Team:Illinois/Antibody GPCR Fusion Notebook

From 2008.igem.org

(Difference between revisions)
(→Primers)
 
(114 intermediate revisions not shown)
Line 1: Line 1:
 +
[[Image:GPCRnotebookpic.png]]
{{bottom_template}}
{{bottom_template}}
<!--PLACE TEXT BELOW HERE -->
<!--PLACE TEXT BELOW HERE -->
-
== 22nd July ==
+
== Recipes ==
-
* Yeast obtained from Dr. Zhao
+
* Tris-Cl, 1M
 +
** Dissolve 121g Tris base in 800ml H2O
 +
** Adjust to desired pH with concentrated HCl
 +
** Mix and add H2O to 1 liter
 +
** (Approximately, 20ml HCl for pH 7.4 and 42ml for pH 8.0)
-
  == 24th July ==
+
* EDTA, 0.5M (pH 8.0)
 +
** Dissolve 186.1g Na2 EDTA-2H2O in 700ml H20
 +
** Adjust pH to 8.0 with 10M NaOH(~50ml)
 +
** Add H2O to 1 liter
 +
 
 +
 
 +
* Breaking buffer - 100ml
 +
** 2ml Triton X-100
 +
** 1ml Sodium dodecyl sulfate (SDS)
 +
** 0.5844g NaCl (100mM)
 +
** 1ml 1M Tris-Cl pH 8.0 (10mM)
 +
** 200uL 0.5M EDTA (1mM)
 +
 
 +
 
 +
==Primers==
 +
 
 +
PGK promoter
 +
Fwd:5'TTTT GAATTC AAAGATGCCGATTTGGGCGC   
 +
Rev:5'TTTT GAGCTC GTTTTATATTTGTTGTAAAA
 +
 
 +
PGK terminator
 +
Fwd:5'TTAT GGGCCC GAAATAAATTGAATTGAATT   
 +
Rev:5'TTTTG AAGCTT CAGCTTTAACGAACGCAGA
 +
 
 +
Ste2
 +
Fwd:5'GCCC TCTAGA ATGTCTGATGCGGCTCCTTC     
 +
Rev:5'TTAT GGGCCC TCATAAATTATTATTATCTT
 +
 
 +
Fus1 upstream
 +
Fwd:5'GTGG GAATTC TAATAATCAGAACTCCAACA     
 +
Rev:5'GGCG TCTAGA TTTGATTTTCAGAAACTTGA
 +
 
 +
Fus1 downstream:
 +
Fwd:5'GCGA GGTACC TGAAAATAATATTGACGTTC 
 +
Rev:5'TTAT GCGGCCGC TATTCACCAGACCCGCTCCT
 +
 
 +
== 22nd July ==
 +
* Yeast obtained from Dr. Zhao
 +
**W303a ''S. Cerevisiae''
 +
 
 +
== 24th July ==
* Prepared liquid culture for DNA extraction
* Prepared liquid culture for DNA extraction
* Made 1M Tris. Cl pH 8.0
* Made 1M Tris. Cl pH 8.0
Line 13: Line 58:
-
== 22nd August ==
+
== 22nd August ==
-
* Attempted DNA extraction
+
* Attempted DNA extraction of W303a genomic DNA
-
** Result: Failed
+
**Protocol from Wiley's ''Current Protocols in Molecular Biology''
 +
** Result: Failed to finish protocol
* Obtained more yeast from Dr. Zhao
* Obtained more yeast from Dr. Zhao
 +
**W303a ''S. cerevisiae''
-
 
+
== 25th August ==
-
== 25th August ==
+
* Prepared overnight culture for DNA extraction (3:27pm)
* Prepared overnight culture for DNA extraction (3:27pm)
-
== 26th August ==
+
== 26th August ==
* Attempted DNA extraction
* Attempted DNA extraction
* Prepped overnight culture
* Prepped overnight culture
-
== 27th August ==
+
== 27th August ==
-
* Performed PCR (FILL IN PCR TABLE)
+
* Performed PCR: PGK Terminator
-
* Prepped 3 overnight cultures
+
 +
{| class="wikitable" border="1"
 +
|-
 +
|Buffer G
 +
|12.5uL
 +
|x4
 +
|50uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x4
 +
|2uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x4
 +
|2uL
 +
|-
 +
|H2O
 +
|10.8uL
 +
|x4
 +
|43.2uL
 +
|-
 +
|Taq
 +
|0.2uL
 +
|x4
 +
|0.8uL
 +
|-
 +
|template
 +
|colspan="4"|0.5ul
 +
|-
 +
|Negative control
 +
|3 H2O
 +
|}
-
== 28th August ==  
+
 
 +
*PCR program:
 +
** 4 min 94 degrees
 +
** 25-30x 30s 94 degrees
 +
** 30s Tm primers
 +
** 1 min/KB 72 degrees
 +
** 7 min 72 degrees
 +
 
 +
* For the gel: 5uL loading dye gel is in cold room
 +
 
 +
* Prepped 3 overnight cultures
 +
 
 +
== 28th August ==  
* Extracted DNA from 4 cultures
* Extracted DNA from 4 cultures
-
* Ran gel of PCR products (1.5%, 200V)
+
* Ran gel of PCR products (1.5% agarose, 200V)
** Result: No bands present
** Result: No bands present
 +
[[Image:GPCR8-28.jpg|190px]]
 +
== 2nd September ==
 +
* PCR: PGK Terminator
 +
{| class="wikitable" border="1"
 +
|-
 +
|5 PRIME Mastermix
 +
|10uL
 +
|x3
 +
|30uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Template
 +
|10uL
 +
|x3
 +
|30uL
 +
|-
 +
|H2O
 +
|10.8uL
 +
|x4
 +
|43.2uL
 +
|-
 +
|Negative control
 +
|25uL H2O
 +
|}
 +
 +
== 3rd September ==
 +
* Ran gel
 +
** Ladder lane 7
 +
** Sample 7 spilled
 +
** 1% agarose
 +
** 120V
 +
*** Too low
 +
** 50 minutes
 +
*Poor results--no bands present
 +
 +
== 8th September ==
 +
* PCR: PGK Terminator
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|5PRIME Mastermix
 +
|10uL
 +
|x3
 +
|30uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Template
 +
|14uL
 +
|x3
 +
|42uL
 +
|-
 +
|}
 +
* Prepped 4 overnight cultures
 +
** Yeast dried out again
 +
 +
== 9th September ==
 +
* Signs of life in 3 of the cultures
 +
** Wait until tomorrow
 +
* Ran gel on PCR from 8th September--no bands present
 +
** 150V, 50 minutes
 +
** No sign of DNA
 +
* Ladder from Courtney
 +
 +
== 10th September ==
 +
* Split culture
 +
* Ran gel from 8th September again--no bands present
 +
** 150V, 50 minutes
 +
** 0.75% gel
 +
** Ladder from Courtney
 +
 +
== 11th September ==
 +
* PCR: PGK Terminator
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|5 PRIME Mastermix
 +
|10uL
 +
|x3
 +
|30uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Template
 +
|14uL
 +
|x3
 +
|42uL
 +
|-
 +
|}
 +
 +
== 12th September ==
 +
* Isolated genomic DNA from 8 cultures of W303a yeast cells
 +
**Protocol from Wiley's ''Current Protocols in Molecular Biology''
 +
**Labeled templates 1,2,3,4 and 1a,2a,3a,4a
 +
 +
 +
* Ran gel of PCR from 11th September
 +
** 1% agarose
 +
** 150V
 +
** 38 mins
 +
*** Poor results
 +
 +
== 15th September ==
 +
* PCR PGK Promotor
 +
** Finnzymes Phusion High Fidelity DNA Polymerase
 +
*** F-530, 20V (2V/uL)
   
   
 +
{| class="wikitable" border="1"
 +
|-
 +
|5x Phusion HF Buffer
 +
|10uL
 +
|x3
 +
|30uL
 +
|-
 +
|10mM dNTPs
 +
|1uL
 +
|x3
 +
|3uL
 +
|-
 +
|Primer A(Forward)
 +
|1uL
 +
|x3
 +
|3uL
 +
|-
 +
|Primer B(Reverse)
 +
|1uL
 +
|x3
 +
|3uL
 +
|-
 +
|Template 1
 +
|10uL
 +
|x3
 +
|30uL
 +
|-
 +
|Phusions DNA polymerase
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|H2O
 +
|26.5uL
 +
|x3
 +
|79.5uL
 +
|}
 +
 +
== 18th September ==
 +
* Ran reaction mentioned on 15th September
 +
* Extracted DNA from gel from 8th September (PGK Terminator)
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|Tube
 +
|Gel(g)
 +
|-
 +
|1
 +
|0.332
 +
|-
 +
|2
 +
|0.278
 +
|-
 +
|3
 +
|0.307
 +
|-
 +
|4
 +
|0.349
 +
|-
 +
|5
 +
|0.385
 +
|}
 +
 +
== 19th September ==
 +
* Gel of PGK Promotor from 15th September has no DNA present
 +
 +
== 23rd September ==
 +
* PCR: Fus1 Downstream
 +
* EPICENTRE Bioetechnologies - MasterAmp(TM) Taq DNA Polymerase
 +
 +
* Per 50uL of reaction,
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterAmp Taq 10x PCR Buffer
 +
|5uL
 +
|-
 +
|1mM dNTPs
 +
|1uL
 +
|-
 +
|Primer 1
 +
|0.5uL
 +
|-
 +
|Primer 2
 +
|0.5uL
 +
|-
 +
|25mM MgCl2
 +
|2uL
 +
|-
 +
|Taq DNA Polymerase
 +
|0.25uL
 +
|-
 +
|Template 2
 +
|20uL
 +
|-
 +
|Water
 +
|20.75uL
 +
|}
 +
 +
* PCR Settings:
 +
** 4mins, 94 degree celcius
 +
** 30s, 94 degree celcius
 +
** 30s, 5 degrees below primer melting temperature
 +
** 1 min, 72 degree celcius -- to step 2 -- 30x
 +
** 7 min, 72 degree celcius
 +
 +
== 24th September ==
 +
* Ran gel of Fus1 Downstream from 23rd September
 +
** Result: No DNA present on gel
 +
 +
== 25th September ==
 +
* PCR: Fus1 Upstream
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|Mastermix
 +
|8.25uL
 +
|x3
 +
|24.75uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Template 3
 +
|20uL
 +
|x3
 +
|60uL
 +
|-
 +
|Water
 +
|20.75uL
 +
|x3
 +
|62.25uL
 +
|-
 +
|}
 +
 +
**same protocol as 23rd September
 +
**The master mix contains the buffer, dNTPs, MgCl, and Taq
 +
**Template 3 (3 reactions run)
 +
 +
== 30th September ==
 +
* PCR: Fus1 Upstream
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|Mastermix
 +
|8.25uL
 +
|x3
 +
|24.75uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Template 3
 +
|20uL
 +
|x3
 +
|60uL
 +
|-
 +
|Water
 +
|20.75uL
 +
|x3
 +
|62.25uL
 +
|-
 +
|}
 +
** same protocol as 23rd September
 +
** Template 4 and 1a (3 reactions each)
 +
 +
** Gel: 1% agarose, 150V, 35 minutes -> poor results
 +
** lanes 2,3 -> faint smear
 +
[[Image:GPCR_FUS1_upstream_9-30.jpg|190px]]
 +
 +
== 1st October ==
 +
* PCR: Ste2
 +
{| class="wikitable" border="1"
 +
|-
 +
|Mastermix
 +
|8.25uL
 +
|x3
 +
|24.75uL
 +
|-
 +
|Forward Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Reverse Primer
 +
|0.5uL
 +
|x3
 +
|1.5uL
 +
|-
 +
|Template 3
 +
|20uL
 +
|x3
 +
|60uL
 +
|-
 +
|Water
 +
|20.75uL
 +
|x3
 +
|62.25uL
 +
|-
 +
|}
 +
**same protocol as 23rd September
 +
**Templates 2a, 3a, 4a used (3 reactions each)
 +
 +
==3rd October==
 +
* Ran Ste2 gel from 1st October
 +
[[Image:GPCR10-3.jpg|190px]]
 +
 +
== 8th October ==
 +
* PCR: PGK Terminator
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|PCR Buffer
 +
|5uL
 +
|-
 +
|10mM dNTPs
 +
|1uL
 +
|-
 +
|Forward Primer
 +
|1uL
 +
|-
 +
|Reverse Primer
 +
|1uL
 +
|-
 +
|MgCl2
 +
|5uL
 +
|-
 +
|Taq DNA Polymerase
 +
|0.25uL
 +
|-
 +
|Template
 +
|25uL
 +
|-
 +
|Water
 +
|11.75uL
 +
|}
 +
 +
**same protocol as 23rd September
 +
** Use DNA extracted from gel on 18th September (5 reactions)
 +
* Also extracted DNA from gel from 30th September (Fus1 Upstream)
 +
 +
== 9th October ==
 +
* PCR: Ste2
 +
**Protocol is the same as 23rd September
 +
** Template used is product from 1st October (9 reactions total)
 +
 +
* PCR: Fus1 Upstream
 +
**Protocal matches 23rd September
 +
**Template used was DNA extracted from the gel from the 8th October, which came from the PCR run on 30th September (5 reactions total)
 +
 +
 +
 +
* Ran Ste2 gel from today
 +
[[Image:GPCR10-09Ste2.jpg|190px]]
 +
* Ran PGK terminator gel from yesterday
 +
[[Image:GPCR10-09PGKp.jpg|190px]]
 +
 +
== 12th October ==
 +
* PCR: Fus1 (3 reactions each)
 +
**Template is products from 9th October
 +
 +
== 13th October ==
 +
* Ran gel of PCR with Fus1
 +
* Used 25uL or product, 5uL of loading dye
 +
[[Image:GPCR10-13.jpg|190px]]
 +
 +
== 14th October ==
 +
* Fus1 PCR
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterAmp Taq 10x PCR Buffer
 +
|5uL
 +
|-
 +
|1mM dNTPs
 +
|1uL
 +
|-
 +
|Primer 1
 +
|0.5uL
 +
|-
 +
|Primer 2
 +
|0.5uL
 +
|-
 +
|25mM MgCl2
 +
|5uL
 +
|-
 +
|Taq DNA Polymerase
 +
|0.25uL
 +
|-
 +
|Template
 +
|25uL
 +
|-
 +
|Water
 +
|11.75uL
 +
|}
 +
* Template is reaction from 12th October
 +
 +
== 15th October ==
 +
*PCR PGK Terminator
 +
{| class="wikitable" border="1"
 +
|-
 +
|5 PRIME MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|25uL
 +
|-
 +
|Water
 +
|4uL
 +
|}
 +
 +
*Ran gel of Ste2 from 10/14
 +
[[Image:GPCR10-15Ste2.jpg|190px]]
 +
*Ran gel of Fus1 upstream from 10/14 (no ladder, oops)
 +
[[Image:GPCR10-15.jpg|190px]]
 +
 +
== 16th October ==
 +
* PCR: Fus1 Downstream, PGK Promoter
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
 +
** Tube 1: Template 4 - Fus1
 +
** Tube 2: Template 4a - Fus1
 +
** Tube 3: Template 4 - PGK Promoter
 +
** Tube 4: Template 4a - PGK Promoter
 +
 +
*ran Gel of above
 +
[[Image:GPCR10-16Fusd.jpg|190px]]
 +
 +
*ran Gel of PGK terminator from 10/15
 +
[[Image:GPCR10-16.jpg|190px]]
 +
 +
 +
 +
* Extracted Ste2 from 10/15 and re-amplified:
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
 +
== 17th October ==
 +
* Ran gel of Ste2 from 10/16
 +
** Tube 1 - lane 2,3
 +
** Tube 2 - lane 5,6
 +
[[Image:GPCR10-17.jpg|190px]]
 +
 +
* PCR: Fus1 upstream
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
**template is products from 10/14
 +
 +
* PCR: PGK Terminator
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
**Template is products from 10/15
 +
 +
* Extracted Ste2(Gel from today)
 +
 +
== 18th October==
 +
Ran gel of Fus1 upstream and PGK terminator from yesterday
 +
[[Image:GPCR10-18.jpg|190px]]
 +
 +
== 20th October ==
 +
* Extracting chromosomal DNA from yeast cells
 +
** W303A - Yellow
 +
** YPD DL
 +
** YHP1 YPD HD - One is orange (YHP1)(Cap was removed in incubator), Other is Yellow
 +
 +
** Orange  - YHP1 YPD HD
 +
** Green - YHP2 YPD HD
 +
** Pink - W303A YPA DL
 +
** Yellow - WD303A YPD DL
 +
 +
== 21st October ==
 +
* PCR: Ste2
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
 +
* 2 tubes
 +
* Block B of black machine
 +
* Annealing temperature: 31 degrees celcius
 +
 +
* Ran gel on Ste2 from today
 +
[[Image:GPCR10-21.jpg|190px]]
 +
 +
== 22nd October ==
 +
* New primers for biobricks are here
 +
** Brought to standard concentration, 30uM
 +
** Added 33.3uL of water per nmol primer
 +
 +
* PCR: Fus1 and PGK Terminator
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.75uL
 +
|-
 +
|Primer Rev
 +
|0.75uL
 +
|-
 +
|Template
 +
|25uL
 +
|-
 +
|Water
 +
|3.5uL
 +
|}
 +
 +
** Forward and Reverse primers are new biobrick primers that arrived today
 +
** Template is PCR product from 17th October
 +
 +
** A,B,C -> Fus1 Upstream -> 1,2,3
 +
** 1,2 -> PGK Terminator -> 4,5
 +
** Annealing temperature: 38 degrees celcius
 +
** In freezer in yellow case
 +
 +
* PCR: Ste2
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|25uL
 +
|-
 +
|Water
 +
|4uL
 +
|}
 +
 +
** Forward primer, Reverse Primer are new primers that arrived today
 +
** Template is PCR product from 21st October
 +
** Two tubes in block B
 +
 +
* The 3 gels in the cold room do not have EtBr
 +
 +
== 23rd October ==
 +
* Ran gel of Fus1 Upstream, PGK Terminator, Ste2 from yesterday
 +
** 1% Agarose
 +
[[Image:GPCR10-23.jpg|190px]]
 +
 +
* PCR: Fus1 Downstream, PGK Promoter
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
 +
** 4 reactions each of Fus1 Upstream(1,2,3,4) and PGK Promoter(A,B,C,D)
 +
*Gel shows no bands.
 +
 +
 +
* PCR: Fus1 Downstream, Fus1 Upstream, PGK Promoter, PGK Terminator, Ste2
 +
** Template genomic DNA from 20th October (x4 different reactions)
 +
** Used all Template
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|20uL
 +
|-
 +
|Water
 +
|9uL
 +
|}
 +
*Gel shows no bands
 +
 +
==24th October==
 +
*Ran gel of Fus1 upstream(lanes 3,4,5), PGK terminator(lanes6,7), and Ste2(lanes 8,9) from 10/22
 +
**ladder is lane 2; 1 and 10 are nothing
 +
[[Image:GPCR10-22.jpg|190px]]
 +
 +
*PCR of Fus1 downstream, Fus1 upstream, PGK promoter, PGK terminator, Ste2
 +
{| class="wikitable" border="1"
 +
|-
 +
|MasterMix
 +
|20uL
 +
|-
 +
|Primer Fwd
 +
|0.5uL
 +
|-
 +
|Primer Rev
 +
|0.5uL
 +
|-
 +
|Template
 +
|29uL
 +
|}
 +
**The templates were the rest of the genomic DNA extracts from 9/12
 +
**Three reactions of each gene were run
 +
 +
*Gel from above:
 +
[[Image:GPCR10-24.jpg|190px]][[Image:GPCR10-24(cont.).jpg|190px]]
 +
*(on left)Fus1 downstream lanes 2,3,4; Fus1 upstream lanes 5,6,7; PGK promoter lanes 8,9,10;
 +
*(on right)PGK terminator lanes2,3,10; Ste2 lanes 4,5,6; Fus1 downstream lanes 7,8,9;
 +
 +
==25th October==
 +
*Extracted DNA from the gel from 10/24
 +
**FUS1 upstream from the higher bands of lanes 3 and 4
 +
**PGK terminator from the lower bands of lanes 6 and 7
 +
*DNA ligation
 +
{| class="wikitable" border="1"
 +
|-
 +
|DNA
 +
|5uL
 +
|-
 +
|buffer
 +
|5uL
 +
|-
 +
|Re1 (Pst1)
 +
|1uL
 +
|-
 +
|Re2 (EcoR1)
 +
|1uL
 +
|-
 +
|Water
 +
|37.5uL
 +
|}
 +
 +
==26th October==
 +
*Incubate for 20mins at 80 degrees celcius
 +
{| class="wikitable" border="1"
 +
|-
 +
|Ligation Buffer
 +
|4uL
 +
|-
 +
|DNA Ligase
 +
|1uL
 +
|-
 +
|DNA
 +
|3uL
 +
|-
 +
|Plasmid
 +
|9uL
 +
|-
 +
|Water
 +
|3uL
 +
|}
 +
*Let sit for 5 min.
 +
*5uL of above mixture to competent cells
 +
**30 min. on ice
 +
*Heat shock 30s (42 degrees)
 +
*Add SOC Media (200uL)
 +
**Incubate 60 min.(37 degrees)
 +
*Plate 200uL
 +
**Incubate 37 degrees celcius overnight
 +
 +
==27th October==
 +
The transformation failed; try again with the same protocol:
 +
*Using extracts 3 and 7 (+Ligation buffers, Ligase, Plasmid, and Water)
 +
 +
*Failed again.
<!-- == Insert Date Here ==
<!-- == Insert Date Here ==
Line 46: Line 940:
* second lab procedure
* second lab procedure
** more about second lab procedure
** more about second lab procedure
-
COPY/PASTE THEN REMOVE THIS AND BRACKETS-->
+
COPY/PASTE THEN REMOVE THIS, BRACKETS, DASHES, AND EXCLAMATION MARK-->
{{bottom_template}}
{{bottom_template}}

Latest revision as of 02:55, 30 October 2008

GPCRnotebookpic.png

Home Team Project Notebook Research Articles Parts Protocols Pictures


Contents

Recipes

  • Tris-Cl, 1M
    • Dissolve 121g Tris base in 800ml H2O
    • Adjust to desired pH with concentrated HCl
    • Mix and add H2O to 1 liter
    • (Approximately, 20ml HCl for pH 7.4 and 42ml for pH 8.0)


  • EDTA, 0.5M (pH 8.0)
    • Dissolve 186.1g Na2 EDTA-2H2O in 700ml H20
    • Adjust pH to 8.0 with 10M NaOH(~50ml)
    • Add H2O to 1 liter


  • Breaking buffer - 100ml
    • 2ml Triton X-100
    • 1ml Sodium dodecyl sulfate (SDS)
    • 0.5844g NaCl (100mM)
    • 1ml 1M Tris-Cl pH 8.0 (10mM)
    • 200uL 0.5M EDTA (1mM)


Primers

PGK promoter Fwd:5'TTTT GAATTC AAAGATGCCGATTTGGGCGC Rev:5'TTTT GAGCTC GTTTTATATTTGTTGTAAAA

PGK terminator Fwd:5'TTAT GGGCCC GAAATAAATTGAATTGAATT Rev:5'TTTTG AAGCTT CAGCTTTAACGAACGCAGA

Ste2 Fwd:5'GCCC TCTAGA ATGTCTGATGCGGCTCCTTC Rev:5'TTAT GGGCCC TCATAAATTATTATTATCTT

Fus1 upstream Fwd:5'GTGG GAATTC TAATAATCAGAACTCCAACA Rev:5'GGCG TCTAGA TTTGATTTTCAGAAACTTGA

Fus1 downstream: Fwd:5'GCGA GGTACC TGAAAATAATATTGACGTTC Rev:5'TTAT GCGGCCGC TATTCACCAGACCCGCTCCT

22nd July

  • Yeast obtained from Dr. Zhao
    • W303a S. Cerevisiae

24th July

  • Prepared liquid culture for DNA extraction
  • Made 1M Tris. Cl pH 8.0
  • Made 4M ammonium acetate


22nd August

  • Attempted DNA extraction of W303a genomic DNA
    • Protocol from Wiley's Current Protocols in Molecular Biology
    • Result: Failed to finish protocol
  • Obtained more yeast from Dr. Zhao
    • W303a S. cerevisiae

25th August

  • Prepared overnight culture for DNA extraction (3:27pm)


26th August

  • Attempted DNA extraction
  • Prepped overnight culture


27th August

  • Performed PCR: PGK Terminator
Buffer G 12.5uL x4 50uL
Forward Primer 0.5uL x4 2uL
Reverse Primer 0.5uL x4 2uL
H2O 10.8uL x4 43.2uL
Taq 0.2uL x4 0.8uL
template 0.5ul
Negative control 3 H2O


  • PCR program:
    • 4 min 94 degrees
    • 25-30x 30s 94 degrees
    • 30s Tm primers
    • 1 min/KB 72 degrees
    • 7 min 72 degrees
  • For the gel: 5uL loading dye gel is in cold room
  • Prepped 3 overnight cultures

28th August

  • Extracted DNA from 4 cultures
  • Ran gel of PCR products (1.5% agarose, 200V)
    • Result: No bands present

GPCR8-28.jpg

2nd September

  • PCR: PGK Terminator
5 PRIME Mastermix 10uL x3 30uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 10uL x3 30uL
H2O 10.8uL x4 43.2uL
Negative control 25uL H2O

3rd September

  • Ran gel
    • Ladder lane 7
    • Sample 7 spilled
    • 1% agarose
    • 120V
      • Too low
    • 50 minutes
  • Poor results--no bands present

8th September

  • PCR: PGK Terminator
5PRIME Mastermix 10uL x3 30uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 14uL x3 42uL
  • Prepped 4 overnight cultures
    • Yeast dried out again

9th September

  • Signs of life in 3 of the cultures
    • Wait until tomorrow
  • Ran gel on PCR from 8th September--no bands present
    • 150V, 50 minutes
    • No sign of DNA
  • Ladder from Courtney

10th September

  • Split culture
  • Ran gel from 8th September again--no bands present
    • 150V, 50 minutes
    • 0.75% gel
    • Ladder from Courtney

11th September

  • PCR: PGK Terminator
5 PRIME Mastermix 10uL x3 30uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 14uL x3 42uL

12th September

  • Isolated genomic DNA from 8 cultures of W303a yeast cells
    • Protocol from Wiley's Current Protocols in Molecular Biology
    • Labeled templates 1,2,3,4 and 1a,2a,3a,4a


  • Ran gel of PCR from 11th September
    • 1% agarose
    • 150V
    • 38 mins
      • Poor results

15th September

  • PCR PGK Promotor
    • Finnzymes Phusion High Fidelity DNA Polymerase
      • F-530, 20V (2V/uL)
5x Phusion HF Buffer 10uL x3 30uL
10mM dNTPs 1uL x3 3uL
Primer A(Forward) 1uL x3 3uL
Primer B(Reverse) 1uL x3 3uL
Template 1 10uL x3 30uL
Phusions DNA polymerase 0.5uL x3 1.5uL
H2O 26.5uL x3 79.5uL

18th September

  • Ran reaction mentioned on 15th September
  • Extracted DNA from gel from 8th September (PGK Terminator)
Tube Gel(g)
1 0.332
2 0.278
3 0.307
4 0.349
5 0.385

19th September

  • Gel of PGK Promotor from 15th September has no DNA present

23rd September

  • PCR: Fus1 Downstream
  • EPICENTRE Bioetechnologies - MasterAmp(TM) Taq DNA Polymerase
  • Per 50uL of reaction,
MasterAmp Taq 10x PCR Buffer 5uL
1mM dNTPs 1uL
Primer 1 0.5uL
Primer 2 0.5uL
25mM MgCl2 2uL
Taq DNA Polymerase 0.25uL
Template 2 20uL
Water 20.75uL
  • PCR Settings:
    • 4mins, 94 degree celcius
    • 30s, 94 degree celcius
    • 30s, 5 degrees below primer melting temperature
    • 1 min, 72 degree celcius -- to step 2 -- 30x
    • 7 min, 72 degree celcius

24th September

  • Ran gel of Fus1 Downstream from 23rd September
    • Result: No DNA present on gel

25th September

  • PCR: Fus1 Upstream
Mastermix 8.25uL x3 24.75uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 3 20uL x3 60uL
Water 20.75uL x3 62.25uL
    • same protocol as 23rd September
    • The master mix contains the buffer, dNTPs, MgCl, and Taq
    • Template 3 (3 reactions run)

30th September

  • PCR: Fus1 Upstream
Mastermix 8.25uL x3 24.75uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 3 20uL x3 60uL
Water 20.75uL x3 62.25uL
    • same protocol as 23rd September
    • Template 4 and 1a (3 reactions each)
    • Gel: 1% agarose, 150V, 35 minutes -> poor results
    • lanes 2,3 -> faint smear

GPCR FUS1 upstream 9-30.jpg

1st October

  • PCR: Ste2
Mastermix 8.25uL x3 24.75uL
Forward Primer 0.5uL x3 1.5uL
Reverse Primer 0.5uL x3 1.5uL
Template 3 20uL x3 60uL
Water 20.75uL x3 62.25uL
    • same protocol as 23rd September
    • Templates 2a, 3a, 4a used (3 reactions each)

3rd October

  • Ran Ste2 gel from 1st October

GPCR10-3.jpg

8th October

  • PCR: PGK Terminator
PCR Buffer 5uL
10mM dNTPs 1uL
Forward Primer 1uL
Reverse Primer 1uL
MgCl2 5uL
Taq DNA Polymerase 0.25uL
Template 25uL
Water 11.75uL
    • same protocol as 23rd September
    • Use DNA extracted from gel on 18th September (5 reactions)
  • Also extracted DNA from gel from 30th September (Fus1 Upstream)

9th October

  • PCR: Ste2
    • Protocol is the same as 23rd September
    • Template used is product from 1st October (9 reactions total)
  • PCR: Fus1 Upstream
    • Protocal matches 23rd September
    • Template used was DNA extracted from the gel from the 8th October, which came from the PCR run on 30th September (5 reactions total)


  • Ran Ste2 gel from today

GPCR10-09Ste2.jpg

  • Ran PGK terminator gel from yesterday

GPCR10-09PGKp.jpg

12th October

  • PCR: Fus1 (3 reactions each)
    • Template is products from 9th October

13th October

  • Ran gel of PCR with Fus1
  • Used 25uL or product, 5uL of loading dye

GPCR10-13.jpg

14th October

  • Fus1 PCR
MasterAmp Taq 10x PCR Buffer 5uL
1mM dNTPs 1uL
Primer 1 0.5uL
Primer 2 0.5uL
25mM MgCl2 5uL
Taq DNA Polymerase 0.25uL
Template 25uL
Water 11.75uL
  • Template is reaction from 12th October

15th October

  • PCR PGK Terminator
5 PRIME MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 25uL
Water 4uL
  • Ran gel of Ste2 from 10/14

GPCR10-15Ste2.jpg

  • Ran gel of Fus1 upstream from 10/14 (no ladder, oops)

GPCR10-15.jpg

16th October

  • PCR: Fus1 Downstream, PGK Promoter
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • Tube 1: Template 4 - Fus1
    • Tube 2: Template 4a - Fus1
    • Tube 3: Template 4 - PGK Promoter
    • Tube 4: Template 4a - PGK Promoter
  • ran Gel of above

GPCR10-16Fusd.jpg

  • ran Gel of PGK terminator from 10/15

GPCR10-16.jpg


  • Extracted Ste2 from 10/15 and re-amplified:
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL

17th October

  • Ran gel of Ste2 from 10/16
    • Tube 1 - lane 2,3
    • Tube 2 - lane 5,6

GPCR10-17.jpg

  • PCR: Fus1 upstream
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • template is products from 10/14
  • PCR: PGK Terminator
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • Template is products from 10/15
  • Extracted Ste2(Gel from today)

18th October

Ran gel of Fus1 upstream and PGK terminator from yesterday GPCR10-18.jpg

20th October

  • Extracting chromosomal DNA from yeast cells
    • W303A - Yellow
    • YPD DL
    • YHP1 YPD HD - One is orange (YHP1)(Cap was removed in incubator), Other is Yellow
    • Orange - YHP1 YPD HD
    • Green - YHP2 YPD HD
    • Pink - W303A YPA DL
    • Yellow - WD303A YPD DL

21st October

  • PCR: Ste2
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
  • 2 tubes
  • Block B of black machine
  • Annealing temperature: 31 degrees celcius
  • Ran gel on Ste2 from today

GPCR10-21.jpg

22nd October

  • New primers for biobricks are here
    • Brought to standard concentration, 30uM
    • Added 33.3uL of water per nmol primer
  • PCR: Fus1 and PGK Terminator
MasterMix 20uL
Primer Fwd 0.75uL
Primer Rev 0.75uL
Template 25uL
Water 3.5uL
    • Forward and Reverse primers are new biobrick primers that arrived today
    • Template is PCR product from 17th October
    • A,B,C -> Fus1 Upstream -> 1,2,3
    • 1,2 -> PGK Terminator -> 4,5
    • Annealing temperature: 38 degrees celcius
    • In freezer in yellow case
  • PCR: Ste2
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 25uL
Water 4uL
    • Forward primer, Reverse Primer are new primers that arrived today
    • Template is PCR product from 21st October
    • Two tubes in block B
  • The 3 gels in the cold room do not have EtBr

23rd October

  • Ran gel of Fus1 Upstream, PGK Terminator, Ste2 from yesterday
    • 1% Agarose

GPCR10-23.jpg

  • PCR: Fus1 Downstream, PGK Promoter
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
    • 4 reactions each of Fus1 Upstream(1,2,3,4) and PGK Promoter(A,B,C,D)
  • Gel shows no bands.


  • PCR: Fus1 Downstream, Fus1 Upstream, PGK Promoter, PGK Terminator, Ste2
    • Template genomic DNA from 20th October (x4 different reactions)
    • Used all Template
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 20uL
Water 9uL
  • Gel shows no bands

24th October

  • Ran gel of Fus1 upstream(lanes 3,4,5), PGK terminator(lanes6,7), and Ste2(lanes 8,9) from 10/22
    • ladder is lane 2; 1 and 10 are nothing

GPCR10-22.jpg

  • PCR of Fus1 downstream, Fus1 upstream, PGK promoter, PGK terminator, Ste2
MasterMix 20uL
Primer Fwd 0.5uL
Primer Rev 0.5uL
Template 29uL
    • The templates were the rest of the genomic DNA extracts from 9/12
    • Three reactions of each gene were run
  • Gel from above:

GPCR10-24.jpgGPCR10-24(cont.).jpg

  • (on left)Fus1 downstream lanes 2,3,4; Fus1 upstream lanes 5,6,7; PGK promoter lanes 8,9,10;
  • (on right)PGK terminator lanes2,3,10; Ste2 lanes 4,5,6; Fus1 downstream lanes 7,8,9;

25th October

  • Extracted DNA from the gel from 10/24
    • FUS1 upstream from the higher bands of lanes 3 and 4
    • PGK terminator from the lower bands of lanes 6 and 7
  • DNA ligation
DNA 5uL
buffer 5uL
Re1 (Pst1) 1uL
Re2 (EcoR1) 1uL
Water 37.5uL

26th October

  • Incubate for 20mins at 80 degrees celcius
Ligation Buffer 4uL
DNA Ligase 1uL
DNA 3uL
Plasmid 9uL
Water 3uL
  • Let sit for 5 min.
  • 5uL of above mixture to competent cells
    • 30 min. on ice
  • Heat shock 30s (42 degrees)
  • Add SOC Media (200uL)
    • Incubate 60 min.(37 degrees)
  • Plate 200uL
    • Incubate 37 degrees celcius overnight

27th October

The transformation failed; try again with the same protocol:

  • Using extracts 3 and 7 (+Ligation buffers, Ligase, Plasmid, and Water)
  • Failed again.


Home Team Project Notebook Research Articles Parts Protocols Pictures

Retrieved from "http://2008.igem.org/Team:Illinois/Antibody_GPCR_Fusion_Notebook"