Team:LCG-UNAM-Mexico/Notebook/2008-June

June's summary:--- ---- - --- ---

Session with our advisor Miguel A.

• changes in pH due to colorimetry or electrodes, choose the electrodes wisely.
• Nickel transporter in E.coli. * if they send the mutated strain: Transcriptional merger with the trp operon; induce the repressor off.
• Introducing the gene into a multicopy plasmid and select controls (-) and (+)
• Coli introduces at least 40% less zinc when it has the gene. While the flow is still measurable there is no problem.
• An electrode is not really necessary, this can be done with conventional methods.

Research: Efflux pumps of metals.

(It must be ionized, maybe a simple salt, the anion doesn't matter).

Team work:

• Cobalt - Mariana
• Zinc - Jimena
• Cadmium - Chicken
• Nickel - Libertad
• Iron - Atahualpa
• TeO3 (+2) - Isaac
• Cu (2 +) - Minerva
• CrO4 (2 -) - Daniela
• AsO4 (3 -) - Enrique
• Hg - Carlos
• Pb - Martin

* Primer design

-- Documents / E.coli pumps

-- Vectors we could use:

prk404 y7o prk415 resistant to tratracicline, maybe 4 - 9 copies.
pbbr1mcs5 resistant kentamicine up to 10 copies.
puc up to 20 copies resistant to ampicillin.
pjet, resistant to ampicillin up to 600 copies.
REMEMBER not to combine the vector with the same replication origin.
Plbb: clorma resistant, up to 12 copies with LacI in cis (it can be controlled with IPTG)

• Choosing the most suitable gene and designing primers.

Tm = (2 (A + T)) + (4 * (C + G))

• Choose the single cut site!
• Compatibility of restriction sites.
• Read more to start writing.

Expositions: Choosing the bomb! (efflux pump)

Nickel and cobalt
• Very specific
• We don't know how to get the Co inside the cell.
• We can leave the natural entrance, regulating the output.
• All this in E. coli.
• Co is very toxic, it can hurt many things ... We better use Nickel only.
• We have two pumps we can test.
• It can hold up to 2 minimolar of Ni.
• It has more than one system to get Ni in.
• Help getting out Ni, RcnA & RcnR (~200 & 300 aa).
• Pending: How Co enters and the mechanism to get Ni in.

Zinc
• Getting in ZnuABC, Zupt, ZntB. Getting out ZntA and ZitB.
• The ones that get them in are not specific for Zn (they also work for other metals), except ZnuABC.
• Regulated by Zurt joining Zn.
• To draw: ZntA only works at high concentrations, but is not specific to Zn; also, ZitB is not specific, it only operates at low concentrations.
• Problem: It is very small... it is difficult to regulate their extrusion.
• It is essential.

Cadmium
• Its entry is a transportation system of divalent ions, it is cotransported with Manganese, which is essential for the cell, so the entry would not be regulated.
• It is toxic to the cell, but it seems that nothing too serious.
• The output can be mediated by multiple systems, all present in E. coli (CzcD, CzcCBA, CadA, ...).
• Legatzki et al. (2003) make an experiment in which they use a mutant of E coli GG48 ((delta) zntA & (delta) zitB) that accumulates both Zn as Cd, but when they transform it with a plasmid with zntA & cadA of R. metallidurans, it recover resistance quite well. It is true that we will not regulate all systems involved, but according to their experiment, change is quite significant. It could be useful.
• Genes are large, up to ~800aa.
• Pending: What concentration can the cell hold?

Iron
• There are many ways to get iron. Through siderophores!
• Problem: On entering the cell, it forms a complex with an overall regulator (fur) involved in many important functions. Essential.
• The pump is ok, unique and the only way to remove the iron. About ~ 920kb, Fief.

Tellurium
• Not so much an extrusion pump, because there is a transformation by means of an enzyme, which is not well known.
• All resistance genes are in two plasmids.
• Admission is a potential difference of ions in membranes.
• It is not necessary, toxic.
• We can not regulate the entry and when the Tellurium enters, unless there is resistance, the cell dies immediately.
• The role of the genes involved in resistance is not well understood.

Copper
• When it enters, it is reduced from 2+ to +, because the extrusion systems only recognize this.
• Hold up to 3.5 miniMolar inside the cell.
• CusCFAB operon is responsible for extrusion regulated transcriptionally by cusRS. There is probably a biopart. Known in E. coli.
• CusRS ~1000 aa. Cus CFAB ~2000aa.
• Problem: It's size! --> Bioparts
• Admission is ATPase dependent... by bombs? Described in yeast and animals, it is known that it enters to E. coli, but how can we regulate it in E. coli?
• It is not essential, it is highly toxic.
• Pending: The entry?

Arsenic
• It is in a plasmid in E. coli. Five genes (Ars [RABCD] ~ 1.4Kb), the plasmid is in total ~ 4.4kb. Some genes on chromosome are also involved; they are not necessary, but reduced from 10 to 100 times the resistance if they are absent.
• Do they have a translational control?
• The pump works with ATP.
• The entry is not specific, active transport.
• Toxic.
• This is the most studied bomb.
• This operon is cloned into a vector.
• Pending: What concentration can it hold?

Mercury
• Free admission... and three carrier assets are known.
• It is highly toxic, but it is not drawn as such, because it is reduced... So there is no nice way to remove it.
• It is not a well-known system of entry.
• The pumps are quite specific.
• Also toxic to the cells environment, that's why the cell eats it, for processing...
• Pending: Getting it out?

Lead
• It enters together with manganese, Zn or Co.
• It is highly toxic to E. coli because it affects membranes.
• Calcium pumps that can help it get in were found, but they are animals...
• To remove it, it uses the Cd systems, there are no specific system.
• Pending: Finding a target, Concentration that endures?

Not useful
• Iron
• Lead
• Mercury
• Tellurium

More or less
• Zinc -> Against: It is essential.
• Copper -> Against: It is very big.

Favourites
• Cobalt & Nickel
• Cadmium
• arsenic

Project Design

Experimental

Pump we will use: Nickel.

Articles:

-- Complex Transcriptional Control Links NikABCDE-HYDROGEN with Dependent Nickel Transport Expression in E. coli (2005).
-- Nickel homeostasis in Escherichia coli - the rcnR-rcnA efflux pathway and its linkage to NikR function (2006).
-- Identification of rcnA (yohM), Nickel and Cobalt Resistance Gene in Escherichia coli (2005).

Pending:

-- Check bioparts.
-- Design vectors.
-- Design primers.
-- Strain with deletion of rcnA.

Tentative design:

• The mechanism of entry of Nickel will remain wildtype.
• In the absence of Nickel, RcnR (whose gene will remain in the plasmid with its normal regulation) will repress rcnA (which will be deleted from chromosome and put into a plasmid).
• By putting (*) we will repress transcription of rcnA, even in the presence of Nickel, so this will be will be our signal to retain the metal in the cell and modify the concentration of the medium (if it is not enough to turn off the pump, it will be necessary to find a new level of regulation).
• How will we turn off the signal (*)?

* we don't know what can the (*) be.

Task: Find (*)!

Modeling

Pending:

-- Responding vs. Concentration (experimental part).
-- Set thresholds & limitations.
-- Efficiency of interactions?
-- Defining variables:
> Metal concentration.
> Repressor concentration.
> (*) concentration.

Final design

Scheme

The first plasmid contains the efflux pump for Nickel (rcnA), which will maintain its natural regulation dependent of metal (by RcnR) and additionally, it will contain a promoter regulated by the repressor of lambda phage, cI. Besides, of course, a resistance as a marker of the plasmid.

   The second contains everything needed for regulating the power down from an external signal (AHL). Both luxR as aiiA will occur constitutively, the first one, with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting, and the second one, having a moderate promoter or weak (pLacZ), to give us space to play with concentrations of AHL without aiiA always wining. And cI *, cI modified with a queue of LVA for rapid degradation, regulated by a promoter dependent of LuxR + AHL. It will also contain an equal resistance as a marker.

   In the presence of AHL, this joins with LuxR and induces the production of cI *, which in turn represses the transcription of rcnA. Like cI *, signal AHL has to be short-lived since aiiA is degradating constantly, so the system quickly returns to its initial state once it ceases to manage AHL.

Parts

Defining bioparts we will use or where to get what is necessary.

Part: BBa_I729006

Part of Quorum sensing used by the team Chiba in iGEM2007. Both tetR and LacI + pL are constitutive promoters, but since LacI + pL is a very strong promoter, it will probably be replaced. This biopart will be responsible for the regulation by luxR and the action of the system by AHL. Instead of GFP (Subpart E0040), the BBa_C0051 part that codes for the protein cI + LVA will be inserted, which will join the regulatory region of cI (biopart BBa_R0051) in the other plasmid.

(Previous experience: none)

Part:BBa_C0051

Region coding for the repressor cI based on the repressor cI of lambda phage with modified LVA with a queue for rapid degradation. cI joins the regulator cI (BBa_R0051)

(Previous experience: none)

Part:BBa_R0051

Promoter regulated by cI based on the pR promoter of lambda phage. The promoter has two binding sites to cI repressor of lambda phage (BBa_C0051). The union of cI results in the suppression of the transcript.

(Previous experience: it works)

Of the previous 3 bioparts, the sequence is in the registration of biological parts and according to this page, DNA is available.

Part: BBa_G00510

This is the forward primer of C0051 that has 24 pb.
(No DNA in the bank, but we know that it works)
gatttctgcatagccagacttggg

Part: BBa_G00511

Reverse primer for C0051 that has 26 pb.
cactgactagcgataactttccccac
(No DNA in the bank but we know that it works)

Vectors

We need to define the vectors we can use.

Possibilities:
*The ones recorded in the spreadsheet (courses).

In bioparts:

Primers

Build or find oligos that we could use for our constructions.

We need:
• rcnA (with its regulatory region; no promoter).
• cI *.
• Constitutive promoter for luxR (tetR is proposed, it is a strong promoter).
• Constitutive promoter for aiiA (lacZ is proposed, it is a moderate promoter).
• aiiA.
• Promoter dependent of cI.
~ In all cases, we have to check whether they already exist (in biopartes or something) and evaluate them.

Promoters

Investigate a little more about the proposed promoters and define whether they are the most optimal.

Facts about kinetics & other things...

Investigate a little more about the parties involved in the system to begin with an outline of modeling and defining how the design is theoretically feasible.

Note: To join HSLwith LuxR and enable the transcription of cI, HLS should be at a concentration of micromolar order.
Note (2): Not all bioparts have been used previously, most DNA is available but still there is no record of it working. We need to check the quality of DNA to ensure that there will be no problems.

June 24th(summary)- -- -- -- -- -- -- -- - ------ -----. --- ------ --- ---- -- --- ----- -- -- -- ------ ---- ---- - -- - ---- - ----- ---- ---, - ----- --- ----- ---- ---- ---- -- --- --- --- --- -- ---- ---------- - ------ ---- --- ---- ----- --- --- ----- ---- ----- ------ ---- -- -- --- ------- - ----- --- ---- --- --- -- - ------ -- ---- --- --- --- -- -- ----- ---, --- - - --- -- -- -- -- -- -- -- - ------ -----. --- ------ --- ---- -- --- ----- -- -- -- ------ ---- ---- - -- - ---- - ----- ---- ---, - ----- --- ----- ---- ---- ---- -- --- --- --- --- -- ---- ---------- - ------ ---- --- ---- ----- --- --- ----- ---- ----- ------ ---- -- -- --- ------- - ----- --- ----.

June 26th(summary)- -- -- -- -- -- -- -- - ------ -----. --- ------ --- ---- -- --- ----- -- -- -- ------ ---- ---- - -- - ---- - ----- ---- ---, - ----- --- ----- ---- ---- ---- -- --- --- --- --- -- ---- ---------- - ------ ---- --- ---- ----- --- --- ----- ---- ----- ------ ---- -- -- --- ------- - ----- --- ---- --- --- -- - ------ -- ---- --- --- --- -- -- ----- ---, --- - - --- -- -- -- -- -- -- -- - ------ -----. --- ------ --- ---- -- --- ----- -- -- -- ------ ---- ---- - -- - ---- - ----- ---- ---, - ----- --- ----- ---- ---- ---- -- --- --- --- --- -- ---- ---------- - ------ ---- --- ---- ----- --- --- ----- ---- ----- ------ ---- -- -- --- ------- - ----- --- ----.