Team:Heidelberg/Notebook/Killing I/Notebook/week3

From 2008.igem.org

Revision as of 22:05, 25 October 2008

Back to the overview

Monday, 08/18/08

chloramphenicol resistance cassette

• Maxiprep of P1000, P1004, B0014, B0015
  • P1000 1672 ng/µl 1,92
  • P1004 1153 ng/µl 1,92
  • B0014 2040,4 ng/µl 1,92
  • B0015 1053,6 ng/µl 1,92

• Analytical digestions
  • lambda DNA with XbaI and XhoI

2µl DNA
5µl NEB2
5µl BSA
1µl XbaI
1µl XhoI
26µl water 

• • Analytical digestion of P1000

1µl DNA
2µl NEB3
2µl NcoI
15µl water

• • Analytical digestion of P1004

1µl DNA
2µl NEB4
1,5µl DraI
15,5µl water

• • Analytical digestion of B0014 / B0015

1µl DNA
2µl NEB4
2µl BSA
2,5µl SfcI
12,5µl water

• • Analytical digestion of cI "green", cI "black" and T9002

• Gel

1. • Lane 0: DNA ladder mix
   • Lane 1: lambda DNA
   • Lane 2: lambda DNA (XbaI, XhoI --> large frament ~ 40kb, small fragment ~ 9kb)
   • Lane 3: P1000
   • Lane 4: P1000 (NcoI-->1473,2374)
   • Lane 5: P1004
   • Lane 6: P1004 (DraI-->19,339,692,1067,1360)
   • Lane 7: cI green
   • Lane 8: cI green (NdeI - expected fragments?)
   • Lane 9: cI black
   • Lane 10: cI black (NdeI)
   • Lane 11: T9002
   • Lane 12: T9002 (NdeI - expected fragments?)

lamda phage

Infectiontest

• inoculation of 20ml medium with over night culture (MG1655)
• after 1h plaque added --> 37C for 2h + inoculation of ZMBH phage (100ql 10^-2 in 20ml MG1655)
• incubation at 42C for 2 more hours
• sterilefiltration + mix with growing bacteria (MG1655 and MG1655+cI)
• incubate in soft agar at 37C for 2h, than at 42C for another 4h (altogether 24 plates)
• phage DNA was also isolated from filtrate
• results:
  • same amount of plaques on plates with MG1655 as with MG1655+cI
  • nearly no plaques on plates with own phage --> very low phage concentration
  • --> cI does not work!!!!
• growing curve

• • the values are the average of all four cultures

Tuesday, 08/19/08

lambda phage

• Digestion of lambda DNA with XbaI and XhoI
  • very nice separation of the small fragment from the two large fragments (one band) picture of the gel was not saved but it looked very nice
  • cutting out of the small and large fragment --> gel purification kit
  • small fragment: 30,3 ng/µl; 1,86
  • large fragment1: 19,5 ng/µl; 2,11
  • large fragment2: 61,5ng/µl; 1,90

GFP

• inoculation of three overnight cultures from the two I20260 glycerol stocks

chloramphenicol resistance cassette

• Transformation of P1000, P1004 (both chloramphenicol resistances) and CI
  • no success

project planning

Guys, we received this email by another professor in the states. sounds good. we should get this helper plasmids in the end :)

I have sent pUB307, RSF1010, pED350, pED361, which are described in our two MGG papers. Also two clones I made of the oriT from RP1; pED369 and pED374. There are 10microl of each. The DNAs are old (1983!) and so I would transform and make fresh plasmid preps.

pED350 is oriT+ and Mob+, so it is efficiently mobilised by RPI or its derivative pUB307. pED361 is oriT+ only. It cannot be mobilised by pUB307 as it lacks mob functions. If RSF1010 is also in the cell pKD361 is very efficiently mobilised by pUB307.

pED369 and pED374 are two subclones I made of the RP1 oriT into pED825 (Amp resistant described in MGG papers). pED374 contains a single 690 bp HaeII fragment containing the RP1 oriT. PED369 contains the 690 bp oriT fragment plus additional HaeII fragments. I sent both just in case the pED374 DNA does not check out. These are efficiently mobilised by pUB307.

I would think cloning this 690 bp fragment into your lambda vector would be the simplest solution; its small and will mobilise in the presence of just pUB307.

Keith

Wednesday, 08/20/08

GFP

• Miniprep of reference promotor I20260
  • Concentrations:
    • Epi1 9,8 ng/ul; 2,52
    • Epi2 15,7 ng/ul; 2,28
    • Epi3 19,7 ng/ul; 1,93

• Digestion of I20260

10 µl DNA (from Epi3)
2ul SmlI
12µl NEB4
2ul BSA 10x
4 µl water

• Digestion of the XbaI-XhoI fragment with AgeI

18 µl DNA (from gel purification kit)
5 µl AgeI
5 µl NEB4
22 µl water

• Gel

• Lane 0: DNA ladder mix
• Lane 1: I20260 (SmlI-->251bp, 373bp, 843bp, 918bp, 1284bp)
• Lane 2: XbaI-XhoI fragment (AgeI-->1.7kb, 7.3kb)
• Lane 3: large lambda DNA fragments 3µl (15kb, 24.5kb)

• Results:
  • I20260 seems not to be correct, inoculate overnight cultures from the glycerol stocks again
  • digestion of the XbaI-XhoI fragment with AgeI did not work good, only the 7.3kb fragment can be seen, reasons: wrong buffer concentration, too much enzyme (glycerol) in the reaction
  • large lambda DNA fragment is looking good

lambda phage

• concentrations of lambda-DNA extractions
  • from Fermentas Phage - plaque 1: 7.5 ng/ul; 1.86
  • from Fermentas Phage - plaque 2: 61.5 ng/ul 1.90
  • from ZMBH phage 19,7 ng/ul 2,11

overview of the first phage cloning strategy

Used primer sequences:

oriT_RP4_fw (Tm=62°C):

CTCGTTTCTAGAACTAGTgacaggctcatgccggccgc

oriT_RP4_rv: (Tm=58°C)

TATTCGGGTACCgtcccctcagttcagtaatttcctgc

GFP_CmR_fw: (Tm=56°C)

CTCGTTGGTACCTCTAGAtttacagctagctcagtcctagg

GFP_CmR_rv: (Tm=55°C)

TATTCGACCGGTACTAGTtataaacgcagaaaggcccacc

GAM_fw: (Tm=55°C)

AGTGCTTTAGCGTTAACTTCCG

GAM_rv: (Tm=53°C)

GGTTTTACCGCATACCAATAACG

CmR_fw: (Tm=54°C)

gctaaaATGgagaaaaaaatcactgg

CmR_rv: (Tm=58°C)

AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC

Thursday, 08/21/08

lambda phae

• Preparative digestion of lambda-DNA from Fermentas

10µl DNA = 3 ug
2µl XhoI
2µl XbaI
5µl NEB 2
5µl BSA
33µl H20

• lambda DNA "2" and "ZMBH" from phage extraction kit

36 µl DNA
2 µl XhoI
2µl XbaI
5µl NEB 2
5 µl BSA

• • all digestions 3h, 400rpm, 37°

• Gel

• • lane 0: DNA ladder mix
  • lane 2: lambda DNA (fermentas) (XbaI, XhoI --> ~40 kb, ~9 kb)
  • lane 4: lambda DNA from extraction "2" (XbaI, XhoI --> ~40 kb, ~9 kb)
  • lane 6: lambda DNA from extraction "ZMBH phage" (XbaI, XhoI --> ~40 kb, ~9 kb)
  • lane 2, 4 and 6 overflowed
• cutting out of the XbaI-XhoI fragment from lane 2
  • the large fragment wasn't cutted out because the gel was exposed to UV light over 30 seconds
  • gel extraction kit
    • DNA eluted in 20µl

• Digestion of the XbaI-XhoI fragment with AgeI

20µl DNA (from gel purification kit)
2µl AgeI
5µl NEB4
23µl water

• • 16°C over night

• Preparative digestion of lambda-DNA from Fermentas

10µl DNA = 3 µg
2µl XhoI
2µl XbaI
5µl NEB 2
5µl BSA
33µl water

• • 16°C over night

GFP

• Miniprep from overnight cultures of I20260 glycerol stocks
  • eluted in 50 µl
  • Concentrations:
    • Miniprep 1: 19.8 ng/µl
    • Miniprep 2: 17.4 ng/µl
    • Miniprep 3: 19.0 ng/µl
    • Miniprep 4: 16.4 ng/µl

• Analytical digestion of the four I20260 Minipreps
  • 20µl DNA
  • 5µl NEB 4
  • 1.5µl DraI
  • 23.5µl water

• Gel

• • • lane 0: DNA ladder
    • lane 1: I20260 1
    • lane 2: I20260 1 (DraI-->19bp, 535bp, 886bp, 2229bp)
    • lane 3: I20260 2
    • lane 4: I20260 2 (DraI)
    • lane 5: I20260 3
    • lane 6: I20260 3 (DraI)
    • lane 7: I20260 4 (DraI)

• • Results
    • it seems that we have I20260, inoculation of an overnight culture from I2020 No. 3 for Maxiprep

• Transformation of I20260 (Kan) (from the promotor measurement kit sheet as well as from the registry) and J01101 (Amp)
  • eluted in 10µl water
  • transformed into TOP10 and MG1655 (each 4µl DNA)

cI

• ordered J01101 (cI) from the iGEM headquater, they will already send it today

Friday, 08/22/08

GFP

• Maxiprep of reference promotor I20260
  • concentrations: 200 ng/µl

lambda phage

• Gel: Digestions of lambda-DNA (fermentas), and the small XbaI-XhoI fragments

• • lane 1: DNA ladder mix
  • lane 3: lambda-DNA (XbaI, XhoI; ~ 40kb, ~ 9kb)
  • lane 5: small lambda-fragment assayI (AgeI, ~1,7kb, ~7,3kb)
  • lane 7: small lambda-fragment assayII (AgeI, ~1,7kb, ~7,3kb)

• Extraction of XbaI-XhoI fragments (evaluation of samples with nanodrop)
  • small fragment 1: 15,9 ng/µl; 2,41
  • small fragment 2: 6,6 ng/µl; 2,02
  • large fragment 1: 14,1 ng/µl; 2,75
  • large fragment 1: 10,8 ng/µl; 2,86
  • large fragment 1: 14,4 ng/µl; 1,99
  • large fragment 1: 16,8 ng/µl; 2,14

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Printable version
• Permanent link
• Privacy policy
• Disclaimers