Team:NYMU-Taipei/Project/pH Sensor

From 2008.igem.org

(Difference between revisions)
Line 49: Line 49:
* [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
* [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
 +
 +
== Experiments ==
 +
 +
=== ''NhaA'' promoter under 0uM, 150uM, 300uM sodium and pH 3.0, 7.0, 8.5 ===
 +
 +
{|
 +
|
 +
[[Image:NYMU 20081025 pNhaA 0uM Na.png]]
 +
|-
 +
|
 +
[[Image:NYMU 20081025 pNhaA 150uM Na.png]]
 +
|-
 +
|
 +
[[Image:NYMU 20081025 pNhaA 300uM Na.png]]
 +
|-
 +
|}
 +
{{:Team:NYMU-Taipei/Footer}}
{{:Team:NYMU-Taipei/Footer}}

Revision as of 17:25, 29 October 2008

NYMU Banner-wider 965px.png


Contents

Motivation

  • When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
  • In this subsystem, we are going to create a pH sensor which senses high pH's.

Goal

  • The pH sensor can sense a high pH condition and start gene expression.

Circuit Design

Regulation of nhaA gene expression

  • [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=178537&blobtype=pdf Na1-Induced Transcription of nhaA, Which Encodes an Na1/H1 Antiporter in Escherichia coli, Is Positively Regulated by nhaR and Affected by hns] (N. DOVER etc.,1996)
  • [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)

NYMU IGEM08 NhaA regulation.png NYMU NhaA protein expression and activity regulated by pH.png

Structure of nhaA gene promoter

  • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)

NYMU Promoter elements of nhaA.png

  • 17,189 -17,488 in E.coli K12 genome from Ecocyc (300 bp upstream of nhaA gene)

00000000011111111112222222222344444444455555555556666666666777777777788888888889
12345678901234567890123456789012345678901234567890123456789012345678901234567890
ACGACAAGCTGGATTATTTTTGAAATATTGGCCTAACAAGCATCGCCGACTGACAACAAATTAATTATTACTTTTCCTAA
TTAATCCCTCAGGAATCCTCACCTTAAGCTATGATTATCTAGGCTTAGGGTCACTCGTGAGCGCTTACAGCCGTCAAAAA
CGCATCTCACCGCTGATGGCGCAAATTCTTCAATAGCTCGTAAAAAACGAATTATTCCTACACTATAATCTGATTTTAAC
GATGATTCGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCTGAAAGAGAAATAAAAA 
  • G is the start of NhaR binding site
  • TTTTAA is the first -35 of P1
  • ATGATT is the second -35 of P1
  • TAAAAT is the first -10 of P1
  • TAAAAA is the second -10 of P1; A in the TAAAAA is the first TSS of P1
  • AAGAGA is the S.D. (Shine-Dalgarno) sequence in RBS
  • There are 3 nhaA promoter sequences protected by NhaR from DNase I digestion
    • AATAGCTCGTAAAAAACGAATTATTCC
    • CACTATAATCTGATTTTAACGATG
    • CGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCT; T in TTCACCT is the second TSS of P1
  • The extracted DNA sequence should include the NhaR binding site
    • The NhaR binding site defined in (Nir Dover and Etana Padan et al.,2001) is 120 bp long
    • The PCR product derived from primers designed by Henry is 274 bp long

References

  • [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)
  • [http://www.pnas.org/cgi/content/abstract/90/4/1212 Histidine-226 is part of the pH sensor of NhaA, a Na+/H+ antiporter in Escherichia coli] (Y Gerchman etc., 1993)
  • [http://www.nature.com/nature/journal/v435/n7046/full/nature03692.html Structure of a Na+/H+ antiporter and insights into mechanism of action and regulation by pH] (Carola Hunte etc., 2005)
  • [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=178537&blobtype=pdf Na1-Induced Transcription of nhaA, Which Encodes an Na1/H1 Antiporter in Escherichia coli, Is Positively Regulated by nhaR and Affected by hns] (N. DOVER etc.,1996)
  • [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)
  • [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
  • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)

Experiments

NhaA promoter under 0uM, 150uM, 300uM sodium and pH 3.0, 7.0, 8.5

NYMU 20081025 pNhaA 0uM Na.png

NYMU 20081025 pNhaA 150uM Na.png

NYMU 20081025 pNhaA 300uM Na.png