Edinburgh/2 July 2008
From 2008.igem.org
Week 3
Wednesday 2 July 08
- Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites:
- primer glgcm1f: tgttgaaaaacctgctaaccc
- primer glgcm1r: aattcgataattttatcgttctc
- primer glgcm2f: ctcattctgcaacattgattcc
- primer glgcm2r: ttcacgcgaacgcgcgag