Team:Hawaii/Construction of Broad-Host-Range Expression Vector

From 2008.igem.org

Revision as of 20:12, 4 August 2008 by MargaretRuzicka (Talk | contribs)
Projects Events Resources
Sponsors Experiments Milestones Protocols
Notebook (t) Meetings (t)

Contents

Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts

This expression vector will pull parts from the RSF1010 derived broad-host-range plasmid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the original DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.

The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into E. coli then conjugatively transferred to SynechocystisPCC6803, followed by the final test of cloning in genes and testing their expression in both E. coli and SynechocystisPCC6803.

Design

Methods

  • Design Primers
  • Design overlapping oligonucleotides
  • Selection of additional BioBrick parts
  • Lay-out of the new vector

Results

pRL1383a Genes w/ BioBrick Ends

name primer Tm Reviewed By Notes
aadA_fp._sb.1 cctTTCTAGatgagggaagcggtgatcg 59.4/65.7 C NW isolates aadA from ATG to TAA-TAA
aadA_rp._sb.1 aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg 55.4/74.5 NW isolates aadA from ATG to TAA-TAA
OmegaInterposon_fo._sb.1 cctTTCTAGAGggtgattgattgagcaagc 54.5/65 NW mixture of 4 products, 2/4 correct
OmegaInterposon_ro._sb.1 aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc 54.5/75.5 NW mixture of 4 products, 2/4 correct
pRL1383aOriV_fb._sb.1 cctTTCTAGAGgaacccctgcaataactgtc 56.3/65.9 NW
pRL1383aOriV_rb._sb.1 aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac 58/76.2 NW
pRL1383aRep_fp._sp.1 cctTTCTAGatgaagaacgacaggactttgc 58.9/64.9 NW Begins with RepB
pRL1383aRep_rb._sb.1 aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca 62.2/78.5 NW Ends RepC terminator.8/2:the terminator is missing the last C.
p1lytic_fb._sb.1 atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac NW E-N-X(front ligation);inducible high-copy-#, incl. Plac;from pSB2K3
p1lytic_rp._sb.1 cTACTAGTATTAttaccctctgaatcctgccg NW S(front ligation), ends w/(TAATAA);induced high-copy-#;from pSB2K3


RP4 Origin of Transfer Sequences for Oligonucleotide Extension

name oligonucleotide set Reviewed by Notes
oriT1_ob._na.1 ctagaggaataagggacagtgaagaaggaacacccgctcg NW complement oriT4
oriT2_ob._na.1 cgggtgggcctacttcacctatcctgcccggctgacgccg NW complement of oriT5
oriT3_ob._na.1 ttggatacaccaaggaaagtctacatactagtagcggccgctgca NW complement of oriT6
oriT4_ob._na.1 GCGGCCGCTACTAGTAtgtagactttccttggtg NW
oriT5_ob._na.1 tatccaacggcgtcagccgggcaggataggtgaagtaggcc NW
oriT6_ob._na.1 cacccgcgagcgggtgttccttcttcactgtcccttattcCT NW

BioBricks Extracted from Registry

name Function Combined with?
[http://partsregistry.org/Part:pSB1A7 pSB1A7] high copy BioBrick vector, AmpR, insulated Storage for oriV, oriT
[http://partsregistry.org/Part:BBa_I51020 BBa_I51020] BioBrick Base Vector final assembly of all parts
[http://partsregistry.org/Part:BBa_I14032 BBa_I14032] lac promoter rep region, aadA region
[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] Double terminator aadA region, P1 lytic region
[http://partsregistry.org/Part:BBa_J23012 BBa_J23012] aadA BioBrick combine with lac promoter and double terminator

Discussion

Discussion

  • What was learned and how to do future experiments differently.


[http://manoa.hawaii.edu/ Sponsor_UHM.gif][http://manoa.hawaii.edu/ovcrge/ Sponsor_OVCRGE.gif][http://www.ctahr.hawaii.edu Sponsor_CTAHR.gif]