"
Minnesota/30 June 2008
From 2008.igem.org
(Difference between revisions)
| (13 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| + | {|style="align:left" width="965" | ||
| + | |- | ||
| + | |'''[[Team:Minnesota/NotebookComparator| Back to Notebook Home]]''' | ||
| + | |- | ||
| + | |'''[[Minnesota/27 June 2008|Go to Previous Day (June 27)]]'''|| width=158|'''[[Minnesota/1 July 2008|Go to Next Day (July 1)]]''' | ||
| + | |} | ||
{| | {| | ||
| Line 38: | Line 44: | ||
|b. '''Suggestions for the Upcoming Week:''' Once we have received the DB3.1 E.coli strain from Invitrogen we will be able to transform the three BioBrick base vectors which we are interested in using. After transforming, sequencing will confirm the presence of our desired DNA. Send design/construct to Yiannis and he will email rest of team, meet with Jon so can discuss how machinery works, Yiannis suggests that need to begin synbioSS and start simulating immediately - he wants to see excel spreads or plots from synbioSS (simulate by next Monday), when do the simulations will find delays and issues | |b. '''Suggestions for the Upcoming Week:''' Once we have received the DB3.1 E.coli strain from Invitrogen we will be able to transform the three BioBrick base vectors which we are interested in using. After transforming, sequencing will confirm the presence of our desired DNA. Send design/construct to Yiannis and he will email rest of team, meet with Jon so can discuss how machinery works, Yiannis suggests that need to begin synbioSS and start simulating immediately - he wants to see excel spreads or plots from synbioSS (simulate by next Monday), when do the simulations will find delays and issues | ||
|} | |} | ||
| - | '''Sequencher''' | + | {| |
| + | |- | ||
| + | |'''Sequencher''' | ||
| + | |- | ||
| + | |Each of the sequencher diagrams below shows that the BioBrick parts in the book do match the parts in the Parts Registry. For each diagram, the forward and reverse primers (which were designed by our team), were aligned with the sequence described on the Parts Registry, along with the sequences that were found from each primer. All five of these sequences aligned in a logical manner, and showed that we had successfully transformed EYFP, GFP, the LacI promoter, the LambdacI gene, and the p22 cII gene. | ||
| + | |- | ||
| + | |[[Image:EYFPMN.jpg|700px|thumb|EYFP]] | ||
| + | |- | ||
| + | |[[Image:GFPMN.jpg|700px|thumb|GFP]] | ||
| + | |- | ||
| + | |[[Image:LacIpromoterMN.jpg|700px|thumb|LacI Promoter]] | ||
| + | |- | ||
| + | |[[Image:LambdacIMN.jpg|700px|thumb|Lambda cI]] | ||
| + | |- | ||
| + | |[[Image:P22cIIMN.jpg|700px|thumb|p22 cII]] | ||
Latest revision as of 15:40, 25 July 2008
| Back to Notebook Home | |
| Go to Previous Day (June 27) | Go to Next Day (July 1) |
| 1. Set up Sequencher: Need to determine what will be synthesized and research p22 mnt sequence. |
| 2. Repick miniprep plate #3 |
| 3. Redo glycerol stock #7 |
| 4. Discuss vectors |
| 5. Use Vector NTI: Choose the primer base pairs (essentially 20 b.p.'s long to lessen chance of hairpins or errors). Using Vector NTI, we designed primers which will allow us to add the RBS sequence, to the TetR promoter/lamba cI gene construct, through PCR rather than cloning. Since the primer sequence is approximately 8 base pairs long, use of the cloning procedure would be highly ineffective. In addition, we designed primers that will allow us to isolate the sequence of each of our dually repressed promoters, with only the prefix and suffix tails. |
- Designed Primers
| Sequence Name | Forward Primer | Reverse Primer |
|---|---|---|
| lambda cI | 5’ – TCACACAGGAAAGTACTAGATGAGCACAAAAAAGAAACC – 3’ (RBS tail)
5' - GAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGTACTAGATGAGC - 3' (Prefix tail) | 5’ – CTGCAGCGGCCGCTACTAGTATTATTAAGC – 3’ |
| LacI/λcI Promoter | 5' - GAATTCGCGGCCGCTTCTAGAGGC - 3' | 5' - CTGCAGCGGCCGCTACTAGTATGTGTGAAATTGTTATCCGC - 3' |
| TetR/p22 mnt Promoter | 5' - GAATTCGCGGCCGCTTCTAGAGTCCC - 3' | 5' - CTGCAGCGGCCGCTACTAGTAGTGCTCAGTATCTAGGTCACCG -3' |
| Plasmid Backbone | 5' - GCTCACTCAAAGGCGGTAAT - 3' | 5' - TGCCACCTGACGTCTAAGAA - 3' |
| 6. Meeting with advisor: |
| a. Discussed: design scheme for dual repressor parts, must buy p22 mnt, want least overlap in dually repressed parts so decided 2 combinations are LacI with LambdaCI (1) and TetR with P22 mnt (2), ordered new strain of E. Coli, performed double digest. |
| b. Suggestions for the Upcoming Week: Once we have received the DB3.1 E.coli strain from Invitrogen we will be able to transform the three BioBrick base vectors which we are interested in using. After transforming, sequencing will confirm the presence of our desired DNA. Send design/construct to Yiannis and he will email rest of team, meet with Jon so can discuss how machinery works, Yiannis suggests that need to begin synbioSS and start simulating immediately - he wants to see excel spreads or plots from synbioSS (simulate by next Monday), when do the simulations will find delays and issues |
| Sequencher |
| Each of the sequencher diagrams below shows that the BioBrick parts in the book do match the parts in the Parts Registry. For each diagram, the forward and reverse primers (which were designed by our team), were aligned with the sequence described on the Parts Registry, along with the sequences that were found from each primer. All five of these sequences aligned in a logical manner, and showed that we had successfully transformed EYFP, GFP, the LacI promoter, the LambdacI gene, and the p22 cII gene. |
 |
 |
 |
 |
 |
