Team:KULeuven/Primers

From 2008.igem.org

(Difference between revisions)
(New page: {{:Team:KULeuven/Tools/Navigation_Bar}} {|cellspacing="1" width=100% ! style="background:#003E81; color: white" colspan="5" | Table of Oligos |-style="background:#99CCFF" align="center" |...)
m
Line 48: Line 48:
|name=GFP-LVA Rev
|name=GFP-LVA Rev
|sequence=ctgcagcggccgctactagtattattaagctactaaagcgtagttttcgtcgtttgcagcaggc
|sequence=ctgcagcggccgctactagtattattaagctactaaagcgtagttttcgtcgtttgcagcaggc
-
|length=64
+
|length=64bp
|comments=Reverse GFP-LVA primer
|comments=Reverse GFP-LVA primer
}}
}}
Line 55: Line 55:
|name=VF2
|name=VF2
|sequence=TGCCACCTGACGTCTAAGAA
|sequence=TGCCACCTGACGTCTAAGAA
-
|length=20
+
|length=20bp
|comments=Forward primer for sequence analysis
|comments=Forward primer for sequence analysis
}}
}}
Line 62: Line 62:
|name=VR
|name=VR
|sequence=ATTACCGCCTTTGAGTGAGC
|sequence=ATTACCGCCTTTGAGTGAGC
-
|length=20
+
|length=20bp
|comments=Reverse primer for sequence analysis
|comments=Reverse primer for sequence analysis
}}
}}
|}
|}

Revision as of 15:32, 29 July 2008

Result:

To have a dropdown for your own team copy over all of the content below. It might be needed to adjust a thing or two. Comments have been added throughout the code what must be changed.

Inspirational websites:

  • [http://javascript-array.com/scripts/simple_drop_down_menu/ Most basic dropdown menu, with no submenu's]
  • [http://jquery.com/ The javascript library used to add effects and optimise the dropdown]
  • [http://www.tyssendesign.com.au/articles/css/centering-a-dropdown-menu/ How to center a ul list effectively]

The dropdown has been created and developed by the KULeuven team.

<html>

<style type="text/css">
#content {z-index:4;}
#ddwrapper * {z-index:8 !important;}

div#ddwrapper {
	margin:0;
	padding:0;
	height:28px;
	width:945px;				/* change to adjust imperfections in width */
}
div#ddnav {
	margin:0 auto;				/* needed to center the dropdown */
	padding:0;
	top:5px;
	/* width: 965px */
	visibility:hidden;			/* dropdown is hidden until properly initalised by javascript */
}
div#ddtoggle {
	margin:0;
	position:fixed;
	right:2px;
	top:15px;
	height:10px;
	width:10px;
	z-index:100;
}

#ddnav ul {
	display:table-row;			/* works only for firefox, later adjusted by javascript for IE */
	margin:0 auto;
	padding:0;
}
#ddnav ul li {
	display:table-cell;			/* works only for firefox, later adjusted by javascript for IE */
	list-style:none;
	margin:0;
	padding:0 !important;
	border-right:1px solid #FFF;		/* creates illusion of spacing between tabs */
}
#ddnav ul li:last-child{border-right:none;}
#ddnav a{
	display:block;
	margin:0;
	padding:4px 14px;			/* play with dimensions for size of tabs */
	background-color:#075A90;		/* background color for tabs */
	color:#FFF !important;			/* font color for text in tabs */
	text-align:center;			/* aligning for text in tabs */
	text-decoration:none !important;
	font:bold 10pt Trebuchet MS;		/* font properties for text in tabs */
	outline:0;
}
#ddnav ul li a:hover {background-color:#99CCFF;}/* background color for tabs on mouseover */
#ddnav li a:active {outline:none;}		/* remove standard dotted border for links when clicked (IE) */
#ddnav li a:focus {-moz-outline-style:none;}	/* remove standard dotted border for links when clicked (FF) */
#ddnav div {
	display:none;
	position:absolute;
	width:9em;
	background-color:#000;			/* bug solution, do not change ! */
	border:1px solid #5970B2;		/* border color for dropdown menus */
	opacity:0.9;				/* transparancy of the dropdown menus (FF) */
	filter:alpha(opacity=90);		/* transparancy of the dropdown menus (IE) */
}
#ddnav div a {
	display:block;
	padding:5px 10px;			/* play with dimensions of block element in dropdown menus */
	position:relative;
	font:normal 8pt arial;			/* font properties for text in dropdown menus */
	text-align:left;			/* aligning of text in dropdown menus */
	cursor:pointer;
}
#ddnav div a:hover, #ddnav span a:hover {color:#000 !important;}	/* text color on mouseover */
#ddnav span div {
	position:relative;
	border:none;
	border-bottom:2px groove #5970B2;	/* separator for submenus, groove does not work in FF */
	opacity:1.0;				/* avoid stacking transparancy for submenus (FF) */
	filter:alpha(opacity=100);		/* avoid stacking transparancy for submenus (IE) */
}

/* may want to upload the following pictures to a new location */
.expand {background: url('https://static.igem.org/mediawiki/2008/e/ef/Icon-expand.png') no-repeat 95% 50%;}
.collapse {background: url('https://static.igem.org/mediawiki/2008/c/cd/Icon-collapse.png') no-repeat 95% 50%;}

.docked {background: #99ccff url("https://static.igem.org/mediawiki/2008/6/62/Ddnavundock.png") no-repeat 50% 50%;}
.undocked {background: #99ccff url("https://static.igem.org/mediawiki/2008/e/e4/Ddnavdock.png") no-repeat 50% 50%;}
</style>

<!-- IMPORTANT: save following script under a personalized webspace or download the library at www.jquery.com -->
<script type="text/javascript" src="http://student.kuleuven.be/~s0173901/wiki/js/jquery.js"></script>
<script type="text/javascript">
	function ddnav() {
		$('#ddnav ul li').hover(
			function () {
				$(this).find('div:first').css('display','block');},
			function () {
				$(this).find('div:first').css('display','none');}
		);
	}
			
	function ddnavsub() {
		$('#ddnav span > a').toggle(
			function () {
				$(this).removeClass("#ddnav expand").addClass("#ddnav collapse");
				$(this).parent().find('div:first').slideDown('fast');
				$(this).hover(
					function (){$(this).css('background-color','#99AAFF');},
					function (){$(this).css('background-color','#99AAFF');});},
			function () {
				$(this).removeClass("#ddnav collapse").addClass("#ddnav expand");
				$(this).parent().find('div:first').css('display','none');
				$(this).hover(
					function (){$(this).css('background-color','#99CCFF');},
					function (){$(this).css('background-color','#075A90');});}
		).addClass("#ddnav expand");
	}
	
	/* If you wish to omit the docking feature, remove following function ddtoggle() */	
	function ddtoggle() {
		$('#ddtoggle').toggle(
			function () {
				$(this).removeClass('undocked').addClass('docked');
				$('#ddnav').css('position','fixed');},
			function () {
				$(this).removeClass('docked').addClass('undocked');
				$('#ddnav').css('position','static');}
		);
	}

	function ddalign() {
		var _windowWidth = $(window).width();
		var _leftOffset = (_windowWidth - 965)/2;

		$('div#ddnav').css('left',_leftOffset);
	}
			
	function ddmsie() {
		$('#ddnav a').hover(
			function () {$(this).css('background-color','#99ccff');},
			function () {$(this).css('background-color','#075a90');}
		);
				
		/* toggle doesn't work yet */
		$('#ddtoggle').css('display','none');
				
		$('#ddnav ul').css('display','inline-block');
		$('#ddnav ul li').css('display','inline');
		$('#ddnav ul li').css('position','relative');
		$('#ddnav ul li>a').css('display','inline-block');
		$('#ddnav ul li>a').css('margin-right','-4px');
				
		$('#ddnav div').css('left','0');
		$('#ddnav div').css('top','100%');
		$('#ddnav span div').css('top','0');
	}
			
	function ddmozilla() {
		ddtoggle();
		$(window).bind('resize', function() {ddalign();});
	}

	$(function () {
		ddnav();
		ddnavsub();

		if(jQuery.browser.msie) ddmsie();
		if(jQuery.browser.mozilla) ddmozilla();

		$('#ddnav').css('visibility','visible');
	});
</script>

<!-- If you wish to omit the docking feature omit following line (div with id ddtoggle) -->
<div id="ddtoggle" class="undocked"></div>
<div id="ddwrapper">
<!-- Here the actual links are defined, simply replace with your own links in the appropriate sections -->
<div id="ddnav" align="center">
<ul>
	<li>
		<a href="https://2008.igem.org/Team:KULeuven">Home</a>
	</li>
	<li>
		<a>The Team</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Team/LabsandGroups">Research Labs and Groups</a>
			<a href="https://2008.igem.org/Team:KULeuven/Team/Students">Students</a>
			<a href="https://2008.igem.org/Team:KULeuven/Team/Instructors">Instructors</a>
			<a href="https://2008.igem.org/Team:KULeuven/Team/Advisors">Advisors</a>
                        <a href="https://2008.igem.org/Team:KULeuven/Team/Pictures">Pictures</a>
		</div>
	</li>
	<li>
		<a>The Project</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Project">Summary</a>
			<span>
				<a>Components</a>
				<div>
					<a href="https://2008.igem.org/Team:KULeuven/Project/Input">Input</a>
					<a href="https://2008.igem.org/Team:KULeuven/Project/Output">Output</a>
					<a href="https://2008.igem.org/Team:KULeuven/Project/Filter">Filter</a>
					<a href="https://2008.igem.org/Team:KULeuven/Project/Inverter">Invertimer</a>
					<a href="https://2008.igem.org/Team:KULeuven/Project/Reset">Reset</a>
					<a href="https://2008.igem.org/Team:KULeuven/Project/CellDeath">Cell Death</a>
					<a href="https://2008.igem.org/Team:KULeuven/Project/Memory">Memory</a>
				</div>
			</span>
                        <a href="https://2008.igem.org/Team:KULeuven/Evaluation">End Evaluation</a>
			<a href="https://2008.igem.org/Team:KULeuven/Literature">Literature</a>
                        <a href="https://2008.igem.org/Team:KULeuven/Brainstorm">Brainstorm</a>
		</div>
	</li>
        <li>
		<a>Ethics</a>
		<div>

		</div>
	</li>
	<li>
		<a>Submitted Parts</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Parts">Listing</a>
			<a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=KULeuven">Sandbox</a>
		</div>
	</li>
	<li>
		<a>Modeling</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Model/Overview">Overview</a>
			<a href="https://2008.igem.org/Team:KULeuven/Model/KineticConstants">Kinetic Constants</a>
			<span>
				<a>Components</a>
				<div>
					<a href="https://2008.igem.org/Team:KULeuven/Model/Output">Output</a>
					<a href="https://2008.igem.org/Team:KULeuven/Model/Filter">Filter</a>
					<a href="https://2008.igem.org/Team:KULeuven/Model/Inverter">Invertimer</a>
					<a href="https://2008.igem.org/Team:KULeuven/Model/Reset">Reset</a>
					<a href="https://2008.igem.org/Team:KULeuven/Model/CellDeath">Cell Death</a>
					<a href="https://2008.igem.org/Team:KULeuven/Model/Memory">Memory</a>
				</div>
			</span>
			<a href="https://2008.igem.org/Team:KULeuven/Model/FullModel">Full Model</a>
                        <a href="https://2008.igem.org/Team:KULeuven/Model/Sensitivity">Sensitivity Analysis</a>
			<a href="https://2008.igem.org/Team:KULeuven/Model/MultiCell">Multi-cell Model</a>
			<a href="https://2008.igem.org/Team:KULeuven/Model/Diffusion">Diffusion</a>
		</div>
	</li>
	<li>
		<a>Data Analysis</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Data/Overview">Overview</a>
			<span>
				<a>New Parts</a>
				<div>
					<a href="https://2008.igem.org/Team:KULeuven/Data/GFP">GFP (LVA-tag)</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/T7">T7 (UmuD-tag)</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Antisense">Antisense LuxI</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/ccdB">Celldeath (ccdB)</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/HybridProm">Hybrid Promotor</a>
				</div>
			</span>
                        <span>
				<a>Components</a>
				<div>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Input">Input</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Output">Output</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Filter">Filter</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Inverter">Invertimer</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Reset">Reset</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/CellDeath">Cell Death</a>
					<a href="https://2008.igem.org/Team:KULeuven/Data/Memory">Memory</a>
				</div>
			</span>
			<a href="https://2008.igem.org/Team:KULeuven/Data/FullModel">Full Model</a>
		</div>
	</li>
        <li>
		<a>Software</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Software/MultiCell">Multi-cell Toolbox</a>
			<a href="https://2008.igem.org/Team:KULeuven/Software/Simbiology2LaTeX">Simbiology2LaTeX Toolbox</a>
		</div>
	</li>
	<li>
		<a>Notebook</a>
		<div>
			<a href="https://2008.igem.org/Team:KULeuven/Meeting_Calendar">Calendar</a>
                        <a href="https://2008.igem.org/Team:KULeuven/SummerHolidays">Summer Holidays</a>
			<span>
				<a>Reports</a>
				<div>
					<a href="https://2008.igem.org/Team:KULeuven/Meeting Reports">Daily</a>
					<a href="https://2008.igem.org/Team:KULeuven/Weekly Meetings">Weekly</a>
				</div>
			</span>
			<span>
				<a>Lab Data</a>
				<div>
					<a href="https://2008.igem.org/Team:KULeuven/Freezer">Freezer</a>
					<a href="https://2008.igem.org/Team:KULeuven/Primers">Primers</a>
					<a href="https://2008.igem.org/Team:KULeuven/Ligation">Ligation</a>
				</div>
			</span>
			<a href="https://2008.igem.org/Team:KULeuven/Tools">Tools</a>
			<a href="https://2008.igem.org/Team:KULeuven/Press">Press</a>
			<a href="https://2008.igem.org/Team:KULeuven/Guestbook">Guestbook</a>
                        
		</div>
	</li>
        
</ul>
</div>
</div>
</html>
Table of Oligos
Number Name Sequence Length Comments
1 T7 Fw, no tag catcatgaattcgcggccgcttctagatgaacacgattaacatcgc 46bp {{{Tm}}} Forward T7 RNApol primer, without UmuD tag
2 T7 Rev ctgcagcggccgctactagtattattacgcgaacgcgaagtccg 44bp {{{Tm}}} Reverse T7 RNApol primer
3 T7 Fw, UmuD tag, part 1 ccgctatttagcgatcttgttcagtgtggctttccttcaccgatgaacacgattaacatcgc 62bp {{{Tm}}} Forward T7 RNApol primer, with UmuD tag, part 1
4 T7 Tw, UmuD tag, part 2 catcatgaattcgcggccgcttctagatgttgtttatcaagcctgcggatctccgcgaaattgtgacttttccgctatttagcgatcttgttcag 95bp {{{Tm}}} Forward T7 RNApol primer, with UmuD tag, part 2, very expensive
5 GFP-LVA Fw catcatgaattcgcggccgcttctagatgcgtaaaggagaagaacttttcactgg 55bp {{{Tm}}} Forward GFP-LVA primer
6 GFP-LVA Rev ctgcagcggccgctactagtattattaagctactaaagcgtagttttcgtcgtttgcagcaggc 64bp {{{Tm}}} Reverse GFP-LVA primer
7 VF2 TGCCACCTGACGTCTAAGAA 20bp {{{Tm}}} Forward primer for sequence analysis
8 VR ATTACCGCCTTTGAGTGAGC 20bp {{{Tm}}} Reverse primer for sequence analysis