTAGCGTTAACTTCCG


GAM_rv: (Tm=53°C)

GGTTTTACCGCATACCAATAACG


CmR_fw: (Tm=54°C)

gctaaaATGgagaaaaaaatcactgg


CmR_rv: (Tm=58°C)

AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC

Thursday, 08/21/08

lambda phae

  • Preparative digestion of lambda-DNA from Fermentas
10µl DNA = 3 ug
2µl XhoI
2µl XbaI
5µl NEB 2
5µl BSA
33µl H20
  • lambda DNA "2" and "ZMBH" from phage extraction kit
36 µl DNA
2 µl XhoI
2µl XbaI
5µl NEB 2
5 µl BSA
    • all digestions 3h, 400rpm, 37°
  • Gel

Hd-phage-08-08-21-lambda.jpg

    • lane 0: DNA ladder mix
    • lane 2: lambda DNA (fermentas) (XbaI, XhoI --> ~40 kb, ~9 kb)
    • lane 4: lambda DNA from extraction "2" (XbaI, XhoI --> ~40 kb, ~9 kb)
    • lane 6: lambda DNA from extraction "ZMBH phage" (XbaI, XhoI --> ~40 kb, ~9 kb)
    • lane 2, 4 and 6 overflowed
  • cutting out of the XbaI-XhoI fragment from lane 2
    • the large fragment wasn't cutted out because the gel was exposed to UV light over 30 seconds
    • gel extraction kit
      • DNA eluted in 20µl
  • Digestion of the XbaI-XhoI fragment with AgeI
20µl DNA (from gel purification kit)
2µl AgeI
5µl NEB4
23µl water
    • 16°C over night
  • Preparative digestion of lambda-DNA from Fermentas
10µl DNA = 3 µg
2µl XhoI
2µl XbaI
5µl NEB 2
5µl BSA
33µl water
    • 16°C over night




GFP

  • Miniprep from overnight cultures of I20260 glycerol stocks
    • eluted in 50 µl
    • Concentrations:
      • Miniprep 1: 19.8 ng/µl
      • Miniprep 2: 17.4 ng/µl
      • Miniprep 3: 19.0 ng/µl
      • Miniprep 4: 16.4 ng/µl
  • Analytical digestion of the four I20260 Minipreps
    • 20µl DNA
    • 5µl NEB 4
    • 1.5µl DraI
    • 23.5µl water
  • Gel

Hd-phage-08-08-21-digestion I20260.jpg

      • lane 0: DNA ladder
      • lane 1: I20260 1
      • lane 2: I20260 1 (DraI-->19bp, 535bp, 886bp, 2229bp)
      • lane 3: I20260 2
      • lane 4: I20260 2 (DraI)
      • lane 5: I20260 3
      • lane 6: I20260 3 (DraI)
      • lane 7: I20260 4 (DraI)
    • Results
      • it seems that we have I20260, inoculation of an overnight culture from I2020 No. 3 for Maxiprep
  • Transformation of I20260 (Kan) (from the promotor measurement kit sheet as well as from the registry) and J01101 (Amp)
    • eluted in 10µl water
    • transformed into TOP10 and MG1655 (each 4µl DNA)

cI

  • ordered J01101 (cI) from the iGEM headquater, they will already send it today


Friday, 08/22/08

GFP

  • Maxiprep of reference promotor I20260
    • concentrations: 200 ng/µl


lambda phage

  • Gel: Digestions of lambda-DNA (fermentas), and the small XbaI-XhoI fragments

Hd-phage-08-08-22-digestion.jpg

    • lane 1: DNA ladder mix
    • lane 3: lambda-DNA (XbaI, XhoI; ~ 40kb, ~ 9kb)
    • lane 5: small lambda-fragment assayI (AgeI, ~1,7kb, ~7,3kb)
    • lane 7: small lambda-fragment assayII (AgeI, ~1,7kb, ~7,3kb)
  • Extraction of XbaI-XhoI fragments (evaluation of samples with nanodrop)
    • small fragment 1: 15,9 ng/µl; 2,41
    • small fragment 2: 6,6 ng/µl; 2,02
    • large fragment 1: 14,1 ng/µl; 2,75
    • large fragment 1: 10,8 ng/µl; 2,86
    • large fragment 1: 14,4 ng/µl; 1,99
    • large fragment 1: 16,8 ng/µl; 2,14


<< Week 2 Overview Week 4 >>