Edinburgh/2 July 2008

From 2008.igem.org

(Difference between revisions)
Andhi (Talk | contribs)
(New page: <html> <head> <title>Edinburgh iGEM 2008</title> <script type="text/javascript"> //Drop Down Tabs Menu- Author: Dynamic Drive (http://www.dynamicdrive.com) //Created: May 16th, 07' var ta...)
Newer edit →

Revision as of 11:07, 20 August 2008

Edinburgh iGEM 2008

 

Week 3

Wednesday 2 July 08

  • Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites:

primer glgcm1f: tgttgaaaaacctgctaaccc
primer glgcm1r: aattcgataattttatcgttctc
primer glgcm2f: ctcattctgcaacattgattcc
primer glgcm2r: ttcacgcgaacgcgcgag