"
Team:Rice University/Notebook/9 June 2008
From 2008.igem.org
(Difference between revisions)
(New page: =Monday 9 June= *Selim Sheikh: **Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector...) |
(→Monday 9 June) |
||
| Line 1: | Line 1: | ||
=Monday 9 June= | =Monday 9 June= | ||
*Selim Sheikh: | *Selim Sheikh: | ||
| - | **Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions | + | **Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions: |
***Primer Set 1: | ***Primer Set 1: | ||
****product of length 538 | ****product of length 538 | ||
Revision as of 19:42, 18 June 2008
Monday 9 June
- Selim Sheikh:
- Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions:
- Primer Set 1:
- product of length 538
- contains region of the molecule from 20481 to 21018
- Tm = 81.7 C TaOpt: 60.4 C GC: 56.3
- area of interest = 20833
- sense primer: GAGACGAATGCCAGGTCATCTGAAA
- length: 25 Tm = 60.3 C GC = 48.0
- antisense primer: AAATCTGGATCATTCCCGAGCGCTG
- length: 25 Tm = 64.9 C GC = 52.0
- Primer Set 2:
- product of length 309
- contains region of the molecule from 23341 to 23649
- Tm = 70.7 C TaOpt: 51.4 C GC: 31.7
- area of interest = 23539
- sense primer: ATCACATCGTCACCCATTGGATTGT
- length: 25 Tm = 60.1 C GC = 44.0
- antisense primer: CGATTTAGAAATGTATAGCGAGGCA
- length: 25 Tm = 55.9 C GC = 40.0
- Primer Set 1:
- Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions:
