Edinburgh/2 July 2008
From 2008.igem.org
(Difference between revisions)
Line 288: | Line 288: | ||
</script> | </script> | ||
</html> | </html> | ||
+ | |||
+ | <table> | ||
+ | <html> | ||
+ | <style type="text/css"> | ||
+ | table.calendar { margin: 0; padding: 2px; } | ||
+ | table.calendar td { margin: 0; padding: 1px; vertical-align: top; } | ||
+ | table.month .heading td { padding:1px; background-color: black; color: white; text-align:center; font-size:140%; font-weight:bold; } | ||
+ | table.month .dow td { color:#000000; text-align:center; font-size:100%; } | ||
+ | table.month td.today { background-color:#cd0000; } | ||
+ | table.month td { | ||
+ | border: none; | ||
+ | margin: 0; | ||
+ | padding: 0pt 0.5pt; | ||
+ | font-weight: bold; | ||
+ | font-size: 9pt; | ||
+ | text-align: right; | ||
+ | background-color: white; | ||
+ | } | ||
+ | #bodyContent table.month a { background:none; padding:0 } | ||
+ | .day-active { color:#cd0000 } | ||
+ | .day-empty { color:#000000 } | ||
+ | |||
+ | </style> | ||
+ | </html> | ||
+ | |||
+ | |||
+ | {|style="font color="#ffffff"; "background-color:"#cd0000"; cellpadding="0" cellspacing="4" border="4" bordercolor="#000"; border-spacing:0px; text-align:"center" width="250px" | ||
+ | </table> | ||
+ | |||
+ | {| align="left" | ||
+ | |- | ||
+ | |align="left" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=06}} | ||
+ | |- | ||
+ | |align="left" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=07}} | ||
+ | |- | ||
+ | |align="left" width="150pt"|{{#calendar: title=Edinburgh |year=2008 | month=08}} | ||
+ | |} | ||
+ | |||
:::: '''[[Edinburgh/1_July_2008|< Previous Entry]]''' | :::: '''[[Edinburgh/1_July_2008|< Previous Entry]]''' |
Revision as of 09:58, 21 August 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||
|
Week 3
Wednesday 2 July 08
- Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites:
- primer glgcm1f: tgttgaaaaacctgctaaccc
- primer glgcm1r: aattcgataattttatcgttctc
- primer glgcm2f: ctcattctgcaacattgattcc
- primer glgcm2r: ttcacgcgaacgcgcgag