Team:Hawaii/Construction of Broad-Host-Range Expression Vector

From 2008.igem.org

(Difference between revisions)
m
(took out progress)
 
(7 intermediate revisions not shown)
Line 3: Line 3:
== Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts ==
== Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts ==
-
This expression vector will pull parts from the RSF1010 derived broad-host-range plamid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the origional DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.  
+
This expression vector will pull parts from the RSF1010 derived broad-host-range plasmid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the original DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.  
The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into ''E. coli'' then conjugatively transferred to ''Synechocystis''PCC6803, followed by the final test of cloning in genes and testing their expression in both ''E. coli'' and ''Synechocystis''PCC6803.
The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into ''E. coli'' then conjugatively transferred to ''Synechocystis''PCC6803, followed by the final test of cloning in genes and testing their expression in both ''E. coli'' and ''Synechocystis''PCC6803.
Line 12: Line 12:
* Design Primers
* Design Primers
-
* Design overlapping oligonucleotides
+
* Design overlapping oligonucleotides and oligonucleotide inserts
* Selection of additional BioBrick parts
* Selection of additional BioBrick parts
* Lay-out of the new vector
* Lay-out of the new vector
=== Results ===
=== Results ===
 +
 +
* These genes were amplified from pRL1383a in all cases except for the P1 lytic region which will be amplified from a BioBrick plasmid: pSB2K3.
'''pRL1383a Genes w/ BioBrick Ends'''
'''pRL1383a Genes w/ BioBrick Ends'''
{| border="1"
{| border="1"
-
! name
+
! width="100"|name
-
! primer
+
! width="100"|primer
-
! length
+
! width="50"|Tm
-
! g/c
+
! width="50"|Reviewed By
-
! Tm
+
! width="250"|Notes
-
! Reviewed By
+
-
! Notes
+
|-
|-
| aadA_fp._sb.1
| aadA_fp._sb.1
| cctTTCTAGatgagggaagcggtgatcg
| cctTTCTAGatgagggaagcggtgatcg
-
| 19 bp, 28 bp
+
| 59.4/65.7 C
-
| 57.9%, 53.6%
+
-
| 59.4 C, 65.7 C
+
| NW
| NW
-
| isolates the aadA gene only from ATG to TAA-TAA (original name: SmSpOmega_fp._sb.1)
+
| isolates aadA from ATG to TAA-TAA  
|-
|-
| aadA_rp._sb.1
| aadA_rp._sb.1
| aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg
| aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg
-
| 20 bp, 48 bp
+
| 55.4/74.5
-
| 45%, 50%
+
-
| 55.4 C, 74.5 C
+
| NW
| NW
-
| isolates the aadA gene only from ATG to TAA-TAA (original name: SmSpOmega_rp._sb.1)
+
| isolates aadA from ATG to TAA-TAA
|-
|-
| OmegaInterposon_fo._sb.1
| OmegaInterposon_fo._sb.1
| cctTTCTAGAGggtgattgattgagcaagc
| cctTTCTAGAGggtgattgattgagcaagc
-
| 19 bp, 30 bp
+
| 54.5/65
-
| 47.4%, 46.7%
+
-
| 54.5 C, 65 C
+
| NW
| NW
-
| will produce mixture of 4 different products, 2/4 will be correct
+
| mixture of 4 products, 2/4 correct
|-
|-
| OmegaInterposon_ro._sb.1
| OmegaInterposon_ro._sb.1
| aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc
| aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc
-
| 19 bp, 44 bp
+
| 54.5/75.5
-
| 47.4%, 54.5%
+
-
| 54.5 C, 75.5 C
+
| NW
| NW
-
| will produce mixture of 4 different products, 2/4 will be correct
+
| mixture of 4 products, 2/4 correct
|-
|-
| pRL1383aOriV_fb._sb.1
| pRL1383aOriV_fb._sb.1
| cctTTCTAGAGgaacccctgcaataactgtc
| cctTTCTAGAGgaacccctgcaataactgtc
-
| 20 bp, 31 bp
+
| 56.3/65.9
-
| 55%, 48.4%
+
-
| 56.3 C, 65.9 C
+
| NW
| NW
|  
|  
Line 71: Line 61:
| pRL1383aOriV_rb._sb.1
| pRL1383aOriV_rb._sb.1
| aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac
| aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac
-
| 20 bp, 45 bp
+
| 58/76.2
-
| 55%, 57.8%
+
-
| 58 C, 76.2 C
+
| NW
| NW
|  
|  
Line 79: Line 67:
| pRL1383aRep_fp._sp.1
| pRL1383aRep_fp._sp.1
| cctTTCTAGatgaagaacgacaggactttgc
| cctTTCTAGatgaagaacgacaggactttgc
-
| 22 bp, 31 bp
+
| 58.9/64.9
-
| 45.5%, 45.2%
+
-
| 58.9 C, 64.9 C
+
| NW
| NW
| Begins with RepB  
| Begins with RepB  
Line 87: Line 73:
| pRL1383aRep_rb._sb.1
| pRL1383aRep_rb._sb.1
| aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca
| aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca
-
| 19 bp, 44 bp
+
| 62.2/78.5
-
| 63.2%, 61.4%
+
-
| 62.2 C, 78.5 C
+
| NW
| NW
-
| Ends with an existing post-RepC terminator (and not the RepC protein stop codon). Checked the sequence 8/2, the terminator is missing the last C.  
+
| Ends RepC terminator.8/2:the terminator is missing the last C.  
|-
|-
|p1lytic_fb._sb.1
|p1lytic_fb._sb.1
|atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac
|atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac
-
| 43
+
|59.5/76.2
-
| (need to recalculate)
+
-
| (need to recalculate)
+
| NW
| NW
-
|E-N-X for front ligation; for priming out phage induced high-copy-number origin of replication (amplification begins as RBS, amplifies out of ??? plasmid)
+
|E-N-X(front ligation);inducible high-copy-#, incl. P<sub>lac</sub>;from pSB2K3
|-
|-
|p1lytic_rp._sb.1
|p1lytic_rp._sb.1
|cTACTAGTATTAttaccctctgaatcctgccg
|cTACTAGTATTAttaccctctgaatcctgccg
-
| 32
+
|59.2/63.5
-
| (need to recalculate)
+
-
| (need to recalculate)
+
| NW
| NW
-
|S for front ligation, introduce additional TTA (TAA) stop codon; for priming out phage induced high-copy-number origin of replication (amplification end as protein coding region stop codon, amplifies out of ??? plasmid)
+
|S(front ligation), ends w/(TAATAA);induced high-copy-#;from pSB2K3
|}
|}
 +
 +
*The origin of conjugative transfer will be synthetically constructed using the Overlapping Oligonucleotides method from the Silver Lab [1].
'''RP4 Origin of Transfer Sequences for Oligonucleotide Extension'''
'''RP4 Origin of Transfer Sequences for Oligonucleotide Extension'''
Line 149: Line 131:
|}
|}
-
== Discussion ==
+
'''BioBricks Extracted from Registry'''
 +
{| border="1"
 +
! name
 +
! Function
 +
! Combined with?
 +
|-
 +
| [http://partsregistry.org/Part:pSB1A7 pSB1A7]
 +
| high copy BioBrick vector, Amp<sup>R</sup>, insulated
 +
| Storage for oriV, oriT
 +
|-
 +
| [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]
 +
| BioBrick Base Vector
 +
| final assembly of all parts
 +
|-
 +
| [http://partsregistry.org/Part:BBa_I14032 BBa_I14032]
 +
| lac promoter
 +
| rep region, aadA region
 +
|-
 +
|[http://partsregistry.org/Part:BBa_B0034 BBa_B0034]
 +
|RBS PoPS=1.0
 +
|rep region, aadA region
 +
|-
 +
| [http://partsregistry.org/Part:BBa_B0015 BBa_B0015]
 +
| Double terminator
 +
| aadA region, P1 lytic region
 +
|-
 +
| [http://partsregistry.org/Part:BBa_J23012 BBa_J23012]
 +
| aadA BioBrick
 +
| combine with lac promoter and double terminator
 +
|}
 +
 
 +
===Discussion===
 +
 
 +
==Make Parts==
 +
 
 +
:* I am making the parts several different ways: 1. PCR amplification, 2. synthetic construction of overlapping oligonucleotides, 3. extraction from BioBrick Registry.
 +
 
 +
===[[Team:Hawaii/PCR Amplification of pRL1383a|PCR Amplification of pRL1383a]]===
 +
:*Each of these experiments can be found at the link above. This will include amplification products from other plasmids besides pRL1383a.
 +
 
 +
===[[Team:Hawaii/Initial Synth. Oligo Assembly|Oligonucleotide Assemby]]===
 +
:*The experiment and results can be found on the link above under the heading: "2 Construction of OriT from RP4 using Overlapping Oligonucleotides: Attempt 1"
 +
 
 +
===[[Team:Hawaii/Extraction of BioBrick Parts from Registry| Extraction of BioBrick Parts from Registry]]===
 +
 
 +
:*Some parts were extracted from BioBrick registry, the experiments and results will be included in the link above.
 +
 
 +
==[[Team:Hawaii/Ligation of pRL1383a Parts|Ligation of Parts]]==
 +
 
 +
:* Experiments and results found in link above.
 +
 
 +
 
 +
== References ==
 +
 
 +
[[http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts]] Silver Lab, Overlapping Oligonucleotides Inserts Protocol.
 +
 
-
* What was learned and how to do future experiments differently.
 
{{Team:Hawaii/Footer}}
{{Team:Hawaii/Footer}}

Latest revision as of 01:10, 16 August 2008

Projects Events Resources
Sponsors Experiments Milestones Protocols
Notebook (t) Meetings (t)

Contents

Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts

This expression vector will pull parts from the RSF1010 derived broad-host-range plasmid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the original DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.

The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into E. coli then conjugatively transferred to SynechocystisPCC6803, followed by the final test of cloning in genes and testing their expression in both E. coli and SynechocystisPCC6803.

Design

Methods

  • Design Primers
  • Design overlapping oligonucleotides and oligonucleotide inserts
  • Selection of additional BioBrick parts
  • Lay-out of the new vector

Results

  • These genes were amplified from pRL1383a in all cases except for the P1 lytic region which will be amplified from a BioBrick plasmid: pSB2K3.

pRL1383a Genes w/ BioBrick Ends

name primer Tm Reviewed By Notes
aadA_fp._sb.1 cctTTCTAGatgagggaagcggtgatcg 59.4/65.7 C NW isolates aadA from ATG to TAA-TAA
aadA_rp._sb.1 aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg 55.4/74.5 NW isolates aadA from ATG to TAA-TAA
OmegaInterposon_fo._sb.1 cctTTCTAGAGggtgattgattgagcaagc 54.5/65 NW mixture of 4 products, 2/4 correct
OmegaInterposon_ro._sb.1 aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc 54.5/75.5 NW mixture of 4 products, 2/4 correct
pRL1383aOriV_fb._sb.1 cctTTCTAGAGgaacccctgcaataactgtc 56.3/65.9 NW
pRL1383aOriV_rb._sb.1 aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac 58/76.2 NW
pRL1383aRep_fp._sp.1 cctTTCTAGatgaagaacgacaggactttgc 58.9/64.9 NW Begins with RepB
pRL1383aRep_rb._sb.1 aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca 62.2/78.5 NW Ends RepC terminator.8/2:the terminator is missing the last C.
p1lytic_fb._sb.1 atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac 59.5/76.2 NW E-N-X(front ligation);inducible high-copy-#, incl. Plac;from pSB2K3
p1lytic_rp._sb.1 cTACTAGTATTAttaccctctgaatcctgccg 59.2/63.5 NW S(front ligation), ends w/(TAATAA);induced high-copy-#;from pSB2K3


  • The origin of conjugative transfer will be synthetically constructed using the Overlapping Oligonucleotides method from the Silver Lab [1].

RP4 Origin of Transfer Sequences for Oligonucleotide Extension

name oligonucleotide set Reviewed by Notes
oriT1_ob._na.1 ctagaggaataagggacagtgaagaaggaacacccgctcg NW complement oriT4
oriT2_ob._na.1 cgggtgggcctacttcacctatcctgcccggctgacgccg NW complement of oriT5
oriT3_ob._na.1 ttggatacaccaaggaaagtctacatactagtagcggccgctgca NW complement of oriT6
oriT4_ob._na.1 GCGGCCGCTACTAGTAtgtagactttccttggtg NW
oriT5_ob._na.1 tatccaacggcgtcagccgggcaggataggtgaagtaggcc NW
oriT6_ob._na.1 cacccgcgagcgggtgttccttcttcactgtcccttattcCT NW

BioBricks Extracted from Registry

name Function Combined with?
[http://partsregistry.org/Part:pSB1A7 pSB1A7] high copy BioBrick vector, AmpR, insulated Storage for oriV, oriT
[http://partsregistry.org/Part:BBa_I51020 BBa_I51020] BioBrick Base Vector final assembly of all parts
[http://partsregistry.org/Part:BBa_I14032 BBa_I14032] lac promoter rep region, aadA region
[http://partsregistry.org/Part:BBa_B0034 BBa_B0034] RBS PoPS=1.0 rep region, aadA region
[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] Double terminator aadA region, P1 lytic region
[http://partsregistry.org/Part:BBa_J23012 BBa_J23012] aadA BioBrick combine with lac promoter and double terminator

Discussion

Make Parts

  • I am making the parts several different ways: 1. PCR amplification, 2. synthetic construction of overlapping oligonucleotides, 3. extraction from BioBrick Registry.

PCR Amplification of pRL1383a

  • Each of these experiments can be found at the link above. This will include amplification products from other plasmids besides pRL1383a.

Oligonucleotide Assemby

  • The experiment and results can be found on the link above under the heading: "2 Construction of OriT from RP4 using Overlapping Oligonucleotides: Attempt 1"

Extraction of BioBrick Parts from Registry

  • Some parts were extracted from BioBrick registry, the experiments and results will be included in the link above.

Ligation of Parts

  • Experiments and results found in link above.


References

http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts Silver Lab, Overlapping Oligonucleotides Inserts Protocol.



[http://manoa.hawaii.edu/ Sponsor_UHM.gif][http://manoa.hawaii.edu/ovcrge/ Sponsor_OVCRGE.gif][http://www.ctahr.hawaii.edu Sponsor_CTAHR.gif]