Template:Team:UC Berkeley/Notebook/AL construction
From 2008.igem.org
(Difference between revisions)
(16 intermediate revisions not shown) | |||
Line 211: | Line 211: | ||
==pBca1256-K112319== | ==pBca1256-K112319== | ||
<pre> | <pre> | ||
- | PCR al0019/ | + | PCR al0019/al0024 on MG1655 (404bp, gp = A) |
+ | PCR al0023/al0023 on MG1655 (86bp, gp=B) | ||
+ | ----------------------------------------------- | ||
+ | PCR al0019/al0020 on A+B (465bp, EcoRI/BamHI/DpnI) | ||
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
Product is pBca1256-K112319 | Product is pBca1256-K112319 | ||
Line 271: | Line 274: | ||
JH090R Reverse biobricking of {H-NS!} Salmonella | JH090R Reverse biobricking of {H-NS!} Salmonella | ||
cgttaGGATCCTTATTcCTTGATCAGG | cgttaGGATCCTTATTcCTTGATCAGG | ||
+ | </pre> | ||
+ | ==pBCa1601CK-K112324== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112902 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112324 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601CK-K112325== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112704 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112325 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112327== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112230 AK, (BamHI methylated) K112203 KC (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AC-K112327 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112328== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112227 AK, (BamHI methylated) K112102 KC (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AC-K112328 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112329== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112230 AK, (BamHI methylated) K112113 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AC-K112329 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112330== | ||
+ | <pre> | ||
+ | Digest K112614 AK (BgIII, XhoI) | ||
+ | Digest K112105 KC(BamHI, XhoI) | ||
+ | Product is pBjh1601AC-K112330 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112331== | ||
+ | <pre> | ||
+ | Digest K112615 AK (BgIII, XhoI) | ||
+ | Digest K112108 KC(BamHI, XhoI) | ||
+ | Product is pBjh1601AC-K112331 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112332== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112615 AK, (BamHI methylated) K112216 KC (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AC-K112332 | ||
+ | </pre> | ||
+ | |||
+ | ==pBCa1601AC-K112333== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112614 AK, (BamHI methylated) K112222 KC (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AC-K112333 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112334== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112230 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112334 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112335== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112227 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112335 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112336== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112614 AC (BamHI/XhoI) | ||
+ | Digest (BamHI methylated) K112324 CK (BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112336 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112337== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112615 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112337 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112339== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112327 AC (BamHI/XhoI) | ||
+ | Digest (BamHI methylated) K112324 CK (BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112339 | ||
+ | </pre> | ||
+ | |||
+ | |||
+ | ==pBca1601AK-K112340== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112328 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112340 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112341== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112329 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112341 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112342== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112330 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112342 | ||
+ | </pre> | ||
+ | |||
+ | |||
+ | ==pBca1601AK-K11234== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112332 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112344 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112348== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112328 AC, (BamHI methylated) K112325 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112348 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112349== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112329 AC, (BamHI methylated) K112325 CK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112349 | ||
+ | </pre> | ||
+ | |||
+ | ==pBca1601AK-K112350== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112330 AC (BamHI/XhoI) | ||
+ | Digest (BamHI methylated) K112325 CK (BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112350 | ||
+ | </pre> | ||
+ | ==pBca1601AK-K112351== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112331 AC (BamHI/XhoI) | ||
+ | Digest (BamHI methylated) K112325 CK (BgIII/XHoI) | ||
+ | Product is pBjh1601AK-K112351 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112354== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112334 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112354 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112355== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112335 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112354 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112356== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112336 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112354 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112357== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112337 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112354 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112360== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112340 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112360 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112361== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112341 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112361 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112362== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112342 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112362 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112363== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112343 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112363 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112368== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112348 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112368 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112369== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112349 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112369 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112370== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112350 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112370 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112371== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112351 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112371 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112372== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) K112121 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112372 | ||
+ | </pre> | ||
+ | ==pBca1601CK-K112373== | ||
+ | <pre> | ||
+ | Digest (BgIII methylated) BBa_K112232 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) | ||
+ | Product is pBjh1601CK-K112373 | ||
</pre> | </pre> |
Latest revision as of 02:10, 29 October 2008
pBca1256-K112300
PCR al0001/al0002 on pSB3C6-Bjh1501 (508bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112300 ----------------------------------------------- al0001 Forward Biobricking of lambda lysozyme with start and stop codons CCATAGAATTCatgAGATCTatggtagaaatcaataatcaacgtaaggcgttcctcg al0002 Reverse Biobricking of lambda lysozyme with start and stop codons CGttaGGATCCtcatacatcaatctctctgaccgttccgcc
pBca1256-K112301
PCR al0003/al0002 on pSB3C6-Bjh1501 (505bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112301 ----------------------------------------------- al0003 Forward Biobricking of Lambda Lysozyme with stop codon and no start codon CCATAGAATTCatgAGATCTgtagaaatcaataatcaacgtaaggcgttcctcg al0002 Reverse Biobricking of Lambda Lysozyme with stop codon and no start codon CGttaGGATCCtcatacatcaatctctctgaccgttccgcc
pBca1256-K112302
PCR al0001/al0004 on pSB3C6-Bjh1501 (505bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112302 ----------------------------------------------- al0001 Forward Biobricking of lambda lysozyme with start codon and no stop codon CCATAGAATTCatgAGATCTatggtagaaatcaataatcaacgtaaggcgttcctcg al0004 Reverse Biobricking of lambda lysozyme with start codon and no stop codon CGttaGGATCCtacatcaatctctctgaccgttccgc
pBca1256-K112303
PCR al0003/al0004 on pSB3C6-Bjh1501 (502bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112303 ----------------------------------------------- al0003 Forward Biobricking of lambda lysozyme with no start/stop codon CCATAGAATTCatgAGATCTgtagaaatcaataatcaacgtaaggcgttcctcg al0004 Reverse Biobricking of lambda lysozyme with no start/stop codon CGttaGGATCCtacatcaatctctctgaccgttccgc
pBca1256-K112304
PCR al0005/al0002 on pSB3C6-Bjh1501 (512bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112304 ----------------------------------------------- al0005 Forward Biobricking of lambda lysozyme with spacer CCATAGAATTCatgAGATCTgaagatggtagaaatcaataatcaacgtaaggcgttcctcg al0002 Reverse Biobricking of lambda lysozyme with spacer CGttaGGATCCtcatacatcaatctctctgaccgttccgcc
pBca1256-K112305
PCR al0006/al0002 on pSB3C6-Bjh1501 (527bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112305 ----------------------------------------------- al0006 Forward Biobricking of lambda lysozyme with rbs site CCATAGAATTCatgAGATCTaaaaaagccggagtagaagatgg al0002 Reverse Biobricking of lambda lysozyme with rbs site CGttaGGATCCtcatacatcaatctctctgaccgttccgcc
pBca1256-K112306
PCR al0007/al0008 on pSB3C6-Bjh1502 (349bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112306 ----------------------------------------------- al0007 Forward Biobricking of lambda holin with start and stop codons CCATAGAATTCatgAGATCTatgccagaaaaacatgacctgttgg al0008 Reverse Biobricking of lambda holin with start and stop codons CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112307
PCR al0009/al0008 on pSB3C6-Bjh1502 (346bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112307 ----------------------------------------------- al0009 Forward Biobricking of lambda holin with stop codon and no start codon CCATAGAATTCatgAGATCTccagaaaaacatgacctgttggcc al0008 Reverse Biobricking of lambda holin with stop codon and no start codon CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112308
PCR al0007/al0010 on pSB3C6-Bjh1502 (346bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112308 ----------------------------------------------- al0007 Forward Biobricking of lambda holin with start and no stop codon CCATAGAATTCatgAGATCTatgccagaaaaacatgacctgttgg al0010 Reverse Biobricking of lambda holin wtih start and no stop codon CGttaGGATCCttgatttctaccatcttctactccggc
pBca1256-K112309
PCR al0009/al0010 on pSB3C6-Bjh1502 (343bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112309 ----------------------------------------------- al0009 Forward Biobricking of lambda holin with no start and stop codon CCATAGAATTCatgAGATCTccagaaaaacatgacctgttggcc al0010 Reverse Biobricking of lambda holin with no start and stop codon CGttaGGATCCttgatttctaccatcttctactccggc
pBca1256-K112310
PCR al0011/al0008 on pSB3C6-Bjh1502 (353bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112310 ----------------------------------------------- al0011 Forward Biobricking of lambda holin with spacer CCATAGAATTCatgAGATCTgaagatgccagaaaaacatgacctg al0008 Reverse Biobricking of lambda holin with spacer CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112311
PCR al0012/al0008 on pSB3C6-Bjh1502 (369bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112311 ----------------------------------------------- al0012 Forward Biobricking of lambda holin with rbs site CCATAGAATTCatgAGATCTattgggggtaagacCtgaag al0008 Reverse Biobricking of lambda holin with rbs site CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112312
PCR al0013/al0008 on pSB3C6-Bjh1503 (355bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112312 ----------------------------------------------- al0013 Forward Biobricking of lambda antiholin with start and stop codons CCATAGAATTCatgAGATCTatgaagCtgccagaaaaacatgacc al0008 Reverse Biobricking of lambda antiholin with start and stop codons CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112313
PCR al0014/al0008 on pSB3C6-Bjh1503 (352bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112313 ----------------------------------------------- al0014 Forward Biobricking of lambda antiholin with stop codon and no start codon CCATAGAATTCatgAGATCTaagCtgccagaaaaacatgacctg al0008 Reverse Biobricking of lambda antiholin with stop codon and no start codon CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112314
PCR al0013/al0010 on pSB3C6-Bjh1503 (352bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112314 ----------------------------------------------- al0013 Forward Biobricking of lambda antiholin with start codon and no stop codon CCATAGAATTCatgAGATCTatgaagCtgccagaaaaacatgacc al0010 Reverse Biobricking of lambda antiholin with start codon and no stop codon CGttaGGATCCttgatttctaccatcttctactccggc
pBca1256-K112315
PCR al0014/al0010 on pSB3C6-Bjh1503 (349bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112315 ----------------------------------------------- al0014 Forward Biobricking of lambda antiholin with no start and stop codons CCATAGAATTCatgAGATCTaagCtgccagaaaaacatgacctg al0010 Reverse Biobricking of lambda antiholin with no start and stop codons CGttaGGATCCttgatttctaccatcttctactccggc
pBca1256-K112316
PCR al0015/al0008 on pSB3C6-Bjh1503 (359bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112316 ----------------------------------------------- al0015 Forward Biobricking of lambda antiholin with spacer CCATAGAATTCatgAGATCTagacatgaagCtgccagaaaaacatgacc al0008 Reverse Biobricking of lambda antiholin with spacer CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112317
PCR al0016/al0008 on pSB3C6-Bjh1503 (375bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112317 ----------------------------------------------- al0016 Forward Biobricking of lambda antiholin with rbs site CCATAGAATTCatgAGATCTccccttattgggggtaagacatg al0008 Reverse Biobricking of lambda antiholin with rbs site CGttaGGATCCttattgatttctaccatcttctactccggc
pBca1256-K112318
PCR al0017/al0018 on MG1655 (467bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112318 ----------------------------------------------- al0017 Forward Biobricking of bolA promoter CCATAGAATTCatgAGATCTtgctgtggcagtgtaatcgtc al0018 Reverse Biobricking of bolA promoter CGttaGGATCCcttctatccgctcacgtatc
pBca1256-K112319
PCR al0019/al0024 on MG1655 (404bp, gp = A) PCR al0023/al0023 on MG1655 (86bp, gp=B) ----------------------------------------------- PCR al0019/al0020 on A+B (465bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112319 ----------------------------------------------- al0019 Forward Biobricking of ftsQ promoter CCATAGAATTCatgAGATCTttgattgaaaaatggctaagtgggccgg al0020 Reverse Biobricking of ftsQ promoter CGttaGGATCCcctcttcttcgctgtttcgc al0023 Forward Removing of EcoRI ggtagtacgaattGtggaactggcg al0024 Reverse Removing of EcoRI cgccagttccaCaattcgtactacc
pBca1256-K112320
PCR al0021/al0022 on MG1655 (804bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112320 ----------------------------------------------- al0021 Forward Biobricking of ftsAZ promoter CCATAGAATTCatgAGATCTaacgacagtgttggtgagcg al0022 Reverse Biobricking of ftsAZ promoter CGttaGGATCCgtaccaatctccagtcctactaccag
pBjh1601AC-K112321
PCR JH088F/JHO88R on Salmonella L2. (435bp, EcoRI/BamHI/DpnI) Sub into pBjh1601AC (EcoRI/BamHI, 3195+910, L) Product is pBjh1601AC-K112321 ----------------------------------------------- JH088F Forward biobricking of {H-NS!} cgataGAATTCatgAGATCTATGAGCGAAGCACTTAAAATTC JH088R Reverse biobricking of {H-NS!} cgttaGGATCCTTATTGCTTGATCAGGAAATCG
pBjh1601CK-K112322
PCR JH089F/JH089R on Salmonella L2. (379 bp, EcoRI/BamHI/DpnI) Sub into pBjh1601CK (EcoRI/BamHI, 3134+910, L) Product is pBjh1601CK-K112322 ----------------------------------------------- JH089F Forward biobricking of {Pdps} cgataGAATTCatgAGATCTaacgattcgacgcgaaccgc JH089R Reverse biobricking of {Pdps} cgttaGGATCCaatctcatatcctcttgatg
pBCa1601AC-K112323
PCR ca998/JH090R on pBjh1601AC-K112321-2 (445 bp, EcoRI/BamHI) Sub into pBjh1601AC (EcoRI/BamHI, 3195+910, L) Product is pBjh1601AC-K112323 ----------------------------------------------- ca998 Forward biobricking of {H-NS!} Salmonella gtatcacgaggcagaatttcag JH090R Reverse biobricking of {H-NS!} Salmonella cgttaGGATCCTTATTcCTTGATCAGG
pBCa1601CK-K112324
Digest (BgIII methylated) K112902 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112324
pBCa1601CK-K112325
Digest (BgIII methylated) K112704 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112325
pBCa1601AC-K112327
Digest (BgIII methylated) K112230 AK, (BamHI methylated) K112203 KC (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112327
pBCa1601AC-K112328
Digest (BgIII methylated) K112227 AK, (BamHI methylated) K112102 KC (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112328
pBCa1601AC-K112329
Digest (BgIII methylated) K112230 AK, (BamHI methylated) K112113 CK (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112329
pBCa1601AC-K112330
Digest K112614 AK (BgIII, XhoI) Digest K112105 KC(BamHI, XhoI) Product is pBjh1601AC-K112330
pBCa1601AC-K112331
Digest K112615 AK (BgIII, XhoI) Digest K112108 KC(BamHI, XhoI) Product is pBjh1601AC-K112331
pBCa1601AC-K112332
Digest (BgIII methylated) K112615 AK, (BamHI methylated) K112216 KC (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112332
pBCa1601AC-K112333
Digest (BgIII methylated) K112614 AK, (BamHI methylated) K112222 KC (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112333
pBca1601AK-K112334
Digest (BgIII methylated) K112230 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112334
pBca1601AK-K112335
Digest (BgIII methylated) K112227 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112335
pBca1601AK-K112336
Digest (BgIII methylated) K112614 AC (BamHI/XhoI) Digest (BamHI methylated) K112324 CK (BgIII/XHoI) Product is pBjh1601AK-K112336
pBca1601AK-K112337
Digest (BgIII methylated) K112615 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112337
pBca1601AK-K112339
Digest (BgIII methylated) K112327 AC (BamHI/XhoI) Digest (BamHI methylated) K112324 CK (BgIII/XHoI) Product is pBjh1601AK-K112339
pBca1601AK-K112340
Digest (BgIII methylated) K112328 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112340
pBca1601AK-K112341
Digest (BgIII methylated) K112329 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112341
pBca1601AK-K112342
Digest (BgIII methylated) K112330 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112342
pBca1601AK-K11234
Digest (BgIII methylated) K112332 AC, (BamHI methylated) K112324 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112344
pBca1601AK-K112348
Digest (BgIII methylated) K112328 AC, (BamHI methylated) K112325 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112348
pBca1601AK-K112349
Digest (BgIII methylated) K112329 AC, (BamHI methylated) K112325 CK (BamHI/BgIII/XHoI) Product is pBjh1601AK-K112349
pBca1601AK-K112350
Digest (BgIII methylated) K112330 AC (BamHI/XhoI) Digest (BamHI methylated) K112325 CK (BgIII/XHoI) Product is pBjh1601AK-K112350
pBca1601AK-K112351
Digest (BgIII methylated) K112331 AC (BamHI/XhoI) Digest (BamHI methylated) K112325 CK (BgIII/XHoI) Product is pBjh1601AK-K112351
pBca1601CK-K112354
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112334 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112354
pBca1601CK-K112355
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112335 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112354
pBca1601CK-K112356
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112336 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112354
pBca1601CK-K112357
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112337 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112354
pBca1601CK-K112360
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112340 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112360
pBca1601CK-K112361
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112341 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112361
pBca1601CK-K112362
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112342 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112362
pBca1601CK-K112363
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112343 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112363
pBca1601CK-K112368
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112348 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112368
pBca1601CK-K112369
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112349 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112369
pBca1601CK-K112370
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112350 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112370
pBca1601CK-K112371
Digest (BgIII methylated) K112900 CA, (BamHI methylated) K112351 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112371
pBca1601CK-K112372
Digest (BgIII methylated) K112121 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112372
pBca1601CK-K112373
Digest (BgIII methylated) BBa_K112232 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112373