Team:KULeuven/Primers
From 2008.igem.org
Result:
To have a dropdown for your own team copy over all of the content below. It might be needed to adjust a thing or two. Comments have been added throughout the code what must be changed.
Inspirational websites:
- [http://javascript-array.com/scripts/simple_drop_down_menu/ Most basic dropdown menu, with no submenu's]
- [http://jquery.com/ The javascript library used to add effects and optimise the dropdown]
- [http://www.tyssendesign.com.au/articles/css/centering-a-dropdown-menu/ How to center a ul list effectively]
The dropdown has been created and developed by the KULeuven team.
<html> <style type="text/css"> #content {z-index:4;} #ddwrapper * {z-index:8 !important;} div#ddwrapper { margin:0; padding:0; height:28px; width:945px; /* change to adjust imperfections in width */ } div#ddnav { margin:0 auto; /* needed to center the dropdown */ padding:0; top:5px; /* width: 965px */ visibility:hidden; /* dropdown is hidden until properly initalised by javascript */ } div#ddtoggle { margin:0; position:fixed; right:2px; top:15px; height:10px; width:10px; z-index:100; } #ddnav ul { display:table-row; /* works only for firefox, later adjusted by javascript for IE */ margin:0 auto; padding:0; } #ddnav ul li { display:table-cell; /* works only for firefox, later adjusted by javascript for IE */ list-style:none; margin:0; padding:0 !important; border-right:1px solid #FFF; /* creates illusion of spacing between tabs */ } #ddnav ul li:last-child{border-right:none;} #ddnav a{ display:block; margin:0; padding:4px 14px; /* play with dimensions for size of tabs */ background-color:#075A90; /* background color for tabs */ color:#FFF !important; /* font color for text in tabs */ text-align:center; /* aligning for text in tabs */ text-decoration:none !important; font:bold 10pt Trebuchet MS; /* font properties for text in tabs */ outline:0; } #ddnav ul li a:hover {background-color:#99CCFF;}/* background color for tabs on mouseover */ #ddnav li a:active {outline:none;} /* remove standard dotted border for links when clicked (IE) */ #ddnav li a:focus {-moz-outline-style:none;} /* remove standard dotted border for links when clicked (FF) */ #ddnav div { display:none; position:absolute; width:9em; background-color:#000; /* bug solution, do not change ! */ border:1px solid #5970B2; /* border color for dropdown menus */ opacity:0.9; /* transparancy of the dropdown menus (FF) */ filter:alpha(opacity=90); /* transparancy of the dropdown menus (IE) */ } #ddnav div a { display:block; padding:5px 10px; /* play with dimensions of block element in dropdown menus */ position:relative; font:normal 8pt arial; /* font properties for text in dropdown menus */ text-align:left; /* aligning of text in dropdown menus */ cursor:pointer; } #ddnav div a:hover, #ddnav span a:hover {color:#000 !important;} /* text color on mouseover */ #ddnav span div { position:relative; border:none; border-bottom:2px groove #5970B2; /* separator for submenus, groove does not work in FF */ opacity:1.0; /* avoid stacking transparancy for submenus (FF) */ filter:alpha(opacity=100); /* avoid stacking transparancy for submenus (IE) */ } /* may want to upload the following pictures to a new location */ .expand {background: url('https://static.igem.org/mediawiki/2008/e/ef/Icon-expand.png') no-repeat 95% 50%;} .collapse {background: url('https://static.igem.org/mediawiki/2008/c/cd/Icon-collapse.png') no-repeat 95% 50%;} .docked {background: #99ccff url("https://static.igem.org/mediawiki/2008/6/62/Ddnavundock.png") no-repeat 50% 50%;} .undocked {background: #99ccff url("https://static.igem.org/mediawiki/2008/e/e4/Ddnavdock.png") no-repeat 50% 50%;} </style> <!-- IMPORTANT: save following script under a personalized webspace or download the library at www.jquery.com --> <script type="text/javascript" src="http://student.kuleuven.be/~s0173901/wiki/js/jquery.js"></script> <script type="text/javascript"> function ddnav() { $('#ddnav ul li').hover( function () { $(this).find('div:first').css('display','block');}, function () { $(this).find('div:first').css('display','none');} ); } function ddnavsub() { $('#ddnav span > a').toggle( function () { $(this).removeClass("#ddnav expand").addClass("#ddnav collapse"); $(this).parent().find('div:first').slideDown('fast'); $(this).hover( function (){$(this).css('background-color','#99AAFF');}, function (){$(this).css('background-color','#99AAFF');});}, function () { $(this).removeClass("#ddnav collapse").addClass("#ddnav expand"); $(this).parent().find('div:first').css('display','none'); $(this).hover( function (){$(this).css('background-color','#99CCFF');}, function (){$(this).css('background-color','#075A90');});} ).addClass("#ddnav expand"); } /* If you wish to omit the docking feature, remove following function ddtoggle() */ function ddtoggle() { $('#ddtoggle').toggle( function () { $(this).removeClass('undocked').addClass('docked'); $('#ddnav').css('position','fixed');}, function () { $(this).removeClass('docked').addClass('undocked'); $('#ddnav').css('position','static');} ); } function ddalign() { var _windowWidth = $(window).width(); var _leftOffset = (_windowWidth - 965)/2; $('div#ddnav').css('left',_leftOffset); } function ddmsie() { $('#ddnav a').hover( function () {$(this).css('background-color','#99ccff');}, function () {$(this).css('background-color','#075a90');} ); /* toggle doesn't work yet */ $('#ddtoggle').css('display','none'); $('#ddnav ul').css('display','inline-block'); $('#ddnav ul li').css('display','inline'); $('#ddnav ul li').css('position','relative'); $('#ddnav ul li>a').css('display','inline-block'); $('#ddnav ul li>a').css('margin-right','-4px'); $('#ddnav div').css('left','0'); $('#ddnav div').css('top','100%'); $('#ddnav span div').css('top','0'); } function ddmozilla() { ddtoggle(); $(window).bind('resize', function() {ddalign();}); } $(function () { ddnav(); ddnavsub(); if(jQuery.browser.msie) ddmsie(); if(jQuery.browser.mozilla) ddmozilla(); $('#ddnav').css('visibility','visible'); }); </script> <!-- If you wish to omit the docking feature omit following line (div with id ddtoggle) --> <div id="ddtoggle" class="undocked"></div> <div id="ddwrapper"> <!-- Here the actual links are defined, simply replace with your own links in the appropriate sections --> <div id="ddnav" align="center"> <ul> <li> <a href="https://2008.igem.org/Team:KULeuven">Home</a> </li> <li> <a>The Team</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Team/LabsandGroups">Research Labs and Groups</a> <a href="https://2008.igem.org/Team:KULeuven/Team/Students">Students</a> <a href="https://2008.igem.org/Team:KULeuven/Team/Instructors">Instructors</a> <a href="https://2008.igem.org/Team:KULeuven/Team/Advisors">Advisors</a> <a href="https://2008.igem.org/Team:KULeuven/Team/Pictures">Pictures</a> </div> </li> <li> <a>The Project</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Project">Summary</a> <span> <a>Components</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Project/Input">Input</a> <a href="https://2008.igem.org/Team:KULeuven/Project/Output">Output</a> <a href="https://2008.igem.org/Team:KULeuven/Project/Filter">Filter</a> <a href="https://2008.igem.org/Team:KULeuven/Project/Inverter">Invertimer</a> <a href="https://2008.igem.org/Team:KULeuven/Project/Reset">Reset</a> <a href="https://2008.igem.org/Team:KULeuven/Project/CellDeath">Cell Death</a> <a href="https://2008.igem.org/Team:KULeuven/Project/Memory">Memory</a> </div> </span> <a href="https://2008.igem.org/Team:KULeuven/Evaluation">End Evaluation</a> <a href="https://2008.igem.org/Team:KULeuven/Literature">Literature</a> <a href="https://2008.igem.org/Team:KULeuven/Brainstorm">Brainstorm</a> </div> </li> <li> <a>Ethics</a> <div> </div> </li> <li> <a>Submitted Parts</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Parts">Listing</a> <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=KULeuven">Sandbox</a> </div> </li> <li> <a>Modeling</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Model/Overview">Overview</a> <a href="https://2008.igem.org/Team:KULeuven/Model/KineticConstants">Kinetic Constants</a> <span> <a>Components</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Model/Output">Output</a> <a href="https://2008.igem.org/Team:KULeuven/Model/Filter">Filter</a> <a href="https://2008.igem.org/Team:KULeuven/Model/Inverter">Invertimer</a> <a href="https://2008.igem.org/Team:KULeuven/Model/Reset">Reset</a> <a href="https://2008.igem.org/Team:KULeuven/Model/CellDeath">Cell Death</a> <a href="https://2008.igem.org/Team:KULeuven/Model/Memory">Memory</a> </div> </span> <a href="https://2008.igem.org/Team:KULeuven/Model/FullModel">Full Model</a> <a href="https://2008.igem.org/Team:KULeuven/Model/Sensitivity">Sensitivity Analysis</a> <a href="https://2008.igem.org/Team:KULeuven/Model/MultiCell">Multi-cell Model</a> <a href="https://2008.igem.org/Team:KULeuven/Model/Diffusion">Diffusion</a> </div> </li> <li> <a>Data Analysis</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Data/Overview">Overview</a> <span> <a>New Parts</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Data/GFP">GFP (LVA-tag)</a> <a href="https://2008.igem.org/Team:KULeuven/Data/T7">T7 (UmuD-tag)</a> <a href="https://2008.igem.org/Team:KULeuven/Data/Antisense">Antisense LuxI</a> <a href="https://2008.igem.org/Team:KULeuven/Data/ccdB">Celldeath (ccdB)</a> <a href="https://2008.igem.org/Team:KULeuven/Data/HybridProm">Hybrid Promotor</a> </div> </span> <span> <a>Components</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Data/Input">Input</a> <a href="https://2008.igem.org/Team:KULeuven/Data/Output">Output</a> <a href="https://2008.igem.org/Team:KULeuven/Data/Filter">Filter</a> <a href="https://2008.igem.org/Team:KULeuven/Data/Inverter">Invertimer</a> <a href="https://2008.igem.org/Team:KULeuven/Data/Reset">Reset</a> <a href="https://2008.igem.org/Team:KULeuven/Data/CellDeath">Cell Death</a> <a href="https://2008.igem.org/Team:KULeuven/Data/Memory">Memory</a> </div> </span> <a href="https://2008.igem.org/Team:KULeuven/Data/FullModel">Full Model</a> </div> </li> <li> <a>Software</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Software/MultiCell">Multi-cell Toolbox</a> <a href="https://2008.igem.org/Team:KULeuven/Software/Simbiology2LaTeX">Simbiology2LaTeX Toolbox</a> </div> </li> <li> <a>Notebook</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Meeting_Calendar">Calendar</a> <a href="https://2008.igem.org/Team:KULeuven/SummerHolidays">Summer Holidays</a> <span> <a>Reports</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Meeting Reports">Daily</a> <a href="https://2008.igem.org/Team:KULeuven/Weekly Meetings">Weekly</a> </div> </span> <span> <a>Lab Data</a> <div> <a href="https://2008.igem.org/Team:KULeuven/Freezer">Freezer</a> <a href="https://2008.igem.org/Team:KULeuven/Primers">Primers</a> <a href="https://2008.igem.org/Team:KULeuven/Ligation">Ligation</a> </div> </span> <a href="https://2008.igem.org/Team:KULeuven/Tools">Tools</a> <a href="https://2008.igem.org/Team:KULeuven/Press">Press</a> <a href="https://2008.igem.org/Team:KULeuven/Guestbook">Guestbook</a> </div> </li> </ul> </div> </div> </html>
Table of Oligos | |||||
---|---|---|---|---|---|
Number | Name | Sequence | Length | Comments | |
1 | T7 Fw, no tag | catcatgaattcgcggccgcttctagatgaacacgattaacatcgc | 46bp | {{{Tm}}} | Forward T7 RNApol primer, without UmuD tag |
2 | T7 Rev | ctgcagcggccgctactagtattattacgcgaacgcgaagtccg | 44bp | {{{Tm}}} | Reverse T7 RNApol primer |
3 | T7 Fw, UmuD tag, part 1 | ccgctatttagcgatcttgttcagtgtggctttccttcaccgatgaacacgattaacatcgc | 62bp | {{{Tm}}} | Forward T7 RNApol primer, with UmuD tag, part 1 |
4 | T7 Tw, UmuD tag, part 2 | catcatgaattcgcggccgcttctagatgttgtttatcaagcctgcggatctccgcgaaattgtgacttttccgctatttagcgatcttgttcag | 95bp | {{{Tm}}} | Forward T7 RNApol primer, with UmuD tag, part 2, very expensive |
5 | GFP-LVA Fw | catcatgaattcgcggccgcttctagatgcgtaaaggagaagaacttttcactgg | 55bp | {{{Tm}}} | Forward GFP-LVA primer |
6 | GFP-LVA Rev | ctgcagcggccgctactagtattattaagctactaaagcgtagttttcgtcgtttgcagcaggc | 64bp | {{{Tm}}} | Reverse GFP-LVA primer |
7 | VF2 | TGCCACCTGACGTCTAAGAA | 20bp | {{{Tm}}} | Forward primer for sequence analysis |
8 | VR | ATTACCGCCTTTGAGTGAGC | 20bp | {{{Tm}}} | Reverse primer for sequence analysis |