|
|
| (38 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| - | <html> | + | <div id="header">{{Template:Team:Edinburgh/Templates/Header}}</div> |
| - | <head>
| + | |
| - | <title>Edinburgh iGem 2008</title>
| + | |
| - | <script type="text/javascript">
| + | |
| - | //Drop Down Tabs Menu- Author: Dynamic Drive (http://www.dynamicdrive.com)
| + | |
| - | //Created: May 16th, 07'
| + | |
| - | | + | |
| - | var tabdropdown={
| + | |
| - | * disappeardelay: 200, //set delay in miliseconds before menu disappears onmouseout
| + | |
| - | disablemenuclick: false, //when user clicks on a menu item with a drop down menu, disable menu item's link?
| + | |
| - | enableiframeshim: 1, //1 or 0, for true or false
| + | |
| - | | + | |
| - | //No need to edit beyond here////////////////////////
| + | |
| - | dropmenuobj: null, ie: document.all, firefox: document.getElementById&&!document.all, previousmenuitem:null,
| + | |
| - | currentpageurl: window.location.href.replace("http://"+window.location.hostname, "").replace(/^\//, ""), //get current page url (minus hostname, ie: http://www.dynamicdrive.com/)
| + | |
| - | | + | |
| - | getposOffset:function(what, offsettype){
| + | |
| - | var totaloffset=(offsettype=="left")? what.offsetLeft : what.offsetTop;
| + | |
| - | var parentEl=what.offsetParent;
| + | |
| - | while (parentEl!=null){
| + | |
| - | totaloffset=(offsettype=="left")? totaloffset+parentEl.offsetLeft : totaloffset+parentEl.offsetTop;
| + | |
| - | parentEl=parentEl.offsetParent;
| + | |
| - | }
| + | |
| - | return totaloffset;
| + | |
| - | },
| + | |
| - | | + | |
| - | showhide:function(obj, e, obj2){ //obj refers to drop down menu, obj2 refers to tab menu item mouse is currently over
| + | |
| - | if (this.ie || this.firefox)
| + | |
| - | this.dropmenuobj.style.left=this.dropmenuobj.style.top="-500px"
| + | |
| - | if (e.type=="click" && obj.visibility==hidden || e.type=="mouseover"){
| + | |
| - | if (obj2.parentNode.className.indexOf("default")==-1) //if tab isn't a default selected one
| + | |
| - | obj2.parentNode.className="selected"
| + | |
| - | obj.visibility="visible"
| + | |
| - | }
| + | |
| - | else if (e.type=="click")
| + | |
| - | obj.visibility="hidden"
| + | |
| - | },
| + | |
| - | | + | |
| - | iecompattest:function(){
| + | |
| - | return (document.compatMode && document.compatMode!="BackCompat")? document.documentElement : document.body
| + | |
| - | },
| + | |
| - | | + | |
| - | clearbrowseredge:function(obj, whichedge){
| + | |
| - | var edgeoffset=0
| + | |
| - | if (whichedge=="rightedge"){
| + | |
| - | var windowedge=this.ie && !window.opera? this.standardbody.scrollLeft+this.standardbody.clientWidth-15 : window.pageXOffset+window.innerWidth-15
| + | |
| - | this.dropmenuobj.contentmeasure=this.dropmenuobj.offsetWidth
| + | |
| - | if (windowedge-this.dropmenuobj.x < this.dropmenuobj.contentmeasure) //move menu to the left?
| + | |
| - | edgeoffset=this.dropmenuobj.contentmeasure-obj.offsetWidth
| + | |
| - | }
| + | |
| - | else{
| + | |
| - | var topedge=this.ie && !window.opera? this.standardbody.scrollTop : window.pageYOffset
| + | |
| - | var windowedge=this.ie && !window.opera? this.standardbody.scrollTop+this.standardbody.clientHeight-15 : window.pageYOffset+window.innerHeight-18
| + | |
| - | this.dropmenuobj.contentmeasure=this.dropmenuobj.offsetHeight
| + | |
| - | if (windowedge-this.dropmenuobj.y < this.dropmenuobj.contentmeasure){ //move up?
| + | |
| - | edgeoffset=this.dropmenuobj.contentmeasure+obj.offsetHeight
| + | |
| - | if ((this.dropmenuobj.y-topedge)<this.dropmenuobj.contentmeasure) //up no good either?
| + | |
| - | edgeoffset=this.dropmenuobj.y+obj.offsetHeight-topedge
| + | |
| - | }
| + | |
| - | this.dropmenuobj.firstlink.style.borderTopWidth=(edgeoffset==0)? 0 : "1px" //Add 1px top border to menu if dropping up
| + | |
| - | }
| + | |
| - | return edgeoffset
| + | |
| - | },
| + | |
| - | | + | |
| - | dropit:function(obj, e, dropmenuID){
| + | |
| - | if (this.dropmenuobj!=null){ //hide previous menu
| + | |
| - | this.dropmenuobj.style.visibility="hidden" //hide menu
| + | |
| - | if (this.previousmenuitem!=null && this.previousmenuitem!=obj){
| + | |
| - | if (this.previousmenuitem.parentNode.className.indexOf("default")==-1) //If the tab isn't a default selected one
| + | |
| - | this.previousmenuitem.parentNode.className=""
| + | |
| - | }
| + | |
| - | }
| + | |
| - | this.clearhidemenu()
| + | |
| - | if (this.ie||this.firefox){
| + | |
| - | obj.onmouseout=function(){tabdropdown.delayhidemenu(obj)}
| + | |
| - | obj.onclick=function(){return !tabdropdown.disablemenuclick} //disable main menu item link onclick?
| + | |
| - | this.dropmenuobj=document.getElementById(dropmenuID)
| + | |
| - | this.dropmenuobj.onmouseover=function(){tabdropdown.clearhidemenu()}
| + | |
| - | this.dropmenuobj.onmouseout=function(e){tabdropdown.dynamichide(e, obj)}
| + | |
| - | this.dropmenuobj.onclick=function(){tabdropdown.delayhidemenu(obj)}
| + | |
| - | this.showhide(this.dropmenuobj.style, e, obj)
| + | |
| - | this.dropmenuobj.x=this.getposOffset(obj, "left")
| + | |
| - | this.dropmenuobj.y=this.getposOffset(obj, "top")
| + | |
| - | this.dropmenuobj.style.left=this.dropmenuobj.x-this.clearbrowseredge(obj, "rightedge")+"px"
| + | |
| - | this.dropmenuobj.style.top=this.dropmenuobj.y-this.clearbrowseredge(obj, "bottomedge")+obj.offsetHeight+1+"px"
| + | |
| - | this.previousmenuitem=obj //remember main menu item mouse moved out from (and into current menu item)
| + | |
| - | this.positionshim() //call iframe shim function
| + | |
| - | }
| + | |
| - | },
| + | |
| - | | + | |
| - | contains_firefox:function(a, b) {
| + | |
| - | while (b.parentNode)
| + | |
| - | if ((b = b.parentNode) == a)
| + | |
| - | return true;
| + | |
| - | return false;
| + | |
| - | },
| + | |
| - | | + | |
| - | dynamichide:function(e, obj2){ //obj2 refers to tab menu item mouse is currently over
| + | |
| - | var evtobj=window.event? window.event : e
| + | |
| - | if (this.ie&&!this.dropmenuobj.contains(evtobj.toElement))
| + | |
| - | this.delayhidemenu(obj2)
| + | |
| - | else if (this.firefox&&e.currentTarget!= evtobj.relatedTarget&& !this.contains_firefox(evtobj.currentTarget, evtobj.relatedTarget))
| + | |
| - | this.delayhidemenu(obj2)
| + | |
| - | },
| + | |
| - | | + | |
| - | delayhidemenu:function(obj2){
| + | |
| - | this.delayhide=setTimeout(function(){tabdropdown.dropmenuobj.style.visibility='hidden'; if (obj2.parentNode.className.indexOf('default')==-1) obj2.parentNode.className=''},this.disappeardelay) //hide menu
| + | |
| - | },
| + | |
| - | | + | |
| - | clearhidemenu:function(){
| + | |
| - | if (this.delayhide!="undefined")
| + | |
| - | clearTimeout(this.delayhide)
| + | |
| - | },
| + | |
| - | | + | |
| - | positionshim:function(){ //display iframe shim function
| + | |
| - | if (this.enableiframeshim && typeof this.shimobject!="undefined"){
| + | |
| - | if (this.dropmenuobj.style.visibility=="visible"){
| + | |
| - | this.shimobject.style.width=this.dropmenuobj.offsetWidth+"px"
| + | |
| - | this.shimobject.style.height=this.dropmenuobj.offsetHeight+"px"
| + | |
| - | this.shimobject.style.left=this.dropmenuobj.style.left
| + | |
| - | this.shimobject.style.top=this.dropmenuobj.style.top
| + | |
| - | }
| + | |
| - | this.shimobject.style.display=(this.dropmenuobj.style.visibility=="visible")? "block" : "none"
| + | |
| - | }
| + | |
| - | },
| + | |
| - | | + | |
| - | hideshim:function(){
| + | |
| - | if (this.enableiframeshim && typeof this.shimobject!="undefined")
| + | |
| - | this.shimobject.style.display='none'
| + | |
| - | },
| + | |
| - | | + | |
| - | isSelected:function(menuurl){
| + | |
| - | var menuurl=menuurl.replace("http://"+menuurl.hostname, "").replace(/^\//, "")
| + | |
| - | return (tabdropdown.currentpageurl==menuurl)
| + | |
| - | },
| + | |
| - | | + | |
| - | init:function(menuid, dselected){
| + | |
| - | this.standardbody=(document.compatMode=="CSS1Compat")? document.documentElement : document.body //create reference to common "body" across doctypes
| + | |
| - | var menuitems=document.getElementById(menuid).getElementsByTagName("a")
| + | |
| - | for (var i=0; i<menuitems.length; i++){
| + | |
| - | if (menuitems[i].getAttribute("rel")){
| + | |
| - | var relvalue=menuitems[i].getAttribute("rel")
| + | |
| - | document.getElementById(relvalue).firstlink=document.getElementById(relvalue).getElementsByTagName("a")[0]
| + | |
| - | menuitems[i].onmouseover=function(e){
| + | |
| - | var event=typeof e!="undefined"? e : window.event
| + | |
| - | tabdropdown.dropit(this, event, this.getAttribute("rel"))
| + | |
| - | }
| + | |
| - | }
| + | |
| - | if (dselected=="auto" && typeof setalready=="undefined" && this.isSelected(menuitems[i].href)){
| + | |
| - | menuitems[i].parentNode.className+=" selected default"
| + | |
| - | var setalready=true
| + | |
| - | }
| + | |
| - | else if (parseInt(dselected)==i)
| + | |
| - | menuitems[i].parentNode.className+=" selected default"
| + | |
| - | }
| + | |
| - | }
| + | |
| - | | + | |
| - | }
| + | |
| - | </script>
| + | |
| - | <style>
| + | |
| - | .ddcolortabs{
| + | |
| - | padding: 0;
| + | |
| - | width: 100%;
| + | |
| - | background: transparent;
| + | |
| - | voice-family: "\"}\"";
| + | |
| - | voice-family: inherit;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs ul{
| + | |
| - | font: normal 11px Arial, Verdana, sans-serif;
| + | |
| - | margin:0;
| + | |
| - | padding:0;
| + | |
| - | list-style:none;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs li{
| + | |
| - | display:inline;
| + | |
| - | margin:0 2px 0 0;
| + | |
| - | padding:0;
| + | |
| - | text-transform:uppercase;
| + | |
| - | }
| + | |
| - | | + | |
| - | | + | |
| - | .ddcolortabs a{
| + | |
| - | float:left;
| + | |
| - | color: white;
| + | |
| - | background: black url(media/color_tabs_left.gif) no-repeat left top;
| + | |
| - | margin:0 2px 0 0;
| + | |
| - | padding:0 0 1px 3px;
| + | |
| - | text-decoration:none;
| + | |
| - | letter-spacing: 1px;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs a span{
| + | |
| - | float:left;
| + | |
| - | display:block;
| + | |
| - | background: transparent url(media/color_tabs_right.gif) no-repeat right top;
| + | |
| - | padding: 4px 8px 2px 7px;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs a span{
| + | |
| - | float:none;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs a:hover{
| + | |
| - | background-color: #591f20;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs a:hover span{
| + | |
| - | background-color: #591f20;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabs .selected a, #ddcolortabs .selected a span{ /*currently selected tab*/
| + | |
| - | background-color: #591f20;
| + | |
| - | }
| + | |
| - | | + | |
| - | .ddcolortabsline{
| + | |
| - | clear: both;
| + | |
| - | padding: 0;
| + | |
| - | width: 100%;
| + | |
| - | height: 8px;
| + | |
| - | line-height: 8px;
| + | |
| - | background: black;
| + | |
| - | border-top: 1px solid #fff; /*Remove this to remove border between bar and tabs*/
| + | |
| - | }
| + | |
| - | | + | |
| - | /* ######### Style for Drop Down Menu ######### */
| + | |
| - | | + | |
| - | .dropmenudiv_a{
| + | |
| - | position:absolute;
| + | |
| - | top: 0;
| + | |
| - | border: 1px solid black; /*THEME CHANGE HERE*/
| + | |
| - | border-top-width: 8px; /*Top border width. Should match height of .ddcolortabsline above*/
| + | |
| - | border-bottom-width: 0;
| + | |
| - | font:normal 12px Arial;
| + | |
| - | line-height:18px;
| + | |
| - | z-index:100;
| + | |
| - | background-color: white;
| + | |
| - | width: 200px;
| + | |
| - | visibility: hidden;
| + | |
| - | }
| + | |
| - | | + | |
| - | | + | |
| - | .dropmenudiv_a a{
| + | |
| - | width: auto;
| + | |
| - | display: block;
| + | |
| - | text-indent: 5px;
| + | |
| - | border-top: 0 solid #678b3f;
| + | |
| - | border-bottom: 1px solid #678b3f; /*THEME CHANGE HERE*/
| + | |
| - | padding: 2px 0;
| + | |
| - | text-decoration: none;
| + | |
| - | color: black;
| + | |
| - | }
| + | |
| - | | + | |
| - | * html .dropmenudiv_a a{ /*IE only hack*/
| + | |
| - | width: 100%;
| + | |
| - | }
| + | |
| - | | + | |
| - | .dropmenudiv_a a:hover{ /*THEME CHANGE HERE*/
| + | |
| - | background-color: #8a3c3d;
| + | |
| - | color: white;
| + | |
| - | }
| + | |
| - | </style>
| + | |
| - | </head>
| + | |
| - | | + | |
| - | <!-- CSS for Drop Down Tabs Menu #1 -->
| + | |
| - | <link rel="stylesheet" type="text/css" href="ddcolortabs.css" />
| + | |
| - | | + | |
| - | <div id="colortab" class="ddcolortabs">
| + | |
| - | <ul>
| + | |
| - | <li><a href="https://2008.igem.org/Team:Edinburgh" title="Home"><span>Home</span></a></li>
| + | |
| - | <li><a href="https://2008.igem.org/Team:Edinburgh/Project" title="Project" rel="dropmenu1_a"><span>The Project</span></a></li>
| + | |
| - | <li><a href="https://2008.igem.org/Team:Edinburgh/Team" title="Team" ><span>The Team</span></a></li>
| + | |
| - | <li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=Edinburgh" title="Project" rel="dropmenu1_a"><span>BioBrick Parts</span></a></li>
| + | |
| - | <li><a href="https://2008.igem.org/Team:Edinburgh/Modeling" title="Modelling" rel="dropmenu2_a"><span>Modelling</span></a></li>
| + | |
| - | <li><a href="https://2008.igem.org/Team:Edinburgh/Notebook" title="Notebook"><span>Notebook</span></a></li>
| + | |
| - | </ul>
| + | |
| - | </div>
| + | |
| - | <div class="ddcolortabsline"> </div>
| + | |
| - | <div id="dropmenu1_a" class="dropmenudiv_a">
| + | |
| - | <a href="https://2008.igem.org/Team:Edinburgh/Team">Overview</a>
| + | |
| - | <a href="https://2008.igem.org/Team:Edinburgh/Team">Step1</a>
| + | |
| - | <a href="https://2008.igem.org/Team:Edinburgh/Team">Step2</a>
| + | |
| - | </div>
| + | |
| - | <script type="text/javascript">
| + | |
| - | //SYNTAX: tabdropdown.init("menu_id", [integer OR "auto"])
| + | |
| - | tabdropdown.init("colortab", 3)
| + | |
| - | </script>
| + | |
| - | </html>
| + | |
| | | | |
| - | For more information, please see [https://www.wiki.ed.ac.uk/display/iGEM2008/HOME our internal wiki].
| + | == Calendar == |
| | | | |
| - | = Calender =
| + | Click on a date to see a summary of labwork done on that day. Up-to-date to end 12 October. Best viewed with Mozilla Firefox. |
| | | | |
| | <table> | | <table> |
| Line 319: |
Line 31: |
| | | | |
| | {|style="font color="#ffffff"; "background-color:"#cd0000"; cellpadding="0" cellspacing="4" border="4" bordercolor="#000"; border-spacing:0px; text-align:center" width="250px" | | {|style="font color="#ffffff"; "background-color:"#cd0000"; cellpadding="0" cellspacing="4" border="4" bordercolor="#000"; border-spacing:0px; text-align:center" width="250px" |
| - | <h3>Calendar</h3>
| |
| - | |-
| |
| - | |
| |
| - | <td><td> {{#calendar: title=Edinburgh |year=2008 | month=06}}
| |
| - | <td><td> {{#calendar: title=Edinburgh |year=2008 | month=07}}
| |
| - | <td><td> {{#calendar: title=Edinburgh |year=2008 | month=08}}
| |
| - | </td></tr>
| |
| - | |-
| |
| - | |
| |
| | </table> | | </table> |
| | | | |
| | + | {| align="center" |
| | + | |-valign="top" |
| | + | |align="center" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=06}} |
| | + | |align="center" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=07}} |
| | + | |align="center" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=08}} |
| | + | |align="center" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=09}} |
| | + | |align="center" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=10}} |
| | + | |} |
| | | | |
| | + | == Summary of samples == |
| | | | |
| - | = Lab Notebook =
| + | Up-to-date to end 28 October. |
| - | === Week 1 ===
| + | |
| - | ==== Tuesday 17 June 08 ====
| + | |
| - | | + | |
| - | * Prepared competent JM109 cells using TSS method. 25 tubes of 0.2 ml were prepared, labelled 'iGEM 17-6-8 Jnn' where nn is a number from 01 to 25. These are in the pink box in Garry's -80°C freezer.
| + | |
| - | | + | |
| - | ==== Thursday 19 June 08 ====
| + | |
| - | | + | |
| - | * Eluted DNA for BioBrick E0240 (GFP) from square 1001, well 4B and used this to transform half of tube J25; other half was transformed with 1.5μl of J33207 (Edinbrick1) as a control to test the competence of the cells. Plated 100 microlitres of each to LA+amb+BW. Incubate at 37°C overnight.<br />
| + | |
| - | '''Plate 1:''' JM109 transformation with E0240 eluted DNA.<br />
| + | |
| - | '''Plate 2:''' JM109 transformation with J33207 plasmid DNA (control).
| + | |
| - | | + | |
| - | ==== Friday 20 June 08 ====
| + | |
| - | | + | |
| - | * '''Result of transformation:''' the positive control was highly successful, with hundreds of colonies, but no colonies were present on the plate transformed with the BioBrick DNA indicating some problem with the DNA elution. Need to check that we got the method right.
| + | |
| - | * Ordered primers for ''dxs'', ''appY'' and ''glgC''. There are no forbidden restriction sites in the first two, so primers with full prefix and partial suffix were ordered to clone as EcoRI-SpeI fragments, but ''glgC'' has two EcoRI sites which will have to be mutated out. We therefore had a choice of cloning it initially as a XbaI-PstI fragment, or attempting the BABEL system, and decided to try BABEL first. If it proves too unreliable, we will need to order new primers to clone it the old-fashioned way.<br />
| + | |
| - | '''Primer dxsf1:''' gat '''gaattc''' gcggccgc t '''tctaga''' tg agt ttt gat att gcc<br />
| + | |
| - | '''Primer dxsr1:''' gc t '''actagt''' a tt a tta tgc cag cca ggc ctt g<br />
| + | |
| - | '''Primer appyf1:''' gat '''gaattc''' gcggccgc t '''tctaga''' tg gat tat gtt tgc tcc<br />
| + | |
| - | '''Primer appyr1:''' gct '''actagt''' a tta tt a gtc aat tgt ttt gtt tat tcc<br />
| + | |
| - | '''Primer glgcf1:''' atg gtt agt tta gag aag aac gat c<br />
| + | |
| - | '''Primer glgcr1:''' tta tta tcg ctc ctg ttt atg ccc taa c<br />
| + | |
| - | | + | |
| - | === Week 2 ===
| + | |
| - | ==== Tuesday 24 June 08 ====
| + | |
| - | | + | |
| - | * Sarah S wants to revive one of the BioBricks from the Registry (pBad+''gfp''), so we'll see whether she can get it to work.
| + | |
| - | | + | |
| - | ==== Wednesday 25 June 08 ====
| + | |
| - | | + | |
| - | * Primers arrived. Made up 500μM stock solutions in EB and 10μM working solutions (f and r together) in water. Performed PCR with KOD, annealing at 55°C and extending for 38s (expected sizes are: ''dxs'' 1862 + prefix and suffix; ''appY'' 749 + prefix and suffix; ''glgC'' 1295 with no prefix or suffix (except the extra TAA). Result: all looked good, nice pure bands.<br />
| + | |
| - | '''Gel 1:''' markers, empty lane, ''dxs'', ''appY'', ''glgC'', ''appY'' (repeat), ''glgC'' (repeat), markers.
| + | |
| - | | + | |
| - | ==== Thursday 26 June 08 ====
| + | |
| - | | + | |
| - | * Purified DNA from PCR reactions. Used 20 microlitres of glass beads and eluted to 40 microlitres of TE.<br />
| + | |
| - | '''Sample P1:''' ''dxs'' PCR product<br />
| + | |
| - | '''Sample P2:''' ''appY'' PCR product<br />
| + | |
| - | '''Sample P3:''' ''glgC'' PCR product<br />
| + | |
| - | * Set up digests to clone ''appY'' and ''dxs'' into Edinbrick1. Digests with 32μl water, 5μl buffer E, 4μl Edinbrick1 DNA, 4μl purified PCR product, 2.5μl SpeI, 2.5μl EcoRI. Incubated at 37°C. Purified. Set up ligations:<br />
| + | |
| - | '''Ligation L1:''' ''dsx'' + Edinbrick1, EcoRI/SpeI<br />
| + | |
| - | '''Ligation L2:''' ''appY'' + Edinbrick1, EcoRI/SpeI<br />
| + | |
| - | '''Ligation L3:''' ''glgC'' (5μl) \+linear Babel1 (16-2-8, 2μl) with PNK<br />
| + | |
| - | '''Ligation L4:''' ''glgC'' (5μl) \+linear Babel2 (18-2-8, 2μl) with PNK<br />
| + | |
| - | Incubate ligations at 16 C overnight.
| + | |
| - | | + | |
| - | ==== Friday 27 June 08 ====
| + | |
| - | | + | |
| - | * Ordered ''Cellulomonas fimi'' ATCC 484 (NCIB 8980, DSM 20113) from DSMZ.
| + | |
| - | * Transformations of the iGEM competent JM109 cells with ligations L1 to L4. In each case, 100μl of cells were transformed with 5μl of ligation, and the remaining 5μl of each ligation was frozen so that it could be analysed if the transformations fail. Fresh Blue-White ampicillin plates were prepared.<br />
| + | |
| - | '''Plate 3:''' Ligation L1, 100μl<br />
| + | |
| - | '''Plate 4:''' Ligation L2, 100μl<br />
| + | |
| - | '''Plate 5:''' Ligation L3, 100μl<br />
| + | |
| - | '''Plate 6:''' Ligation L4, 100μl<br />
| + | |
| - | '''Plate 7:''' Ligation L1, 900μl<br />
| + | |
| - | '''Plate 8:''' Ligation L2, 900μl<br />
| + | |
| - | '''Plate 9:''' Ligation L3, 900μl<br />
| + | |
| - | '''Plate 10:''' Ligation L4, 900μl<br />
| + | |
| - | | + | |
| - | ==== Saturday 28 June 08 ====
| + | |
| - | | + | |
| - | * '''Result of transformations:'''<br />
| + | |
| - | '''Plate 3:''' 1 white; '''Plate 7:''' 5 white, 13 blue.<br />
| + | |
| - | '''Plate 4:''' no growth; '''Plate 8:''' no growth.<br />
| + | |
| - | '''Plate 5:''' 1 white; '''Plate 9:''' 3 white, 20 blue, possible signs of phage.<br />
| + | |
| - | '''Plate 6:''' maybe one tiny white; '''Plate 10:''' 7 white, 9 blue.<br />
| + | |
| - | The white colonies were transferred to fresh plates of the same medium:<br />
| + | |
| - | '''Plate 11:''' possible pSB1A2+''dxs'' transformants.<br />
| + | |
| - | '''Plate 12:''' possible Babel1+''glgC'' transformants.<br />
| + | |
| - | '''Plate 13:''' possible Babel2+''glgC'' transformants.<br />
| + | |
| - | The new plates were incubated at 37°C. The old plates were left at room temperature to see if any further colonies would appear.
| + | |
| - | | + | |
| - | ==== Sunday 29 June 08 ====
| + | |
| - | | + | |
| - | * Streaks on plate 12 show strong signs of phage infection and are unusable apart from the single white one from plate 5. At least one of the streaks on plate 13 also has a couple of plaques, but plate 11 looks fine. This suggests that phage may have come from the Babel DNA stock (or the PNK, which seems unlikely). Set up overnight cultures (2.5ml LB in 20ml bijoux) for minipreps. Numbers 1 to 6 are pSB1A2+''dxs'' from plate 11, all white, number 7 is from plate 12 (the white clone from plate 5), and 8 to 12 are from plate 13, white or pale blue. Incubated at 37°C with shaking.
| + | |
| - | * Also note: a couple more colonies turned up on plates 5 and 6. The one on 6 looks like an escape, but the one on 5 looks OK. Subbed them both to a fresh plate ('''Plate 14'''). Previous plates, apart from plates 4 and 8 which had no growth, were transferred to the cold storage room.
| + | |
| - | | + | |
| - | === Week 3 ===
| + | |
| - | ==== Monday 30 June 08 ====
| + | |
| - | | + | |
| - | * Plasmid DNA minipreps:<br />
| + | |
| - | '''M1 to M6:''' pSB1A2+''dxs'' white colonies<br />
| + | |
| - | '''M7:''' Babel1+''glgC'' white colony<br />
| + | |
| - | '''M8 to M12:''' Babel2+''glgC'' white and pale blue colonies<br />
| + | |
| - | Minipreps M1 to M6 were digested with EcoRI and PstI ('''Gel 2'''). The expected pattern is pSB1A2 vector band at 2.04kb (2079 bp less prefix and suffix) and ''dxs'' insert band around 1.9kb. M1 showed bands around 1.1kb and 2.1kb. M5 showed no DNA. The other four showed a vector-like band around 2kb and a fainter, fuzzier band around 3kb, possibly a 'ghost' band. Thus none of the clones show the expected pattern of bands (although it is conceivable, since the vector and insert bands are so close in size, that they may be lying on top of each other; ''dxs'' has an internal EcoRV site at +504 and two HindIII sites at +606 and +1230, whereas pSB1A2 lacks such sites so this could be used to check). In conjunction with the total lack of growth on the ''appY'' plates, this suggests that something went wrong in the cloning procedure. The next step is to run the remaining ligation material on a gel and see what it looks like.
| + | |
| - | | + | |
| - | ==== Tuesday 1 July 08 ====
| + | |
| - | | + | |
| - | '''Gel 3:''' minipreps M2, M3, M4 and M6 (pSB1A2+''dxs'' clones) digested with EcoRI alone; lanes 5 and 6, 2.5μl of ligations L1 and L2. Result: all 4 minipreps now give a 4.2kb band (plus the same 3.2kb 'ghost' band as before) consistent with pSB1A2 carrying a 2kb insert. Would be nice to confirm identity using HindIII (2 internal sites). Both ligations show clear signs of insert and vector bands (oddly, the ''dxs'' insert band overlaps the pSB1A2 vector band whereas the ''appY'' insert band overlaps the ''lacZ'' insert excised from Edinbrick1). However, no ligated bands are visible. Thus the DNA purification is fine; if there was a a problem, it is with the ligase or ligase buffer.<br />
| + | |
| - | '''Gel 4:''' Minipreps M7 to M12 (supposed to be ''glgC'' in Babel vectors) digested with EcoRI and PstI to excise the inserts. M10 and M11 have a single 3kb band consistent with vector, but no insert band at 1.2kb. M7, M8, M9 and M12 all show a single band at about 2.4kb which is not consistent with Babel vectors if properly digested. Unless the digests totally failed, none of these plasmids would seem to contain ''glgC''.
| + | |
| - | * '''BUT WAIT:''' Turns out gel 4 has undigested plasmid DNA rather than the EcoRI/PstI digests. These were run on '''Gel 5'''. Since ''glgC'' is about 1295bp with internal EcoRI sites at +570 and +1067, we would expect to see a vector band at 3kb and the insert cut into bands of around 570bp, 567bp and 228bp. This is precisely what we see in the case of M10 and M11. We can therefore conclude that '''M10 and M11''' both represent the Babel2+''glgC'' BioBrick. This is not sufficient to determine the orientation, but a single EcoRI digest of these two clones should be sufficient to establish that. Even if both are in the reverse orientation, they can still be used as templates for the three mutagenesis step which will be required to produce the final BioBrick.
| + | |
| - | * Also attempted HindIII digests of M2, M3, M4 and M6 to confirm that the insert is really ''dxs'', despite knowing that the HindIII stock expired in 2002. Results are shown on '''Gel 6''' lanes 1 to 4. In all cases a 0.6kb band was excised, consistent with ''dxs'' insert. It therefore seems likely that M2, M3, M4 and M6 all represent pSB1A2+''dxs'' coding sequence BioBrick.
| + | |
| - | * Also did fusion PCR for the BABEL1+''glgC'' and BABEL2+''glgC'' constructs, using 1μl of L3 and L4 as templates ('''P4 and P5'''). KOD was used, with primers stdvectf1 and glgCr1, annealing at 65°C and extending for 110s. Results are shown on '''Gel 6''' lanes 5 and 6. P4 (BABEL1) has a strong band the right size and would probably work if self-ligated, but P5 (BABEL2) shows strong bands at 2 and 3 kb, as CK is also seeing. I suspect that primer stdvectf1 does not work well with BABEL2 - possibly mis-anneals to the other end of the vector. In any event, we can delay the decision as to whether or not to carry on with these until we know the results from M10 and M11.
| + | |
| - | | + | |
| - | ==== Wednesday 2 July 08 ====
| + | |
| - | | + | |
| - | * Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear ('''Gel 7'''). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites:<br />
| + | |
| - | '''primer glgcm1f:''' tgttgaaaaacctgctaaccc<br />
| + | |
| - | '''primer glgcm1r:''' aattcgataattttatcgttctc<br />
| + | |
| - | '''primer glgcm2f:''' ctcattctgcaacattgattcc<br />
| + | |
| - | '''primer glgcm2r:''' ttcacgcgaacgcgcgag<br />
| + | |
| - | | + | |
| - | ==== Thursday 3 July 08 ====
| + | |
| - | | + | |
| - | * Clones M2, M10 and M11 were submitted for sequencing using primers pSB1A2f1 and pSB1A2r1 (for M2) and pTG262f1 and pTG262r1 (for M10 and M11). We should get the results on Monday.
| + | |
| - | * Ordered primers to make carotenoid biosynthesis BioBricks:<br />
| + | |
| - | '''primer crtIf2:''' gat gaattc gcggccgc t tctag atg aaa cca act acg gta att g<br />
| + | |
| - | 22 matches, 8 GC = 32 C, 14 AT = 28 C, total 60°C, total length = 45<br />
| + | |
| - | 83.2°C, moderate, no<br />
| + | |
| - | '''primer crtIr2:''' gct actagt a tta tt a tat cag atc ctc cag cat c<br />
| + | |
| - | 20 matches, 9 GC = 36, 11 AT = 22, total 58°C, length = 35<br />
| + | |
| - | 66.1°C, weak, no<br />
| + | |
| - | '''primer crtBf2:''' gat gaattc gcggccgc t tctag atg aat aat ccg tcg tta ctc<br />
| + | |
| - | 21 matches, 8 GC = 32, 13 AT = 26, total 58°C. length = 44<br />
| + | |
| - | 82.9°C, moderate, no<br />
| + | |
| - | '''primer crtYf2:''' gat gaattc gcggccgc t tctag atg caa ccg cat tat gat ctg<br />
| + | |
| - | 21 matches, 9 GC = 36,12 AT = 24, total 60°C, length = 44<br />
| + | |
| - | 86.4°C, very strong, no<br />
| + | |
| - | Note that we already have a compliant ''crtE'' BioBrick (I hope), and the reverse primers crtBr2 and crtYr2 should be fine (see iGEM2007 lab book, page 90).
| + | |
| - | * Retransformed JM109 with the remainder of the ''appY'' ligation (I re-ligated it, and also heat-treated it before the transformation, since Tom Knight reports that this can increase transformation efficiency). Plated this to '''Plates 15 and 16'''.
| + | |
| - | | + | |
| - | ==== Friday 4 July 08 ====
| + | |
| - | | + | |
| - | * Repeat ''appY'' transformation has failed: no colonies on plates 15 and 16. It seems unlikely that there is a major problem with the competent cells since other transformations have worked. Other than this, the only way to get no colonies (not even recircularized vector) is if something went seriously wrong in the original digest.
| + | |
| - | * Mutagenic primers for ''glgC'' arrived. Prepared 500μM stock solutions and 10μM working solutions. Tried PCR with both primer pairs using M11 (0.5μl) as template, just to check that the primers are OK. Annealing was at 57°C (lowest melting temperature of a primer) and extension for 110s using KOD (PCR reactions '''P6 and P7'''). Products (5μl) were run on '''Gel 8'''. P6 (M1) shows a single rather faint band at 4.2kb; P7 (M2) shows multiple bands, with the 4.2kb band strongest. Probably both pairs are fine for MABEL. Now we just need to wait for the sequencing results on Monday.
| + | |
| - | * Also ran the other 5μl left from the religated L2 on gel 8. No DNA was visible. Did another digest (30μl total volume with 2μl each P2 and Edinbrick1, using Buffer E with EcoRI and SpeI, digesting at 37°C for about 5 hours, mainly because I forgot about it). Purified and ligated: Ligation '''L5'''.
| + | |
| - | | + | |
| - | ==== Saturday 5 July 08 ====
| + | |
| - | | + | |
| - | * Streaked ''Pantoea ananatis'' DSM 30080 from cryogenic stock to LA ('''Plate 17''') and incubated at 30°C so that we will have a fresh stock of cells to make the ''crt'' BioBricks. Transformed competent cells tube J21 with ligation L5 (pSB1A2+''appY'')('''Plates 18 and 19''').
| + | |
| - | | + | |
| - | ==== Sunday 6 July 08 ====
| + | |
| - | | + | |
| - | * Result of ''appY'' transformation: one white colony (subcultured to '''plate 20'''). Several more possible small white ones right at the edge: plate left overnight to grow a bit more.
| + | |
| - | | + | |
| - | === Week 4 ===
| + | |
| - | ==== Monday 7 July 08 ====
| + | |
| - | | + | |
| - | * Several more white colonies have grown on plate 19, but quite small and close together. Tried to sub these to '''Plate 21'''.
| + | |
| - | * Nimisha and the team did two maxipreps - '''X1''' (J33201), and '''X2''' (the ''dxs'' clone of miniprep M2). X2 digested with HindIII (single restriction digest).
| + | |
| - | * Purified the mutagenic PCR reactions P6 and P7, and set up self ligations ('''L6 and L7''').
| + | |
| - | * Sequence results for ''glgC'' clones M10 and M11 show that both are in reverse orientation. The result for the ''dxs'' clones M2 looks OK at first glance, but can't see restriction sites since sequencing primers pSB1A2insf1 and pSB1A2insr1 were used rather than pSB1A2f2 and pSB1A2r2.
| + | |
| - | | + | |
| - | ==== Tuesday 8 July 08 ====
| + | |
| - | | + | |
| - | * New primers for ''crt'' BioBricks arrived. Performed PCR with KOD using primer pairs crtBf2 (new) + crtBr2 (old)('''P8'''), crtIf2 + crtIr2 (both new) ('''P9'''), and crtYf2 (new) + crtYr2 (old)('''P10'''). The template for P8 and P10 was a suspension of ''Pantoea ananatis'' cells from plate 17; for P9, Douglas's maxiprep DNA from 19 Feb (with the PstI sites mutated out) was used. In all cases annealing was at 55 C and extension for 30s. '''Gel 9''' showed that P8 and P9 had worked, with pure products of the expected size seen, but no product was seen for P10.
| + | |
| - | * ''glgC'' mutagenesis: Transformed competent cells with ligation products L6 and L7; plated cells on '''Plates 22 and 23''' (L6) and '''Plates 24 and 25''' (L7).
| + | |
| - | * ''dxs'': Ran gel (Gel 9) to check size of X1 (J33201) and X2 (pSB1A2+''dxs'') HindIII restriction digest. The digest looked fine.
| + | |
| - | | + | |
| - | ==== Wednesday 9 July 08 ====
| + | |
| - | | + | |
| - | * Results of L6 and L7 transformations: no colonies for L6, but 9 colonies were obtained from L7. These were subcultured to '''plates 26 and 27'''. By the end of the day, these had grown sufficiently for 6 overnight cultures to be set up for minipreps tomorrow. In theory, some or all of these should be ''glgC'' with EcoRI site 2 mutated out.
| + | |
| - | * Minipreps '''M13 to M18''' of possible pSB1A2+''appY' transformants. Digests with EcoRI/PstI were run on '''Gel 10'''. All but M13 looked OK (insert band on M14 was so faint as to be ambiguous, but M15 to M18 all look good).
| + | |
| - | * Digests and ligation '''L8''' for addition of a synthetic ribosome binding site M2 (which has now been entered into the Registry as '''BBa_K118000''').
| + | |
| - | | + | |
| - | ==== Thursday 10 July 08 ====
| + | |
| - | | + | |
| - | * Subitted M15 (possible pSB1A2+''appY'') for sequencing with primers pSB1A2insf2 and pSB1A2insr2.
| + | |
| - | * Minipreps '''M19 to M24''' of possible ''glgC'' mutants with EcoRI site 2 removed. EcoRI digests were run on '''Gel 11'''. The insert bands are a bit fuzzy, but it looks as though '''M19, M21 and M22''' may have lost the site, and M20, M23 and M24 may still have it.
| + | |
| - | * PCR '''P11''' using ligation L8 as template to generate a fusion product of rbs+''dxs''. Run on '''Gel 11''', last lane. No product visible.
| + | |
| - | * Digested P8 and P9 (''crtB'' and ''crtI''-mut PCR products) with EcoRI/SpeI together with Edinbrick1, purified and ligated (ligations '''L9 and L10''') at 16°C overnight.
| + | |
| - | | + | |
| - | ==== Friday 11 July 08 ====
| + | |
| - | | + | |
| - | * Submitted M19, M21 and M22 for sequencing using primer pTG262f1, to check for clean removal of the EcoRI site.
| + | |
| - | * Revived ''Cellulomonas fimi'' in NB and plated to NA and NA+glucose. '''Plates 28 and 29''' incubated at 30°C.
| + | |
| - | * ZY and XH repeated rbs+''dxs'' ligation ('''L11''').
| + | |
| - | * Transformation of JM109 with L9 (pSB1A2+''crtB'' )and L10 (pSB1A2+''crtI''-mut). '''Plates 30 to 33'''.
| + | |
| - | * possible rbs+''dxs'' clones from un-numbered plates were streaked to '''plate 34'''.
| + | |
| - | | + | |
| - | ==== Saturday 12 July 08 ====
| + | |
| - | | + | |
| - | * Result of transformation: ''crtB'' 100μl, 22 white and 10 blue; 900μl, too numerous to count, about two thirds white; a few blue showed signs of phage-like lysis. For ''crtI'' mutant, 100μl, 4 white and 2 blue; 900μl, 143 white and 25 blue. White ''crtB'' colonies were patched to '''Plate 35''', ''crtI'' to '''Plate 36'''.
| + | |
| - | * Set up overnight cultures of possible rbs+''dxs'' clones from plate 34 for minipreps.
| + | |
| - | | + | |
| - | ==== Sunday 13 July 08 ====
| + | |
| - | | + | |
| - | * Signs of growth on ''Cellulomonas'' plates 28 and 29.
| + | |
| - | * '''Minipreps M25 to M30''' of possible rbs+''dxs'' clones from plate 34.
| + | |
| - | * '''PCR P12''' to obtain rbs+''dxs'' fusion product in case minipreps didn't work. Template was ligation L11, and primers were rbs2clonf1 and pSB1A2insr1. Annealing was 58°C, extension 40s using KOD.
| + | |
| - | | + | |
| - | === Week 5 ===
| + | |
| - | ==== Monday 14 July 08 ====
| + | |
| - | | + | |
| - | * Digests and ligation '''L12''' to add rbs to ''appY'' clone M15 (sequence back today, seems OK).
| + | |
| - | * Minipreps '''M31 to M42''' of ''crtB'' and ''crtI'' clones. Digests with EcoRI/PstI. (AM)
| + | |
| - | | + | |
| - | ==== Tuesday 15 July 08 ====
| + | |
| - | | + | |
| - | * PCR '''P15''': fusion PCR of rbs+''appY'' using L15 as template. Extension 20s, annealing 58°C, same primer set as before. '''Gel 13''' shows that it worked OK.
| + | |
| - | * '''Gel 13''' also shows digests of M31 to M42 from yesterday.
| + | |
| - | * Transformation of JM109 with ligations L13 and L15 (''glgC'' mutation and rbs+''dxs'' cloning). Plated to '''plates 39 to 41'''.
| + | |
| - | | + | |
| - | ==== Wednesday 16 July 08 ====
| + | |
| - | | + | |
| - | Meeting with other UK iGEM teams.
| + | |
| - | | + | |
| - | ==== Thursday 17 July 08 ====
| + | |
| - | | + | |
| - | * PCR for ''cenA'', ''cenB'', ''cenC'' and ''cex'' ('''P16''', '''P17''', '''P18''', '''P19'''). Annealing 58°C, extension 115s (''cenB'' and ''cenC'' are both over 3kb) and included 5% v/v glycerol in the reactions since in the past that has been helpful with high GC templates. PCR products purified to be run on gel tomorrow (against wisdom, since they should have been run on gel both before and after purification).
| + | |
| - | * Results of transformations: plenty of colonies for ''glgC'' mutation (mutating site 1 in the mutant which already has site 2 mutated). Subbed some of these to '''plates 42, 44 and 45''' (poor communications). Only a few colonies for rbs+''dxs'', and only one of these was white. Subbed this to '''plate 43'''. Apparently there may have been some problem with the purification of this digest - may need to repeat.
| + | |
| - | * Re-digested M32, M36 (''pSB1A2-crtB''), M39 and M40 (''pSB1A2-crtI'') and ran on '''Gel 15'''. Gel unsuccessful - stain smeared over 0.5-2kb region, exactly where ''crtB'' and ''crtI'' bands are expected to appear. Perhaps too much loading buffer or problem with the tank (tank with 'loose wire' was used). (AM)
| + | |
| - | * pSB1A2+''appY'' cultures set up in beaker for maxiprep tomorrow ('''X3'''). (AM)
| + | |
| - | | + | |
| - | ==== Friday 18 July 08 ====
| + | |
| - | | + | |
| - | * Made pSB1A2+''appY'' Maxiprep *X3*. (AM)
| + | |
| - | * Purified PCR products for ''cenA'', ''cenB'', ''cenC'' and ''cex'' ('''P16''', '''P17''', '''P18''', '''P19''') run on '''Gel 16'''. No visible bands. (AM)
| + | |
| - | * Second attempt at PCR for ''cenA'', ''cenB'', ''cenC'' and ''cex'' ('''P20''', '''P21''', '''P22''', '''P23'''). Annealing 55°C, extension 85s; did ''not'' include glycerol. Ran unpurified PCR products on '''Gel 17''' - no bands apart from thick bands in the <0.5kb region = primers. Hence, PCR was unsuccessful. (AM)
| + | |
| - | | + | |
| - | ==== Saturday 19 July 08 ====
| + | |
| - | | + | |
| - | * Minipreps '''M43 to M47''' of possible ''glgC'' double mutants (both EcoRI sites gone), and '''M48''' of the only white colony from the pSB1A2+rbs+''dxs'' transformation. '''Gel 18''' shows EcoRI/PstI digests of 3μl. M43 to M47 all look about right: send one for sequencing. M48 is ambiguous, could be incomplete deigestion, need to repeat. (CF)
| + | |
| - | * PCR '''P24 and P25''', repeat PCR for ''cenA'' and ''cex'' (the two shorter genes) using Pfu polymerase instead of KOD, adding 5% glycerol - this worked well for high-GC genes from ''Saccharothrix espanaensis'' last year. (CF)
| + | |
| - | | + | |
| - | ==== Sunday 20 July 08 ====
| + | |
| - | | + | |
| - | * Ran P24 and P25 on '''Gel 19'''. No amplification products. Time to do some trouble shooting. The fault is in either the primers, the template, or the reactions. All previous reactions have been fine, so most likely the primers or template. To check this, we need to do a positive control using universal primers such as fd1 and rd1 (amplify 16S rRNA gene ''rrnB'') which should definitely give a product. If these fail, then it is most likely that the template is at fault - we should prepare genomic DNA and try using this as template rather than cells; also do a Gram stain to confirm that the cells look OK. If the control reaction works, try remaking the primer solutions, though it seems unlikely that all four sets could be wrong, unless I was having a really bad day. (CF)
| + | |
| - | * Redid digest of M48 with SacI/Spe1. Does not look good. Also repeated digests of ''crtB'' and ''crtI'' clones M36 and M42; alternating single digests (EcoRI) and double digests (EcoRI/PstI) to check for inserts. Look OK. Submit for sequencing. (CF)
| + | |
| - | * Also: I have a plan for in vitro assembly to cut down on transformations and minipreps. Could have a try of this next week if there are some students with some free time. (CF)
| + | |
| - | | + | |
| - | === Week 6 ===
| + | |
| - | ==== Monday 21 July 08 ====
| + | |
| - | | + | |
| - | * M36 (''crtB''), M42 (''crtI'') and M43 (''glgC''-mut1,2) submitted for sequencing. (AH)
| + | |
| - | * Plates 46 and 46 have no colonies (white or blue) - Something went wrong with the transformation. (AH)
| + | |
| - | | + | |
| - | ==== Tuesday 22 July 08 ====
| + | |
| - | | + | |
| - | * Positive control PCR with universal primers fd1 and rd1 to amplify 16S rRNA gene ''rrnB'' from ''C. fimi'' ('''P26'''); PCR products run on '''Gel 21''' - failed. (AM)
| + | |
| - | * Made overnight culture of ''C. fimi'' from plate 37 for chromosomal DNA purification tomorrow. (AM)
| + | |
| - | * M36 (''crtB'') and M42 (''crtI'') double digested, ligated with rbs to make '''L17''' (M36) and '''L18''' (M42). (YAN & OG)
| + | |
| - | * L15 (rbs+''dxs'' ligation to Edinbrick1) and L16 (rbs+''appY'' ligation to Edinbrick1) run on gel, the result showed the ligations into edinbrick1 failed. (YAN & OG)
| + | |
| - | | + | |
| - | ==== Wednesday 23 July 08 ====
| + | |
| - | | + | |
| - | * M43 (''glgC''-mut1,2) sequence results received. First and second mutation sites successfully removed. (AH)
| + | |
| - | * Overnight culture of ''C. fimi'' did not yield sufficient cells. Made two more cultures in nutrient broth; all cultures incubated at 30°C with shaking. (AM)
| + | |
| - | * PCR of ''crtY'' from ''P. ananatis'' cells ('''P27''') and ''crtB'' and ''crtI'' from ligations L17 and L18 respectively ('''P28, P29'''). PCR products were run on '''Gel 22''' ~ P28 and P29 successful, P27 unsuccessful. (AM, YZJ, OG)
| + | |
| - | * Re-did positive control PCR for ''rrnB'' from ''C. fimi'' ('''P30''') ~ denaturing at 95°C for 20s, annealing at 55°C for 1 minute, extension at 70°C for 30s. The first two settings were in error; ''denaturing'' should have been set to 1 minute and annealing to 10 sec as usual. HOWEVER, annealing for 1 minute appears to have worked, so it might be worth trying this for PCRing the cellulases. (AM)
| + | |
| - | * P30 (the above) and pZntA were run on '''Gel 23'''. Both successful. (AM)
| + | |
| - | | + | |
| - | ==== Thursday 24 July 08 ====
| + | |
| - | | + | |
| - | * Purified PCR products P28 and P29 (OG)
| + | |
| - | * Double digestions using XbaI/PstI (buffer H) to add P12 (rbs+''dxs''), P15 (rbs+''appY''), P28 (rbs+''crtB'') and P29 (rbs+''crtI'') to Edinbrick1. (Yan, OG)
| + | |
| - | * Double digestion using SacI/SpeI (BufferE) to add P31 (pZntA) to Edinbrick1. (Yan, OG)
| + | |
| - | * Purified genomic DNA from ''C. fimi'' culture (made from plate 37, incubated in 25ml bottle at 30C for 48 hours with shaking). Used Promega Wizard Genomic DNA Purification Kit, lysozyme and RNAse+EDTA (as replacement for proprietary RNAse Solution, of which none was left). Final solution left overnight in refrigerator at 4°C. (AM)
| + | |
| - | * Plated ''C. fimi'' culture from plate 37...
| + | |
| - | ** Incubated in 25ml bottle for 48 hours at 30°C with shaking ... to '''Plate 48'''.
| + | |
| - | ** Incubated in 50ml bottle for 24 hours at 30°C with shaking ... to '''Plate 49'''.
| + | |
| - | ** Incubated in 250ml flask for 24 hours at 30°C with shaking ... to '''Plate 50'''. (AM)
| + | |
| - | * PCR of ''cenA'' ('''P32'''), ''cenB'' ('''P33'''), ''cenC'' ('''P34'''), ''cex'' ('''P35'''), annealing 1 min 55°C, extension 90 sec 70°C. Run on '''Gel 24''' ~ unsuccessful. (AM)
| + | |
| - | | + | |
| - | ==== Friday 25 July 08 ====
| + | |
| - | | + | |
| - | * Made maxiprep '''X4''' (pSB1A2-''crtB'' as M36; BBa_K118002) and '''X5''' (pSB1A2-''crtI'' as M42; BBa_K118003) (AH, XH)
| + | |
| - | * Ligation of P29 into Edinbrick1 to make '''L22''' (pSB1A2+rbs+''crtI''). (Yan, OG)
| + | |
| - | * Ligation of P28 into Edinbrick1 to make '''L21''' (pSB1A2+rbs+''crtB''). (Yan, OG)
| + | |
| - | * Ligation of P12 into Edinbrick1 to make '''L19''' (pSB1A2+rbs+''dxs''). (Yan, OG)
| + | |
| - | * Ligation of P15 into Edinbrick1 to make '''L20''' (pSB1A2+rbs+''appY''). (Yan, OG)
| + | |
| - | * Ligation of P31 into Edinbrick1 to make '''L23''' (pSB1A2+pZntA). (Yan, OG)
| + | |
| - | * ''C. fimi'' Plate 48 appears to be contaminated (mix of opaque and clear colonies). The same culture was used for genomic DNA purification yesterday ~ this preparation is therefore inadequate for sequencing purpose but might be worth using for PCR. (AM)
| + | |
| - | * No growth of ''C. fimi'' on Plates 49 and 50, but ''C. fimi'' takes a relatively long time to form colonies so we should check again on Monday. (AM)
| + | |
| - | * PCR '''P36''' of M43 (''glgC''-mut1,2) to excise the gene from BABEL and rectify its orientation and '''P37''' of ''crtY'' from ''P. ananatis'' (Plate 17) cell suspension - repeat of P27.
| + | |
| - | ** P36 and P37 run on '''Gel 25'''. P36 tentatively successful (larger than desirable smear in the region of interest), P37 failed.
| + | |
| - | * Also did preparations to transfer ''crtE'' from BABEL2 vector to pSB1A2. This is necessary, because we are supposed to use Registry standard vectors for all BioBricks we make (in fact, we should even stop using pSB1A2and move to pSB1A3). So, digested the BABEL2+''crtE'' clone that Douglas Leslie made with EcoRI and PstI, and also Edinbrick1 - in both cases, 3μl in 20μl total volume. Ran both on a gel and excised the appropriate bands, eluted each to 10μl EB and set up a ligation using 4μl of each in 10μl total volume. Ligated at 16°C. (CF)
| + | |
| - | | + | |
| - | ==== Saturday 26 July 08 ====
| + | |
| - | | + | |
| - | * Transformed JM109 with 5μl of ligations labelled as L12, L15, L28, L29, L31 (note: these ligations seem to have been numbered based on the PCR product they were derived from rather than sequentially; they have been renumbered as '''L19 to L23'''), plus my own ligation ('''L24''') which was to transfer ''crtE'' from the BABEL vector (which is not an 'official' BioBrick vector, though it is fully compliant) to pSB1A2, so that we can submit it to the Registry. These were plated on '''plates 51 to 62.''' (CF)
| + | |
| - | | + | |
| - | ==== Sunday 27 July 08 ====
| + | |
| - | | + | |
| - | * Result of transformations: no growth for 'L12' (L19), 'L15' (L20) or 'L28' (L21). For 'L29' (L22) there are some blue and white colonies. For 'L31' (L23) there are many blue colonies but only a few white ones, suggesting that the SacI/SpeI double digest is less efficient than the XbaI/PstI which was (I hope) used for the others. For the ''crtE'' ligation, there are many white colonies and very few blue - this is as expected, since in this case the vector and insert bands were purified from a gel. (CF)
| + | |
| - | | + | |
| - | === Week 7 ===
| + | |
| - | ==== Monday 28 July 08 ====
| + | |
| - | | + | |
| - | * Repeated transformation of L20 (pSB1A2+rbs+''appY'') and L21 (pSB1A2+rbs+''crtB''), and plated on ''plates 63 to 66''. (YAN and Omar).
| + | |
| - | * PCR of ''cenA'', ''cenB'', ''cenC'' and ''cex'' from cell suspension ('''P38-41'''; cell solution incubated at 73-80°C for 8 minutes to kill cells/inactivate DNAse) and DNA solution 'purified' from contaminated cell culture ('''P42-45'''). Denaturing 95°C for 1 min, annealing 55°C for 10s, extension 70°C for 90s. PCR products run on '''Gel 26'''. (AM)
| + | |
| - | * Prepared '''L25''' of P36 (''glgC''-mut1,2 PCRed with primers f2 and r2) and Edinbrick 1. (AM)
| + | |
| - | * Minipreps '''M49 to M54''' of pSB1A2+rbs+''crtI'' transformants. (CF)
| + | |
| - | | + | |
| - | ==== Tuesday 29 July 08 ====
| + | |
| - | | + | |
| - | * Transformation of L20 and L21 failed.
| + | |
| - | * Transformation of ''glgC''-mut1,2 ligation product, made '''plate 67 & 68''' (Yan)
| + | |
| - | * Cut out putative ''cenA'' and ''cex'' (both ~1.5kb) fragments from '''gel 27''' (repeat of Gel 26 but stained with SYBRsafe). Purified DNA from gel fragments: '''F1''' (putative ''cenA'') and '''F2''' (putative ''cex''). (AM)
| + | |
| - | * Digests of M49 to M54 (pSB1A2+rbs+''crtI'') with EcoRI alone. This should generate a single 4 kb band (doing an EcoRI/PstI double digest would give a vector and insert band both around 2 kb, which would probably run at the same place, making it hard to tell whether there was an insert). These were run on '''Gel 28'''. All showed a single band at the expected place. (CF)
| + | |
| - | * Minipreps of pSB1A2+pZntA ('''M55 to M60''') from L23 (Yan, Nimisha)
| + | |
| - | * Minipreps of pSB1A2+rbs+''crtE'' ('''M61 to M66''') from L22 (Yan, Nimisha)
| + | |
| - | ** Double digests of M55 to M60 and M61 to M66 with EcoRI/PstI. This should generate the following bands: ~2.2 kb for pZntA (M55 to M60), ~1.1 kb for rbs+''crtE'' (M61 to M66), and ~2 kb for the pSB1A2 vector. These were run on '''Gel 29'''. M55 to M60 unsuccessful; M61 to M66 showed a band at the expected location for rbs+''crtE'' but seemed to be indicate that L22 was still ligated into BABEL2 instead of pSB1A2. (Yan & AM)
| + | |
| - | | + | |
| - | ==== Wednesday 30 July 08 ====
| + | |
| - | | + | |
| - | * '''P48''' (''crtY'') and '''P49''' (Recreation of P12, rbs+''dxs'') created (30.07.08: CF)
| + | |
| - | * Ligated F1 (putative ''cenA'') and F2 (putative ''cex'') to Edinbrick 1 ('''L28''' and '''L29''' respectively). All were digested with EcoRI/SpeI, purified and stored overnight in the 16°C water bath. (AM)
| + | |
| - | * Repeated PCR for ''cenA'' and ''cex'' ('''P46''', '''P47''') from heat killed cell solution. Denaturing 95°C for 1 min, annealing 65°C for 10s, extension 70°C for 40s. Run on '''Gel 30'''. Unsuccessful, perhaps because annealing temperature was too high (temperature was decided based on stock solution label, which took the prefix/suffix into consideration). (AM)
| + | |
| - | * '''Gel 31''': M49 and M50 (pSB1A2-rbs+''crtI'' digested with a) XbaI, b) SpeI/XbaI, c) sac/speI), M63 (BABEL2+rbs+''crtE'' digested with a) EcoRI, b) EcoRI/PstI), M67 (pSB1A2+rbs+''crtB'' digested with a) EcoRI/PstI, b) sacI/speI) and P48 (''crtY''). (OG)
| + | |
| - | * Re-digested M55 to M60 (pSB1A2+pZntA) with a) EcoRI and b) EcoRI/PstI. (This time, the amount of DNA for digestion is increased). (Yan)
| + | |
| - | ** '''Gel 32''' results look promising for M57, but not for the others. (Yan)
| + | |
| - | * Purified P15 (rbs+''appY'') and P28 (''crtB''), digested each with EdinbrickI using XbaI/PstI and set-up for ligations ('''L26''' and '''L27'''). Stored overnight in the 16°C water bath.(HX)
| + | |
| - | | + | |
| - | ==== Thursday 31 July 08 ====
| + | |
| - | | + | |
| - | * M50 (pSB1A2+rbs+''crtI''), M63 (BABEL2+rbs+''crtE'') and M67 (rbs+''crtB'') submitted for sequencing. (CF)
| + | |
| - | * Transformation of L26 (pSB1A2+rbs+''appY'') to '''Plates 75 and 76''', L27 (pSB1A2+''crtB'') to '''Plates 77 and 78''', L28 (pSB1A2+''cenA'') to '''plates 79 and 80''' and L29 (pSB1A2+''cex'') to '''plates 81 and 82'''. (HX)
| + | |
| - | * Minipreps of '''M68-M71''' (pSB1A2+''glgC''-mut1,2), '''M72-M75''' (pSB1A2+rbs+''dxs'') and *M76-M79* (BABEL2+''crtE''). (YAN, AM)
| + | |
| - | | + | |
| - | ==== Friday 1 August 08 ====
| + | |
| - | | + | |
| - | * Primers for pCstA ordered. (CF)
| + | |
| - | * White colonies from Thursday's transformations were subplated as follows...
| + | |
| - | ** Plate 76 (L26: pSB1A2+rbs+''appY'') to '''Plate 83'''
| + | |
| - | ** Plate 77 (L27: pSB1A2+rbs+''crtB'') to '''Plate 84'''
| + | |
| - | ** Plate 80 (L28: pSB1A2+''cenA'') to '''Plate 85'''
| + | |
| - | ** Plates 81/82 (L29: pSB1A2+''cex'') to '''Plate 86'''. (AM/HX/OG)
| + | |
| - | * ''First digestion'': M68 to M71 (pSB1A2+''glgC''-mut1,2) with EcoRI/PstI, M72 to M75 (pSB1A2+rbs+''dxs'') with EcoRI, M76 to M79 (BABEL2+''crtE'') with EcoRI/PstI. Run on '''Gel 33'''. Results: M68, 69, 71: vector band around 2 kb, no ''glgC'' band; M72, 73, 74: single band around 4 kb, expected length for vector+gene; M76-79: ''crtE'' band <1 kb, vector band ~2 kb. It is not clear into which vector ''crtE'' (M76~79) is inserted, so sequencing will be necessary.
| + | |
| - | * ''Second digestion'': M68 and M69 with a) EcoRI, b) EcoRI/PstI; M72 with a) EcoRI b) SacI/SpeI. Run on '''Gel 34'''. Results: Single and double digests of M68 and M69 yielded similar results, hence pSB1A2+''glgC''-mut1,2 ligation or transformation failed; digests of M72 yielded expected bands, hence pSB1A2+rbs+''dxs'' successful. (AM)
| + | |
| - | * P36 (''glgC''-mut1,2 excision from BABEL2) and L25 (P36 + Edinbrick1) were run again on '''Gel 35'''. Results: P36 viewed at lower illumination yields one band of the desired length (1.5kb); L25 yields two bands around 1.5kb, a thick band at 3kb and several fainter bands including one at 2kb (length of pSB1A2). (AM)
| + | |
| - | | + | |
| - | === Week 8 ===
| + | |
| - | ==== Monday 4 August 08 ====
| + | |
| - | | + | |
| - | * Made 17 minipreps from transformations of L26, L27, L28, L29: '''M80-83''' (L26: rbs+''appY'' in Edinbrick1), '''M84-85''' (L27: rbs+''crtB'' in Edinbrick1), '''M86-90''' (L28: ''cenA'' in Edinbrick1) and '''M91-96''' (L29: ''cex'' in Edinbrick1). This was followed by double digestion of all the miniprep products (M80-96) with EcoRI/PstI. (Yan, OG)
| + | |
| - | * Third ''glgC'' mutagenesis made by MABEL on BABEL2+''glgC''-mut1,2 (since pSB1A2+''glgC''-mut1,2 appears to have failed) performed: '''P50''' (Yan)
| + | |
| - | * Double digestions of M80 to M96 and P50 were run on '''gel 36'''. Results were good for M80-82 (pSB1A2+rbs+''appY''), M84-85 (pSB1A2+rbs+''crtB''), M92 (pSB1A2+''cex'') and P50 (''glgC''-mut1,2,3). Other results were poor, with bands in the wrong position for M86-M90 (pSB1A2+''cenA''). (Yan, OG)
| + | |
| - | * Sequencing results back today indicate that M50 = pSB1A2+rbs+''crtI'', M63 = pSB1A2+rbs+''crtE'' and M67 = pSB1A2+rbs+''crtB''. (AH)
| + | |
| - | | + | |
| - | ==== Tuesday 5 August 08 ====
| + | |
| - | | + | |
| - | * M72 (pSB1A2+rbs+''dxs''), M79 (BABEL2+''crtE'') and M82 (pSB1A2+rbs+''appY'') submitted for seqencing. (CF)
| + | |
| - | * Minipreps '''M97-104''' of pSB1A2 ''cenA'' (2, 7-13) and '''M105-108''' Minipreps '''M105-108''' of pSB1A2+''cex''. (Yan)
| + | |
| - | * M97-108 were double-digested with EcoRI/PstI and run on '''gel 37'''. (Yan)
| + | |
| - | * Purification and self-ligation of P50 (3rd mutagenesis of ''glgc''-mut1,2) ('''L30'''). (HX)
| + | |
| - | * M68-69 (''glgc''-mut1,2 in pSB1A2) and M92 (pSB1A2+''cex'') were digested with a) PstI and b) EcoRI/PstI, but gel leaked. Entire process needs repeating tomorrow! (CF, OG)
| + | |
| - | * Digested P36 (''glgC''-mut1,2) with Edinbrick1 using Spe1/EcoR1 - to be continued tomorrow. (OG)
| + | |
| - | * '''Plate 93''' created from subculture of plate 56 (M67, pSB1A2+rbs+''crtB'')
| + | |
| - | | + | |
| - | ==== Wednesday 6 August 08 ====
| + | |
| - | | + | |
| - | * '''L31''' ligation of P36 (glgC-mut1,2, hopefully, could be P39) to Edinbrick1 completed. (OG)
| + | |
| - | * Primers have arrived for pCstA. Chris carried out the PCR (that would be '''P51'''). Unsuccessful. (CF)
| + | |
| - | * Digestion of M67 (pSB1A2+rbs+''crtB'') with EcoRI/SpeI and M50 (pSB1A2+rbs+''crtI'') with EcoRI/XbaI, in preparation for combining the two with the former as insert and the latter as vector. (CF)
| + | |
| - | ** Not enough time to purify/ligate due to high demand for agarose gel following lunchtime. Shall do tomorrow morning at 9. (AM)
| + | |
| - | * Re-digestion of M97, M98, M99 and M101 (all pSB1A2+''cenA'') and M105 and M108 (pSB1A2+''cex'') with a) EcoRI, b) EcoRI/PstI, and M92 (pSB1A2+''cex'') with a) PstI, b) EcoRI/PstI. All run on '''gel 38''' (because gel 37 did not look good). (Yan)
| + | |
| - | * Transformation of L30 (Self-ligation of BABEL2+''glgC''-mut1,2,3) ('''plates 89 and 90''') and L31 (''glgC''-mut1,2 to Edinbrick1) ('''plates 91 and 92''') onto B/W plates. (HX)
| + | |
| - | * Maxipreps '''X6''' (as M50, pSB1A2+rbs+''crtI'') and '''X7''' (as M63: pSB1A2-+rbs+''crtE'') made. (AM)
| + | |
| - | * Overnight culture made from plate 93 (pSB1A2+rbs+''crtB'') ready for maxiprep tomorrow. (AM, AH)
| + | |
| - | * Analytical digests using a) EcoRI, b) EcoRI/PstI of M70, M71 (both pSB1A2+''glgC''-mut1,2) and M92 (pSB1A2
| + | |
| - | +''cex''). Run on '''gel 39'''. Results do not look good. Bands are wrong size to correspond to vector and no bands match an expected insert size. (CF)
| + | |
| - | | + | |
| - | ==== Thursday 7 August 08 ====
| + | |
| - | | + | |
| - | * Subcultured from Plates 89 and 90 (BABEL2+''glgC''-mut1,2,3) to '''Plate 94'''. Plate 91 (pSB1A2+''glgC''-mut1,2) showed no growth, so was discarded. Plate 92 (pSB1A2+''glgC''-mut1,2) had a blue smear and two white colonies. These colonies were subbed to '''Plate 95'''. (HX)
| + | |
| - | * Maxiprep '''X8''' (as M67: pSB1A2+rbs+''crtB'') made. Slight hiccup after step 6. (Cold solution 3 was added and incubation on ice was skipped. Centrifugation continued for 2 minutes before mistake was realised, after which the solution was mixed and incubated on ice for ten minutes (continuing with step 7). (AM, AH)
| + | |
| - | * Combination (Ligation) of rbs+''crtB'' (from M67) and rbs+''crtI'' (from M50): rbs+''crtB'' as an insert cut with EcoRI/SpeI; rbs+''crtI'' as a vector cut with EcoRI/XbaI ('''L32'''). (Yan, AM)
| + | |
| - | * Double digestion of three biobricks: 2 of rbs+''dxs'' (from M72), rbs+''crtE'' (from M63) and rbs+''lims1'' (from 0713536 in iGEM 07 box): rbs+''dxs'' as a vector cut with SpeI/PstI; rbs+''crtE'' as an insert cut with XbaI/PstI; rbs+''lims1'' as an insert cut with XbaI/PstI.
| + | |
| - | * Made PCR of ''cenA'' and ''cex'' again, stored in '''P52''' (''cenA'') and '''P53''' (cex). The PCR products were checked on gel, but failed again! (Yan, AM)
| + | |
| - | * PCR '''P54''' of pCstA. Run on '''gel 40'''. Results look promising (fairly prominent band <500bp). Purified. (CF)
| + | |
| - | * Plates made for testing glycogen assay. 2x LB agar, ampicillin; 2x LB agar, ampicillin, 2% glucose ready for spreading with ''E. coli''. (SK)
| + | |
| - | * '''Plates 96 and 97''' (glycogen assay) were spread with subcultures from Plate 43. Plate 96 = (-)glucose, plate 97 = (+)glucose. (HX)
| + | |
| - | | + | |
| - | ==== Friday 8 August 08 ====
| + | |
| - | | + | |
| - | * Plate 94 (BABEL2+''glgC''-mut1,2,3) has white cultures, so can be prepped for minipreps. Plate 95 (pSB1A2+''glgC''-mut1,2) has blue cultures. Therefore transformation of L31 (''glgC''-mut1,2 to Edinbrick1) has been repeated on '''plates 100 and 101'''. (HX)
| + | |
| - | * Transformation of L32 (pSB1A2+''crtB''+''crtI'') on '''plates 98 and 99'''. (HX)
| + | |
| - | * Digested pCstA (P54) and Edinbrick1 using Spe1/EcoR1. Ligated as '''L33''' to be transformed tomorrow (OG)
| + | |
| - | * ''Arabidopsis'' ''isa1'' and ''isa2'' cDNAs have arrived as well as ''Zea mays'' ''su1'', ''iso2'' and ''iso3''. The ''Arabidopsis'' genes are full of forbidden restriction sites, so it would be best to use the maize genes. Primers will need to be designed. (AH)
| + | |
| - | * PCRed ''cenA'' and ''cex'' with a) KOD polymerase, b) Velocity polymerase separately to make '''P55''' (''cenA'' by KOD), '''P56''' (''cenA'' by Velocity), '''P57''' (''cex'' by KOD) and '''P58''' (''cex'' by Velocity). (Yan)
| + | |
| - | * Combined rbs+''dxs'' with rbs+''crtE'' as '''L34''', and rbs+''dxs'' with rbs+''lims1'' as '''L35'''. L34 and L35 ligation is being allowed to occur at 16°C overnight. (Yan)
| + | |
| - | * M79 sequencing results indicate that M79 is BABEL2+''crtE''. (AH)
| + | |
| - | | + | |
| - | ==== Sunday 10 August 08 ====
| + | |
| - | | + | |
| - | * Extracted ''C. fimi'' genomic DNA, followed by PCR of ''rrnB'' ('''P61'''), ''cenA'' ('''P62''') and ''cex'' ('''P63''') from genomic DNA. (CF)
| + | |
| - | * Made subcultures...
| + | |
| - | ** Patches from Plate 99 (L32, ''crtB''+''crtI'') to '''Plate 102'''.
| + | |
| - | ** Patches from Plate 101 (L31, glgC double mutant+pSB1A2) to '''Plate 103'''.
| + | |
| - | ** Patches from Plates 105 (pSB1A2+''crtY'') and 106 (pSB1A2+rbs+''crtY'') to '''Plate 108'''. (CF)
| + | |
| - | * Transformed competent cells with '''L36''' pSB1A2+''crtY'' ('''Plates 104/105''') and '''L37''' pSB1A2+rbs+''crtY'' ('''Plates 106/107'''). (CF)
| + | |
| - | | + | |
| - | === Week 9 ===
| + | |
| - | | + | |
| - | | + | |
| - | ==== Monday 11 August 08 ====
| + | |
| - | | + | |
| - | * PCR products of P55 to P58 (''cenA'' and ''cex'') were run on '''Gel 41:''' ''cex'' with KOD polymerase (P57) generated a single band of the desired size. However, ''cex'' with Velocity polymerase and ''cenA'' with both KOD or Velocity polymerase failed. (YAN)
| + | |
| - | * PCR products P61 to P63 (''rrnB'', ''cenA'', ''cex'') were run on '''Gel 42'''. Very clear band for ''rrnB'', no bands for either ''cenA'' or ''cex''. (CF)
| + | |
| - | * Made '''Plate 109/110''' (Transformation of L33: pBS1A2+pCstA), '''111/112''' (transformation of L34: pBS1A2+''dxs''+''crtE'') and Plate '''113/114''' (Transformation of L35: pBS1A2+''dxs''+''lims1''). (Yan)
| + | |
| - | * Maxipreps '''X9''' of pSB1A2+rbs+''dxs'' (as for M72) and '''X10''' of pSB1A2P+rbs+''appY'' (as for M82). (AM)
| + | |
| - | * Redid PCR (KOD) of ''cex'' from ''C. fimi'' genomic DNA but with 10µl 50% glycerol, denaturing 1 min, annealing 60°C for 30s and extension 30s ('''P64'''). To be run on gel tomorrow. (AM)
| + | |
| - | * Digested P57 (''cex'' from KOD PCR) with EcoRI/PstI to confirm identity of the gene. ''cex'' has a PstI restriction site near its midpoint, so this digestion should generate two segments of approximately 750bp. To be run on gel tomorrow. (AM)
| + | |
| - | * Digests performed using EcoRI/PstI to move ''crtE'' from BABEL2 (M79) to Edinbrick1. In each case, 3µl of vector was digested in 20µl total volume. The digests were run on a gel ready for excision, but gel showed no band corresponding to ''crtE'' (see '''gel 43''' showing a single band at ~3kb for BABEL2+''crtE'' and bands at ~2.5kb and 800bp for Edinbrick1). (AH)
| + | |
| - | * '''M109-M112''' Minipreps of pSB1A2+''crtB''+''crtI'', from plates 102. '''M113-M116''' Minipreps of pSB1A2+''glgC''-mut1,2 from plate 103. '''M117-M120''' Minipreps of pSB1A2+''glgC''-mut1,2,3 from plate 94 (OG)
| + | |
| - | * Double digestion of M109 to M120 with EcoRI/PstI, run on '''gel 44'''. M110-102 (pSB1A2+''crtB''+''crtI'') have a band at 2.5kb as expected. M109 (pSB1A2+''crtB''+''crtI'') gave a band at 3kb instead, so should be ignored from now on. (Yan)
| + | |
| - | | + | |
| - | ==== Tuesday 12 August 08 ====
| + | |
| - | | + | |
| - | * '''Plate 115''' made with subs from L33 (Pl. 109/110: pSB1A2+pCstA), L34 (Pl. 111/112: pSB1A2+''dxs''+''crtE'') and L35 (Pl. 113/114: pSB1A2+''dxs''+''lims1'') (CF)
| + | |
| - | * Over-night cultures of L33 (pSB1A2+pCstA, sub-cloned on Plate 115), L34 (pSB1A2+''dxs''+''crtE'', sub-cloned on Plate 115) and L35 (pSB1A2+''dxs''+''lims1'', subcloned on Plate 115) set up, ready for minipreps tomorrow.
| + | |
| - | * '''M121-M123''': Minipreps of pSB1A2+''crtY'' (1,2,3). '''M124-M126''': Minipreps of pSB1A2+rbs+''crtY'' (1,2,3). note: I messed up M121 by adding 200µl instead of 100µl of sol 1. They are in the green box, the orange one is full. (OG)
| + | |
| - | * Double digests of M121 to M126, run on '''Gel 46'''. It looks good! M121 is good! (Yan)
| + | |
| - | * Purified P61 (''rrnB'') for sequencing. (CF/AM)
| + | |
| - | * Re-purified already purified genomic DNA from ''C. fimi''. This meaningless endeavour resulted from a misunderstanding. Hopefully, the doubly-purified DNA will still be useable. (AM)
| + | |
| - | * P57 (''cex'' from cells) EcoRI/PstI double digest, undigested P64 (''cex'' from genomic DNA), P66 (''su1'') and P67 (''iso2'') run on '''Gel 45'''. P57 double digest yielded no clear bands; P64 yielded a clear band at 1.5 kb. (CF/AM)
| + | |
| - | * Purified P57 (''cex'' from cell suspension) and P64 (''cex'' from genomic DNA). Digested both with PstI. (AM)
| + | |
| - | * PCR for ''cenA'' from ''C. fimi'' genomic DNA ('''P65'''): denaturing 1 min, annealing 56°C for 20s, extension 30s, with glycerol. (AM)
| + | |
| - | * P57 and P64 (''cex'') PstI digests and P65 (''cenA'') run on '''Gel 47'''. Results indicate success!. (AM)
| + | |
| - | * Re-did the excise of ''crtE'' from BABEL2 (M79); cut out the band responsible for ''crtE'' and Edinbrick 1 on the gel, followed by putification of ''crtE'' and Edinbrick1 from the cut-out gel. Finally, ligation of ''crtE'' to Edinbrick1 ('''L38'''). (HX, AH)
| + | |
| - | * Analytical digests as follows (AH):
| + | |
| - | ** M109 and M110 (pSB1A2+''crtB''+''crtI''): BamHI/EcoRV
| + | |
| - | ** M115 and M116 (pSB1A2+''glgC''-mut1,2): HindIII
| + | |
| - | ** M115 and M116 (pSB1A2+''glgC''-mut1,2): EcoRI/HindIII
| + | |
| - | * Digests of M109, M110, M115 and M116 were run on '''gel 48'''. M109 and M110 should give two bands if both genes are present. HindIII digest of M115/116 should give a single band indicating linearised plasmid with ''glgC''. Double digest of M115/116 should give an insert band of ~1kb and a vector + ~500bp of insert band. Results do not look good. Bands seem to indicate much too large products, but will discuss with Chris tomorrow.(AH)
| + | |
| - | * M116 (pSB1A2+''glgC''-mut1,2) and M120 (BABEL2+''glgC''-mut1,2,3) submitted for sequencing. (CF)
| + | |
| - | | + | |
| - | ==== Wednesday 13 August 08 ====
| + | |
| - | | + | |
| - | * Submitted M109 (pSb1A2+''crtB''+''crtI'') for sequencing as AH_109F and AH_109R using primers pSB1A2insF2 and pSB1A2insR2 respectively. (AH)
| + | |
| - | * '''M127-M130''': Minipreps of pSB1A2+pCstA (1,2,3,4), '''M131-M134''': Minipreps of pSB1A2+''dxs''+''crtE'' (1,2,3,4), '''M135-M138''': Minipreps of pSB1A2+''dxs''+''lims1'' (1,2,3,4). All from plate 115. Note: M132 and M136 might be labelled wrong, the ethanol erased the writing on the tubes. Sorry! (OG)
| + | |
| - | * Double digests performed on M127-138 using EcoRI/PstI. (AH, OG)
| + | |
| - | * Transformation of L38 (pSB1A2-''crtE'') on '''Plate 116''' (100ml) and '''plate 117''' (900ml). (HX)
| + | |
| - | * Ligation of P54 (''cex'') and P65 (''cenA'') into Edinbrick1, to make L39 (pSB1A2+''cex'') and L40 (pSB1A2+''cenA''). (Yan)
| + | |
| - | * PCR for ''cenB'' ('''P68''') and ''cenC'' ('''P69''') from ''C. fimi'' genomic DNA: denaturing 1 min, annealing 56°C for 20s, extension 85s, with glycerol. Run on '''Gel 49'''. Results indicate failure. (AM)
| + | |
| - | | + | |
| - | h5. Thursday 14 August 08
| + | |
| - | | + | |
| - | * Subplated from plate 116 (pSB1A2+crtE 100 microlitres) onto *plate 118*. Should be ready to make culture for miniprep later this afternoon. (AH)
| + | |
| - | * Submitted M121 (pSB1A2+crtY), M124 (pSB1A2+rbs+crtY), M130 (pSB1A2+pCstA) and M137 (pSB1A2+dxs+lims) for sequencing using pSB1A2insF2 for sequencing of all 4 + pSB1A2insR2 for M137. Also resubmitted M109 (pSB1A2+crtBI) for sequencing using both forward and reverse primers, because I realised that yesterday I circled BigDye rather than "reaction required" on the sequencing form\! (AH)
| + | |
| - | * Made culture of pSB1A2+CrtE from plate 118, which was subcloned from plate 116 for minipreps (1-4) (YAN & HX).
| + | |
| - | * Transformation of L39 (Cex+Edinbrick1) into *plate 121/122;* and L40 (CenA+Edinbrick1) into *Plate 119/120.* (YAN).
| + | |
| - | * Digested and ligated M63 (crtE) and M72 (dxs). for M63 i used buffer H, XbaI, and PstI, For M72 i used buffer B, SpeI and PstI. M63 in inserted downstream of M72. the DNA samples of M63 and M72 were taken from the gel after using SYBR-Safe staining. (OG)
| + | |
| - | * Purified four preps of _C. fimi_ genomic DNA from bottled cultures made by Dr French (in LB, made from _C. fimi_ NA plates on lab bench). (AM)
| + | |
| - | * PCR of M43 (glgC mut 1+2 -->- *{-}P70{-}*\-) and M120 (glgC mut 1+2+3 \--> *P71*) with blunt-ended glgC primers. Run on *Gel 52* (?) . Results: P70 failed; P71 yielded a thick band around 1.5kb (proper size for glgC) and two unexpected bands around 6kb and 12kb. (AM)
| + | |
| - | | + | |
| - | h5. Friday 15 August 08
| + | |
| - | | + | |
| - | * Plates from yesterdays transformations of pSB1A2\+_cex_ and pSB1A2\+_cenA_ (119-122) failed to show any signs of growth. The transformation's being repeated. (AH)
| + | |
| - | * Glycogen assay performed: Flooding colonies with Gram's iodine solution yields results after \~5 minutes. Colonies on the (+)glucose plate stained darker than those on the (-)glucose plate (brown compared to no apparent change). The staining seems to grow more apparent up to \~30 minutes and then fades to nothing as the plate dries off. (AH)
| + | |
| - | * Transform with L39(cex+Edi), L40(cenA+Edi) & L41(dxs/crtE) on Plate123 to 128.(HX)
| + | |
| - | * Minipreps of pSB1A2+CrtE from its corresponding culture 1 to 4, made *M139 to M143*. (M142 and M143 made from the same culture (4). M143 has double quantity of solution 1.) Then, double digeats of M139 to M143 with EcoRI and PstI and the products were run on *Gel 53*. (YAN/OG)
| + | |
| - | * PCR of M43 (repeat: glgC mut 1+2 -->- *{-}P71A{-}*\-), M120 (repeat: glgC mut 1+2+3 \--> *P72*), and rrnB from the four _C. fimi_ genomic DNA preps made yesterday plus the original prep as a positive control (*P73~77*). PCR products run on *Gel 54*. Results: P71A and P72 succeeded, producing large quantities of DNA around the length of glgC; P74 yielded a single band around 1.5~2 kbp whilst P73 and P75 yielded gel-length smears and nothing came of P76 and P77 (the control). (AM)
| + | |
| - | | + | |
| - | == Summary of samples: ==
| + | |
| - | ==== PCR products ====
| + | |
| - | | + | |
| - | '''P1:''' ''dxs'' from ''Eschaerichia coli'' JM109 (or K12?)<br />
| + | |
| - | '''P2:''' ''appY'' from ''E. coli'' JM109 (or K12?)<br />
| + | |
| - | '''P3:''' ''glgC'' from ''E. coli'' JM109 (or K12?)<br />
| + | |
| - | '''P4:''' fusion PCR for BABEL1+''glgC''<br />
| + | |
| - | '''P5:''' fusion PCR for BABEL2+''glgC''<br />
| + | |
| - | '''P6:''' mutagenic PCR to remove EcoRI site 1 from ''glgC''<br />
| + | |
| - | '''P7:''' mutagenic PCR to remove EcoRI site 2 from ''glgC''<br />
| + | |
| - | '''P8:''' ''crtB'' (from ''Pantoea ananatis'' cells)<br />
| + | |
| - | '''P9:''' ''crtI'' (from Douglas's maxiprep of the mutated ''crtIB'' plasmid)<br />
| + | |
| - | '''P10:''' ''crtY'' (from ''P. ananatis'' cells). Failed.<br />
| + | |
| - | '''P11:''' fusion PCR for rbs+''dxs''. Failed.<br />
| + | |
| - | '''P12:''' repeat fusion PCR for rbs+''dxs'', using L11 and primers rbs2fclon1+pSB1A2insr1.<br />
| + | |
| - | '''P13 and P14:''' MABEL mutation of site 1 on ''glgC'' mutant clones M19 and M22.<br />
| + | |
| - | '''P15:''' fusion PCR for rbs+''appY''<br />
| + | |
| - | '''P16, P17, P18 and P19:''' first attempts at ''cenA'', ''cenB'', ''cenC'' and ''cex''.<br />
| + | |
| - | '''P20, P21, P22 and P23:''' second attempts at ''cenA'', ''cenB'', ''cenC'' and ''cex''.<br />
| + | |
| - | '''P24, P25:''' repeat PCR for ''cenA'' and ''cex'' using Pfu. Failed.<br />
| + | |
| - | '''P26:''' Positive control PCR with primers fd1 and rd1 to amplify 16S rRNA gene ''rrnB'' from ''Cellulomonas fimi''.<br />
| + | |
| - | '''P27:''' ''crtY'' from ''P. ananatis'' cells. - Failed<br />
| + | |
| - | '''P28, P29:''' ''crtB'' and ''crtI'' from L18 and L19.<br />
| + | |
| - | '''P30:''' Repeat positive control ''rrnB'' from ''C. fimi'', annealing 1 minute.<br />
| + | |
| - | '''P31:''' pZntA promoter<br />
| + | |
| - | '''P32-P35:''' repeat PCR for ''cenA'', ''cenB'', ''cenC'' and ''cex'', annealing 1 minute. Failed.<br />
| + | |
| - | '''P36:''' M43 (''glgC''-mut1,2) with primers glgCf2/glgCr2 (25.07.08: AM)<br />
| + | |
| - | '''P37:''' ''crtY'' from ''P. ananatis''. (25.07.08: AM) - Failed<br />
| + | |
| - | '''P38~P41:''' ''cenA'', ''cenB'', ''cenC'' and ''cex'' from heat-killed cell suspension.<br />
| + | |
| - | '''P42~P45:''' ''cenA'', ''cenB'', ''cenC'' and ''cex'' from 'impure' DNA solution.<br />
| + | |
| - | '''P46~P47:''' ''cenA'' and ''cex'' from 'impure' DNA solution, annealing 65C. Failed.<br />
| + | |
| - | '''P48:''' ''crtY'' (new primer mixture) (previously P38a) (30.07.08: CF) - Failed<br />
| + | |
| - | '''P49:''' Recreation of P12 (rbs+''dxs'') (previously P39a) (30.07.08: CF)<br />
| + | |
| - | '''P50:''' third mutagenesis of ''glgc''-mut1,2 (04.08.08: YAN)<br />
| + | |
| - | '''P51:''' pCstA from ''E. coli'' cells (06.08.08: CF) - Failed<br />
| + | |
| - | '''P52:''' ''cenA'' from heat killed ''C. fimi'' (07/08/08: YAN, AM) - Failed<br />
| + | |
| - | '''P53:''' ''cex'' from heat killed ''C. fimi'' (07/08/08: YAN, AM) - Failed<br />
| + | |
| - | '''P54:''' pCstA from ''E. coli'' cells - Purified (07.08.08: CF)<br />
| + | |
| - | | + | |
| - | ==== Ligations ====
| + | |
| - | | + | |
| - | '''L1:''' Edinbrick1+''dxs''<br />
| + | |
| - | '''L2:''' Edinbrick1+''appY''<br />
| + | |
| - | '''L3:''' Babel1+''glgC''<br />
| + | |
| - | '''L4:''' Babel2+''glgC''<br />
| + | |
| - | '''L5:''' Edinbrick1+''appY'' repeat (initially labelled L4 in error)<br />
| + | |
| - | '''L6:''' Self ligation of mutagenic PCR P6<br />
| + | |
| - | '''L7:''' Self ligation of mutagenic PCR P7<br />
| + | |
| - | '''L8:''' Ligation of synthetic ribosome binding site to M2 (BBa_K118000)<br />
| + | |
| - | '''L9:''' Edinbrick1+''crtB''<br />
| + | |
| - | '''L10:''' Edinbrick1+''crtI'' (mutant lacking PstI sites, I hope)<br />
| + | |
| - | '''L11:''' repeat ligation of synthetic ribosome binding site to M2 (BBa_K118000)<br />
| + | |
| - | '''L12:''' rbs ligated with ''appY''.<br />
| + | |
| - | '''L13 and L14:''' self ligations of ''glgC'' mutation reactions P13 and P14.<br />
| + | |
| - | '''L15:''' ligation of Edinbrick1 with rbs+''dxs'' fusion PCR product (P12). - Failed<br />
| + | |
| - | '''L16:''' Ligation of Edinbrick1 with rbs+''appY'' fusion PCR product (P15) (17/07/08) - Failed<br />
| + | |
| - | '''L17:''' Ligation of ''crtB'' (M36) to rbs (22/07/08)<br />
| + | |
| - | '''L18:''' Ligation of ''crtI'' (M42) to rbs (22/07/08)<br />
| + | |
| - | '''L19:''' pSB1A2+rbs+''dxs'' ligation product (From P12) (25/07/08: Yan/OG)<br />
| + | |
| - | '''L20:''' pSB1A2+rbs+''appY'' ligation product (From P15) (25/07/08: Yan/OG)<br />
| + | |
| - | '''L21:''' pSB1A2+rbs+''crtB'' ligation product (From P28) (25/07/08: Yan/OG)<br />
| + | |
| - | '''L22:''' pSB1A2+rbs+''crtI'' ligation product (From P29) (25/07/08: Yan/OG)<br />
| + | |
| - | '''L23:''' PzntA+pSB1A2 ligation product (From P31) (25/07/08: Yan/OG)<br />
| + | |
| - | '''L24:''' Ligation of ''crtE'' to pSB1A2 (25/07/08: CF)<br />
| + | |
| - | '''L25:''' Ligation of ''glgC'' double mutant (P36) to Edinbrick 1 (28.07.2008: AM)<br />
| + | |
| - | '''L26:''' Ligation of Edi+P15 XP - rbs+''appY'' (30.07.2008: HX)<br />
| + | |
| - | '''L27:''' Ligation of Edi+P28 XP - rbs+''crtB'' (30.07.2008: HX)<br />
| + | |
| - | '''L28:''' Putative ''cenA'' ligated to Edinbrick1 (30.07.08: AM)<br />
| + | |
| - | '''L29:''' Putative ''cex'' ligated to Edinbrick1 (30.07.08: AM)<br />
| + | |
| - | '''L30:''' Self-ligation of P15 (3rd mutagenesis of ''glgC''-mut1,2) (05.08.08: HX)<br />
| + | |
| - | '''L31:''' Ligation of P36 (''glgC''-mut1,2, hopefully, could be P39) to Edinbrick1 (05.08.08: OG)<br />
| + | |
| - | '''L32:''' Ligation of rbs+''crtB'' (M67) to rbs+''crtI'' (M50) to create ''crtB''/''crtI'' (07.08.08: AM, Yan)<br />
| + | |
| - | '''L33:''' Ligation of PcstA (P54) to Edinbrick1 (08.08.08: OG)<br />
| + | |
| - | | + | |
| - | ==== Minipreps ====
| + | |
| - | | + | |
| - | '''M1 to M6:''' pSB1A2+''dxs'' transformants. *M2, M3, M4 and M6* all looked correct on a gel. *M2* was sequenced to confirm identity and was maxiprepped as *X2*.<br />
| + | |
| - | '''M7:''' Babel1+''glgC'' transformant. Did not look right on gel.<br />
| + | |
| - | '''M8 to M12:''' Babel2+''glgC''_ transformants. *M10 and M11* both looked good on a gel, but sequencing showed that both had the insert in the reverse orientation.<br />
| + | |
| - | '''M13 to M18:''' pSB1A2+''appY'' transformants. Gel 10 showed that M15 to M18, and possibly M14, all seemed to have inserts the right size.<br />
| + | |
| - | '''M19 to M24:''' Babel2+''glgC'' clones after mutation of EcoRI site 2. EcoRI digests on *Gel 11* suggest that *M19, M21 and M22* may have lost the EcoRI site.<br />
| + | |
| - | '''M25 to M30:''' possible rbs+''dxs'' transformants.<br />
| + | |
| - | '''M31 to M36:''' ''crtB'' clones.<br />
| + | |
| - | '''M37 to M42:''' ''crtI'' clones.<br />
| + | |
| - | '''M43 to M47:''' possible ''glgC'' double mutants (both EcoRI sites gone)<br />
| + | |
| - | '''M48:''' a possible rbs+''dxs'' clone.<br />
| + | |
| - | '''M49 to M54:''' pSB1A2-rbs+''crtI''<br />
| + | |
| - | '''M55 to M60:''' PZntA promoter<br />
| + | |
| - | '''M61 to M66:''' BABEL2+rbs+''crtE''<br />
| + | |
| - | '''M67:''' rbs+''crtB''<br />
| + | |
| - | '''M68 to M71:''' pSB1A2+''glgC''-mut1,2 (31.07.08: AM, YAN)<br />
| + | |
| - | '''M72 to M75:''' pSB1A2+rbs+''dxs'' (31.07.08: AM, YAN)<br />
| + | |
| - | '''M76 to M79:''' BABEL2+''crtE'' (31.07.08: AM, YAN)<br />
| + | |
| - | '''M80 to M83:''' pSB1A2+rbs+''appY'' (04/08/08: YAN and OG)<br />
| + | |
| - | '''M84 to M85:''' pSB1A2+rbs+''crtB'' (04/08/08: YAN and OG)<br />
| + | |
| - | '''M86 to M90:''' pSB1A2+''cenA'' (04/08/08: YAN and OG)<br />
| + | |
| - | '''M91 to M96:''' pSB1A2+''cex''(04/08/08: YAN and OG)<br />
| + | |
| - | '''M97 to M104:''' pSB1A2+''cenA'' (05.08.08: YAN)<br />
| + | |
| - | '''M105 to M108:''' pSB1A2+''cex'' (05.08.08: YAN)<br />
| + | |
| - | | + | |
| - | ==== Maxipreps ====
| + | |
| | | | |
| - | '''X1:''' BioBrick J33201<br />
| + | [[Edinburgh/Notebook/PCR products|PCR products]]<br /> |
| - | '''X2:''' pSB1A2+''dxs'' clone (as M2; BBa_K118000)<br />
| + | [[Edinburgh/Notebook/Ligation products|Ligation products]]<br /> |
| - | '''X3:''' pSB1A2+''appY'' (from Plate 21, streak 3) (18 July 2008)<br />
| + | [[Edinburgh/Notebook/Minipreps|Minipreps]]<br /> |
| - | '''X4:''' pSB1A2+''crtB'' (as M36; BBa_K118002) (25.07.08: A
| + | [[Edinburgh/Notebook/Maxipreps|Maxipreps]]<br /> |
| | + | [[Edinburgh/Notebook/Plates|Plates]]<br /> |
Click on a date to see a summary of labwork done on that day. Up-to-date to end 12 October. Best viewed with Mozilla Firefox.
"
