"
Team:Brown/Parts
From 2008.igem.org
(Difference between revisions)
(Prototype team page) |
NeilParikh (Talk | contribs) (→Cell Lysis for Everyone!) |
||
| (8 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| - | + | {{BrownTemp}} | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
<!-- *** End of the alert box *** --> | <!-- *** End of the alert box *** --> | ||
| + | =Cell Lysis for Everyone!= | ||
| + | ===BIOBRICKS=== | ||
| + | |||
| + | 1 BBa_K124003 – This part is the DNA received from John Mekalanos’ Lab at Harvard Medical School, pvj4. The sequence, 1273 base pairs in length, codes for three different proteins. These three proteins, commonly known as the S, R, and Rz genes, encode for cell lysis. The three genes packaged together are regularly called the “Cell Lysis Cassette.” The S gene is a holin and the R gene is an endolysin. Little is known about the function of the Rz gene in cell lysis but it is involved in many cell lysis processes. | ||
| + | * Biobrick Primers containing proper Prefix and Suffix: | ||
| + | * Prefix: 5’ atg aaa tca atg gac aaa atc tca act ggc ATG AAA TCA ATG GAC AAA ATC TCA ACT GGC 3' Melting Point = 58 deg C | ||
| + | * Suffix: 5’ GTT TCT TCC TGC AGC GGC CGC TAC TAG TA cta tct gca ctg ctc att aat ata ctt c 3' Melting Point = 56 deg C | ||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | + | 2 BBa_k124014 – Received from Ry Young at Texas A&M. S105 is a mutant of the single S gene in the Cell Lysis Cassette. It’s purpose is to create a hole in the cellular membrane, hence the name “Holin.” This variation of the S gene induces lysis at a faster rate than the Wild Type. The length of time required for complete lysis is much shorter due to the deletion of the antiholin product, S107. The first 6 base pairs of the Wild Type sequence are the N-terminus residues of S107. S105 does not have these first 6 base pairs enabling it to be more efficient at membrane-permeabilizing activity. | |
| - | + | * Biobrick Primers containing proper Prefix and Suffix: | |
| - | + | * Prefix: 5' GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ATGCCAGAAAAACATGACCTGTTGGC 3' Melting Point = 58 deg C | |
| - | + | * Suffix: 5' GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTA TTG ATT TCT ACC ATC TTC TAC TCC GGC 3' Melting Point =59 deg C | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | 3 BBa_K124017 - This part contains the S105 Holin gene as well as the R and Rz genes that complete the lysis cassette. The R and Rz genes are the same sequences as the R and Rz on pVJ4 (part BBa_k124003) received from the John Mekalanos' Lab. We used the Prefix primer of S105 and the Suffix Primer of PVJ4 to Biobrick the part. | |
| - | + | * Biobrick Primers containing proper Prefix and Suffix: | |
| + | * Prefix: 5' GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ATGCCAGAAAAACATGACCTGTTGGC 3'Melting Point = 58 | ||
| + | * Suffix: 5’ GTT TCT TCC TGC AGC GGC CGC TAC TAG TA cta tct gca ctg ctc att aat ata ctt c 3' Melting Point = 56 | ||
Latest revision as of 03:51, 30 October 2008
|
Cell Lysis for Everyone!BIOBRICKS1 BBa_K124003 – This part is the DNA received from John Mekalanos’ Lab at Harvard Medical School, pvj4. The sequence, 1273 base pairs in length, codes for three different proteins. These three proteins, commonly known as the S, R, and Rz genes, encode for cell lysis. The three genes packaged together are regularly called the “Cell Lysis Cassette.” The S gene is a holin and the R gene is an endolysin. Little is known about the function of the Rz gene in cell lysis but it is involved in many cell lysis processes.
|
