Team:Heidelberg/Notebook/Killing I/Notebook/week3

From 2008.igem.org

(Difference between revisions)

Latest revision as of 11:34, 29 October 2008

<< Week 2	Overview	Week 4 >>

Week 3

Monday, 08/18/08

chloramphenicol resistance cassette

Maxiprep of P1000, P1004, B0014, B0015
- P1000 1672 ng/µl 1,92
- P1004 1153 ng/µl 1,92
- B0014 2040,4 ng/µl 1,92
- B0015 1053,6 ng/µl 1,92

Analytical digestions
- lambda DNA with XbaI and XhoI

2µl DNA
5µl NEB2
5µl BSA
1µl XbaI
1µl XhoI
26µl water

- Analytical digestion of P1000

1µl DNA
2µl NEB3
2µl NcoI
15µl water

- Analytical digestion of P1004

1µl DNA
2µl NEB4
1,5µl DraI
15,5µl water

- Analytical digestion of B0014 / B0015

1µl DNA
2µl NEB4
2µl BSA
2,5µl SfcI
12,5µl water

- Analytical digestion of cI "green", cI "black" and T9002

Gel

- Lane 0: DNA ladder mix
- Lane 1: lambda DNA
- Lane 2: lambda DNA (XbaI, XhoI --> large frament ~ 40kb, small fragment ~ 9kb)
- Lane 3: P1000
- Lane 4: P1000 (NcoI-->1473,2374)
- Lane 5: P1004
- Lane 6: P1004 (DraI-->19,339,692,1067,1360)
- Lane 7: cI green
- Lane 8: cI green (NdeI - expected fragments?)
- Lane 9: cI black
- Lane 10: cI black (NdeI)
- Lane 11: T9002
- Lane 12: T9002 (NdeI - expected fragments?)

lamda phage

Infectiontest

inoculation of 20ml medium with over night culture (MG1655)
after 1h plaque added --> 37C for 2h + inoculation of ZMBH phage (100ql 10^-2 in 20ml MG1655)
incubation at 42C for 2 more hours
sterilefiltration + mix with growing bacteria (MG1655 and MG1655+cI)
incubate in soft agar at 37C for 2h, than at 42C for another 4h (altogether 24 plates)
phage DNA was also isolated from filtrate
results:
- same amount of plaques on plates with MG1655 as with MG1655+cI
- nearly no plaques on plates with own phage --> very low phage concentration
- --> cI does not work!!!!
growing curve

- the values are the average of all four cultures

Tuesday, 08/19/08

lambda phage

Digestion of lambda DNA with XbaI and XhoI
- very nice separation of the small fragment from the two large fragments (one band) picture of the gel was not saved but it looked very nice
- cutting out of the small and large fragment --> gel purification kit
- small fragment: 30,3 ng/µl; 1,86
- large fragment1: 19,5 ng/µl; 2,11
- large fragment2: 61,5ng/µl; 1,90

GFP

inoculation of three overnight cultures from the two I20260 glycerol stocks

chloramphenicol resistance cassette

Transformation of P1000, P1004 (both chloramphenicol resistances) and CI
- no success

project planning

Guys, we received this email by another professor in the states. sounds good. we should get this helper plasmids in the end :)

I have sent pUB307, RSF1010, pED350, pED361, which are described in our two MGG papers. Also two clones I made of the oriT from RP1; pED369 and pED374. There are 10microl of each. The DNAs are old (1983!) and so I would transform and make fresh plasmid preps.

pED350 is oriT+ and Mob+, so it is efficiently mobilised by RPI or its derivative pUB307. pED361 is oriT+ only. It cannot be mobilised by pUB307 as it lacks mob functions. If RSF1010 is also in the cell pKD361 is very efficiently mobilised by pUB307.

pED369 and pED374 are two subclones I made of the RP1 oriT into pED825 (Amp resistant described in MGG papers). pED374 contains a single 690 bp HaeII fragment containing the RP1 oriT. PED369 contains the 690 bp oriT fragment plus additional HaeII fragments. I sent both just in case the pED374 DNA does not check out. These are efficiently mobilised by pUB307.

I would think cloning this 690 bp fragment into your lambda vector would be the simplest solution; its small and will mobilise in the presence of just pUB307.

Keith

Wednesday, 08/20/08

GFP

Miniprep of reference promotor I20260
- Concentrations:
  - Epi1 9,8 ng/ul; 2,52
  - Epi2 15,7 ng/ul; 2,28
  - Epi3 19,7 ng/ul; 1,93

Digestion of I20260

10 µl DNA (from Epi3)
2ul SmlI
12µl NEB4
2ul BSA 10x
4 µl water

Digestion of the XbaI-XhoI fragment with AgeI

18 µl DNA (from gel purification kit)
5 µl AgeI
5 µl NEB4
22 µl water

Gel

Lane 0: DNA ladder mix
Lane 1: I20260 (SmlI-->251bp, 373bp, 843bp, 918bp, 1284bp)
Lane 2: XbaI-XhoI fragment (AgeI-->1.7kb, 7.3kb)
Lane 3: large lambda DNA fragments 3µl (15kb, 24.5kb)

Results:
- I20260 seems not to be correct, inoculate overnight cultures from the glycerol stocks again
- digestion of the XbaI-XhoI fragment with AgeI did not work good, only the 7.3kb fragment can be seen, reasons: wrong buffer concentration, too much enzyme (glycerol) in the reaction
- large lambda DNA fragment is looking good

lambda phage

concentrations of lambda-DNA extractions
- from Fermentas Phage - plaque 1: 7.5 ng/ul; 1.86
- from Fermentas Phage - plaque 2: 61.5 ng/ul 1.90
- from ZMBH phage 19,7 ng/ul 2,11

overview of the phage cloning strategy one

Used primer sequences:

oriT_RP4_fw (Tm=62°C):

CTCGTTTCTAGAACTAGTgacaggctcatgccggccgc

oriT_RP4_rv: (Tm=58°C)

TATTCGGGTACCgtcccctcagttcagtaatttcctgc

GFP_CmR_fw: (Tm=56°C)

CTCGTTGGTACCTCTAGAtttacagctagctcagtcctagg

GFP_CmR_rv: (Tm=55°C)

TATTCGACCGGTACTAGTtataaacgcagaaaggcccacc

GAM_fw: (Tm=55°C)

AGTGCTTTAGCGTTAACTTCCG

GAM_rv: (Tm=53°C)

GGTTTTACCGCATACCAATAACG

CmR_fw: (Tm=54°C)

gctaaaATGgagaaaaaaatcactgg

CmR_rv: (Tm=58°C)

AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC

Thursday, 08/21/08

lambda phae

Preparative digestion of lambda-DNA from Fermentas

10µl DNA = 3 ug
2µl XhoI
2µl XbaI
5µl NEB 2
5µl BSA
33µl H20

lambda DNA "2" and "ZMBH" from phage extraction kit

36 µl DNA
2 µl XhoI
2µl XbaI
5µl NEB 2
5 µl BSA

- all digestions 3h, 400rpm, 37°

Gel

- lane 0: DNA ladder mix
- lane 2: lambda DNA (fermentas) (XbaI, XhoI --> ~40 kb, ~9 kb)
- lane 4: lambda DNA from extraction "2" (XbaI, XhoI --> ~40 kb, ~9 kb)
- lane 6: lambda DNA from extraction "ZMBH phage" (XbaI, XhoI --> ~40 kb, ~9 kb)
- lane 2, 4 and 6 overflowed
cutting out of the XbaI-XhoI fragment from lane 2
- the large fragment wasn't cutted out because the gel was exposed to UV light over 30 seconds
- gel extraction kit
  - DNA eluted in 20µl

Digestion of the XbaI-XhoI fragment with AgeI

20µl DNA (from gel purification kit)
2µl AgeI
5µl NEB4
23µl water

- 16°C over night

Preparative digestion of lambda-DNA from Fermentas

10µl DNA = 3 µg
2µl XhoI
2µl XbaI
5µl NEB 2
5µl BSA
33µl water

- 16°C over night

GFP

Miniprep from overnight cultures of I20260 glycerol stocks
- eluted in 50 µl
- Concentrations:
  - Miniprep 1: 19.8 ng/µl
  - Miniprep 2: 17.4 ng/µl
  - Miniprep 3: 19.0 ng/µl
  - Miniprep 4: 16.4 ng/µl

Analytical digestion of the four I20260 Minipreps
- 20µl DNA
- 5µl NEB 4
- 1.5µl DraI
- 23.5µl water

Gel

- - lane 0: DNA ladder
  - lane 1: I20260 1
  - lane 2: I20260 1 (DraI-->19bp, 535bp, 886bp, 2229bp)
  - lane 3: I20260 2
  - lane 4: I20260 2 (DraI)
  - lane 5: I20260 3
  - lane 6: I20260 3 (DraI)
  - lane 7: I20260 4 (DraI)

- Results
  - it seems that we have I20260, inoculation of an overnight culture from I2020 No. 3 for Maxiprep

Transformation of I20260 (Kan) (from the promotor measurement kit sheet as well as from the registry) and J01101 (Amp)
- eluted in 10µl water
- transformed into TOP10 and MG1655 (each 4µl DNA)

cI

ordered J01101 (cI) from the iGEM headquater, they will already send it today

Friday, 08/22/08

GFP

Maxiprep of reference promotor I20260
- concentrations: 200 ng/µl

lambda phage

Gel: Digestions of lambda-DNA (fermentas), and the small XbaI-XhoI fragments

- lane 1: DNA ladder mix
- lane 3: lambda-DNA (XbaI, XhoI; ~ 40kb, ~ 9kb)
- lane 5: small lambda-fragment assayI (AgeI, ~1,7kb, ~7,3kb)
- lane 7: small lambda-fragment assayII (AgeI, ~1,7kb, ~7,3kb)

Extraction of XbaI-XhoI fragments (evaluation of samples with nanodrop)
- small fragment 1: 15,9 ng/µl; 2,41
- small fragment 2: 6,6 ng/µl; 2,02
- large fragment 1: 14,1 ng/µl; 2,75
- large fragment 1: 10,8 ng/µl; 2,86
- large fragment 1: 14,4 ng/µl; 1,99
- large fragment 1: 16,8 ng/µl; 2,14

<< Week 2	Overview	Week 4 >>

@@ Line 1: / Line 1: @@
 <html>
-<link rel='stylesheet' href='http://igem-heidelberg.de/fileadmin/Wiki/Heidelberg2.css' type='text/css' />
-<link rel="stylesheet" href="http://igem-heidelberg.de/fileadmin/Wiki/Menu.css" type="text/css"/>
-<link rel="stylesheet"  href="http://igem-heidelberg.de/fileadmin/Wiki/MenuHD.css" type="text/css"/>
+<style>
+h1.firstHeading { display: none; }
+p {text-align: justify;}
+a:link { color: #00b0e6; text-decoration: none}
+a:visited { color:#00b0e6; text-decoration: none}
+a:hover { color:#f29400; text-decoration: none}
+a:active { color:#f29400; text-decoration: none}
+#bodyContent { padding: 10px auto; width: 910px; margin: auto; clear: none; }
+table#team_members { text-align: justify; border: 0; }
+table#team_members h2, table#team_members h3 { clear: both; }
+/*-----------------------------------------------------------------------------------------------*/
+div.MenuBar ul li ul.DropDownMenu {
+  display: none; /* Hides all drop-down menus. */
+}
+/*
+li:hover works in IE7 and FF2.
+a:hover works in IE6 and FF2.
+a:hover breaks li:hover in FF2.
+*/
+div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu {
+  display: none; /* Hides all side menus. */
+}
+/*------------------------------------------------------------------------------------- Menu Bar */
+div.MenuBar {
+  font: arial, helvetica, sans-serif;
+  height: 30px;
+  width: 910px;
+  /*width: 100%*/
+  margin: 0;
+  border-top: 0;
+  border-right: 0;
+  border-left: 0;
+  padding: 0;
+  background: black;
+}
+div.MenuBar ul {
+  font: arial, helvetica, sans-serif;
+  text-align: center;
+  list-style-type: none;
+  margin: 0.5em auto;
+  border: 0;
+  padding: 0;
+  background: black;
+}
+div.MenuBar ul li {
+  font: arial, helvetica, sans-serif;
+  display: block;
+  padding: 0;
+  margin: 0;
+  font-size: 1.3em;
+  float: left;
+  background: black;
+  text-align: center;
+  width: 107px;
+  position: relative; /* Sets the positioning context for each drop-down menu. */
+}
+div.MenuBar ul li a {
+  font: arial, helvetica, sans-serif;
+  display: block;
+  background: black;
+  height: 22px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */
+  color: #ffffff;
+  padding-top: 4px;
+  padding-bottom: 4px;
+  padding-left: 1em; /* Sets the left space between top-level items. */
+  padding-right: 1em; /* Sets the right space between top-level items. */
+  text-decoration: none;
+}
+/*------------------------------------------------------------------------------ Drop-Down Menus */
+div.MenuBar ul li:hover ul.DropDownMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu {
+  display: block;
+  width: 10em; /* Drop-down menu width.
+                  Use MenuTailor.css to customize. */
+  height: 1em;
+  padding: 1px; /* Sets the drop-down menu "effective border" width. */
+  position: absolute;
+  top: 23px; /* Places the drop-down menu under the menu bar.
+                Keep it sync with the menu bar height. */
+  left: 0; /* Aligns the drop-down menu to its top-level item. */
+  background-color: black; /* Selected item. */
+  color: #FFFFFF;
+}
+div.MenuBar ul li:hover ul.DropDownMenu li a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a {
+  width: 10em; /* Keep it sync with the drop-down menu width.
+                             Use MenuTailor.css to customize. */
+  height: 1em;
+  padding-left: 0;
+  padding-right: 0;
+  background-color: black; /* Selected item. */
+  color: #FFFFFF;
+}
+ul.DropDownMenu li a span {
+  display: block;
+  padding-left: 0.75em; /* Sets the left space of each drop-down menu item. */
+  padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */
+  text-align: right; /* Aligns the >> symbol to the right. */
+}
+ul.DropDownMenu li a span span {
+  float: left; /* Aligns the text (back) to the left. */
+  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+  height: 20px;
+  color: #FFFFFF;
+}
+/*----------------------------------------------------------------------------------- Side Menus */
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+  display: block;
+  width: 11em; /* Side menu width.
+                  Use MenuTailor.css to customize. */
+  padding: 1px; /* Sets the side menu "effective border" width. */
+  position: absolute;
+  top: -1px; /* Aligns the side menu to its drop-down menu item.
+                Keep it sync with the side menu "effective border" width. */
+  left: 13em; /* Places the side menu to the right of the drop-down menu.
+                            Keep it sync with the drop-down menu width.
+                            Use MenuTailor.css to customize. */
+}
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+  width: 11em; /* Keep it sync with the side menu width.
+                             Use MenuTailor.css to customize. */
+  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+  left: 13em; /* Places the side menu to the right of the drop-down menu.
+                            Keep it sync with the drop-down menu width.
+                            Use MenuTailor.css to customize. */
+}
+div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span {
+  padding-left: 1.5em; /* Sets the left space of each side menu item. */
+  padding-right: 0.5em; /* Sets the right space of each side menu item. */
+  text-align: left;
+  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+  left: 13em; /* Places the side menu to the right of the drop-down menu.
+                            Keep it sync with the drop-down menu width.
+                            Use MenuTailor.css to customize. */
+}
+/*----------------------------------------------------------------------------- Browser Specific */
+* html div.MenuBar ul li a {
+  float: left; /* Required for IE55 and IE6.
+                             Breaks O9.
+                             Hidden (* html) from non-IE browsers. */
+}
+* html ul.DropDownMenu li a:hover {
+  cursor: hand; /* Required for IE55.
+                   Hidden (* html) from non-IE browsers. */
+}
+ul.DropDownMenu li a:hover {
+  cursor: pointer; /* Required for IE6 and IE7.
+                      Hidding it (* html) from non-IE browsers breaks IE7!
+}
+* html div.MenuBar a:hover {
+  text-decoration: none; /* Required for IE55 and IE6.
+                            Hidden (* html) from non-IE browsers. */
+}
+* html div.MenuBar ul li table,
+* html div.MenuBar ul li table td {
+  border: 0; /* Required for IE55 and IE6.
+                Hidden (* html) from non-IE browsers. */
+}
+/*------------------------------------------------------------------------------- Default Colors */
+div.MenuBar {
+  background-color: Menu;
+  border-bottom: 1px solid ButtonShadow;
+}
+div.MenuBar a {
+  background-color: Menu; /* Top-level unselected items. */
+  color: MenuText;
+}
+div.MenuBar ul li:hover a,
+div.MenuBar ul li a:hover {
+  color: #ea7f16;
+  background-color: Highlight; /* Top-level selected item. */
+  color: HighlightText;
+}
+/*...............................................................................................*/
+div.MenuBar ul li:hover ul.DropDownMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu {
+  background-color: ButtonShadow; /* Sets the drop-down menu "effective border" color. */
+}
+div.MenuBar ul li:hover ul.DropDownMenu li a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a {
+  background-color: Menu;  Drop-down menu unselected items.
+                             Sets the drop-down menu "effective background" color. */
+  color: MenuText;
+}
+div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover {
+  background-color: Highlight; /* Drop-down menu selected item. */
+  color: HighlightText;
+}
+/*...............................................................................................*/
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+  background-color: ButtonShadow; /* Sets the side menu "effective border" color. */
+}
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+  background-color: Menu; /* Side menu unselected items.
+                             Sets the side menu "effective background" color. */
+  color: MenuText;
+}
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
+  background-color: Highlight; /* Side menu selected item. */
+  color: HighlightText;
+}
+/*-----------------------------------------------------------------------------------------------*/
+/*Script-Free 3-Level Menu 1.2 Tailor
+  www.CesarDaniel.info
+/*-------------------------------------------------------------------------------------- General */
+body {
+  background: white;
+  color: black;
+  margin: 0;
+  border: 0;
+  padding: 0;
+}
+div.MenuBar {
+  font: 13px arial, helvetica, sans-serif;
+}
+div.MenuBar ul {
+  font: 13px arial, helvetica, sans-serif; /* Required for IE55. */
+}
+/*--------------------------------------------------------------------------------------- Colors */
+div.MenuBar {
+  background-color: black; /* Selected item. */
+  color: #FFFFFF;
+  border-bottom: 1px solid ButtonShadow;
+}
+div.MenuBar a,
+div.MenuBar ul li:hover ul.DropDownMenu li a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a,
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+  background-color: black; /* Selected item. */
+  color: #FFFFFF;
+}
+div.MenuBar ul li:hover a,
+div.MenuBar ul li a:hover,
+div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover,
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
+  background-color: #00b0e6; /* Selected item. */
+  color: #FFFFFF;
+}
+div.MenuBar ul li:hover ul.DropDownMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu,
+div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+  background-color: ButtonShadow; /* Sets the drop-down and side menus "effective border" color. */
+}
+/*--------------------------------------------------------------------------------------- Widths */
+/*
+/*
+Menu Bar 1
+Drop-Down Menu #2
+*/
+div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4,
+div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a {
+  width: 11em; /* Drop-down menu width. */
+}
+div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5,
+div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a {
+  width: 12em; /* Drop-down menu width. */
+}
+/*...............................................................................................*/
+/*
+Menu Bar 1
+Drop-Down Menu #2
+Side Menu #1
+*/
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 {
+  left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
+                            Keep it sync with the drop-down menu width. */
+}
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1,
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a {
+  width: 10em; /* Side menu width. */
+}
+/*...............................................................................................*/
+/*
+Menu Bar 1
+Drop-Down Menu #2
+Side Menu #2
+*/
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 {
+  left: 15.5em  !important; /* Places the side menu to the right of the drop-down menu.
+                            Keep it sync with the drop-down menu width. */
+}
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2,
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a {
+  width: 10em; /* Side menu width. */
+}
+/*...............................................................................................*/
+/*
+Menu Bar 1
+Drop-Down Menu #2
+Side Menu #3
+*/
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 {
+  left: 15.5em  !important; /* Places the side menu to the right of the drop-down menu.
+                            Keep it sync with the drop-down menu width. */
+}
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3,
+div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a,
+div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a {
+  width: 10em; /* Side menu width. */
+}
+/*...............................................................................................*/
+</style>
 <body>
@@ Line 52: / Line 393: @@
 		</li>
 		<li>
-			<a href="https://2008.igem.org/Team:Heidelberg/Chemotaxis" style="color: white">Modeling<!--[if gt IE 6]><!--></a><!--<![endif]-->
+			<a href="https://2008.igem.org/Team:Heidelberg/Modeling" style="color: white">Modeling<!--[if gt IE 6]><!--></a><!--<![endif]-->
 			<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
 				<ul class="DropDownMenu" id="MB1-DDM3">
@@ Line 62: / Line 403: @@
 		</li>
 		<li>
-			<a href="https://2008.igem.org/Team:Heidelberg/Notebook/Sensing_Group/Notebook" style="color: white">Notebook<!--[if gt IE 6]><!--></a><!--<![endif]-->
+			<a href="https://2008.igem.org/Team:Heidelberg/Notebook/Overview" style="color: white">Notebook<!--[if gt IE 6]><!--></a><!--<![endif]-->
 			<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
 				<ul class="DropDownMenu" id="MB1-DDM5">
@@ Line 98: / Line 439: @@
 		</li>
 		<li style="width: 160px">
-			<a href="https://2008.igem.org/Team:Heidelberg/Project/General_information" style="color: white">Human Practice<!--[if gt IE 6]><!--></a><!--<![endif]-->
+			<a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Project_Overview" style="color: white">Human Practice<!--[if gt IE 6]><!--></a><!--<![endif]-->
 			<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
 				<ul class="DropDownMenu" id="MB1-DDM4">
@@ Line 106: / Line 447: @@
                                 <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Surveys"><span><span>Surveys</span></span></a></li>
                                 <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Open_Day"><span><span>Open Day</span></span></a></li>
                                 <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Nobel_Prize"><span><span>Nobel Prize</span></span></a></li>
 				</ul>
 				<!--[if lte IE 6]></td></tr></table></a><![endif]-->
@@ Line 121: / Line 463: @@
 </html>
+{| class="wikitable"
+|- bgcolor=white
+! height=20px, width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week2|<< Week 2]]|| width=500px | [[Team:Heidelberg/Notebook/Killing_I/Notebook|Overview]]|| width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week4| Week 4 >> ]]
+|-style="height:20px"
+|}
-[[Team:Heidelberg/Notebook/Killing_I/Notebook|Back to the overview]]
+'''Week 3'''
 ==Monday, 08/18/08==
@@ Line 287: / Line 634: @@
-===overview of the first phage cloning strategy===
+===overview of the phage cloning strategy one===
 <br>
 [[Image:Hd-phage-Klonierungsstrategie_Page_1.jpg]]
@@ Line 339: / Line 686: @@
 AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC
 ==Thursday, 08/21/08==
@@ Line 458: / Line 800: @@
 ** large fragment 1: 14,4 ng/µl; 1,99
 ** large fragment 1: 16,8 ng/µl; 2,14
+{| class="wikitable"
+|- bgcolor=white
+! height=20px, width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week2|<< Week 2]]|| width=500px | [[Team:Heidelberg/Notebook/Killing_I/Notebook|Overview]]|| width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week4| Week 4 >> ]]
+|-style="height:20px"
+|}

Team:Heidelberg/Notebook/Killing I/Notebook/week3

From 2008.igem.org

Latest revision as of 11:34, 29 October 2008

Contents

Monday, 08/18/08

chloramphenicol resistance cassette

lamda phage

Tuesday, 08/19/08

lambda phage

GFP

chloramphenicol resistance cassette

project planning

Wednesday, 08/20/08

GFP

lambda phage

overview of the phage cloning strategy one

Thursday, 08/21/08

lambda phae

GFP

cI

Friday, 08/22/08

GFP

lambda phage