From 2008.igem.org

Revision as of 13:57, 15 August 2008 by Andhi (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Edinburgh iGem 2008

Overview Step1 Step2

For more information, please see our internal wiki.

Lab Notebook

Week 1

Tuesday 17 June 08

Prepared competent JM109 cells using TSS method. 25 tubes of 0.2 ml were prepared, labelled 'iGEM 17-6-8 Jnn' where nn is a number from 01 to 25. These are in the pink box in Garry's -80°C freezer.

Thursday 19 June 08

Eluted DNA for BioBrick E0240 (GFP) from square 1001, well 4B and used this to transform half of tube J25; other half was transformed with 1.5μl of J33207 (Edinbrick1) as a control to test the competence of the cells. Plated 100 microlitres of each to LA+amb+BW. Incubate at 37°C overnight.

Plate 1: JM109 transformation with E0240 eluted DNA.
Plate 2: JM109 transformation with J33207 plasmid DNA (control).

Friday 20 June 08

Result of transformation: the positive control was highly successful, with hundreds of colonies, but no colonies were present on the plate transformed with the BioBrick DNA indicating some problem with the DNA elution. Need to check that we got the method right.
Ordered primers for dxs, appY and glgC. There are no forbidden restriction sites in the first two, so primers with full prefix and partial suffix were ordered to clone as EcoRI-SpeI fragments, but glgC has two EcoRI sites which will have to be mutated out. We therefore had a choice of cloning it initially as a XbaI-PstI fragment, or attempting the BABEL system, and decided to try BABEL first. If it proves too unreliable, we will need to order new primers to clone it the old-fashioned way.

Primer dxsf1: gat gaattc gcggccgc t tctaga tg agt ttt gat att gcc
Primer dxsr1: gc t actagt a tt a tta tgc cag cca ggc ctt g
Primer appyf1: gat gaattc gcggccgc t tctaga tg gat tat gtt tgc tcc
Primer appyr1: gct actagt a tta tt a gtc aat tgt ttt gtt tat tcc
Primer glgcf1: atg gtt agt tta gag aag aac gat c
Primer glgcr1: tta tta tcg ctc ctg ttt atg ccc taa c

Week 2

Tuesday 24 June

Sarah S wants to revive one of the BioBricks from the Registry (pBad+gfp), so we'll see whether she can get it to work.

Wednesday 25 June

Primers arrived. Made up 500μM stock solutions in EB and 10μM working solutions (f and r together) in water. Performed PCR with Kod, annealing at 55°C and extending for 38 seconds (expected sizes are: dxs 1862 + prefix and suffix; appY 749 + prefix and suffix; glgC 1295 with no prefix or suffix (except the extra TAA). Result: all looked good, nice pure bands.

Gel 1: markers, empty lane, dxs, appY, glgC, appY (repeat), glgC (repeat), markers.

Thursday 26 June 08

Purified DNA from PCR reactions. Used 20 microlitres of glass beads and eluted to 40 microlitres of TE.

Sample P1: dxs PCR product
Sample P2: appY PCR product
Sample P3: glgC PCR product

Set up digests to clone appY and dxs into Edinbrick1. Digests with 32μl water, 5μl buffer E, 4μl Edinbrick1 DNA, 4μl purified PCR product, 2.5μl SpeI, 2.5μl EcoRI. Incubated at 37°C. Purified. Set up ligations:

Ligation L1: dsx + Edinbrick1, EcoRI/SpeI
Ligation L2: appY + Edinbrick1, EcoRI/SpeI
Ligation L3: glgC (5μl) \+linear Babel1 (16-2-8, 2μl) with PNK
Ligation L4: glgC (5μl) \+linear Babel2 (18-2-8, 2μl) with PNK
Incubate ligations at 16 C overnight.

Friday 27 June 08

Ordered Cellulomonas fimi ATCC 484 (NCIB 8980, DSM 20113) from DSMZ.
Transformations of the iGEM competent JM109 cells with ligations L1 to L4. In each case, 100μl of cells were transformed with 5μl of ligation, and the remaining 5μl of each ligation was frozen so that it could be analysed if the transformations fail. Fresh Blue-White ampicillin plates were prepared.

Plate 3: Ligation L1, 100μl
Plate 4: Ligation L2, 100μl
Plate 5: Ligation L3, 100μl
Plate 6: Ligation L4, 100μl
Plate 7: Ligation L1, 900μl
Plate 8: Ligation L2, 900μl
Plate 9: Ligation L3, 900μl
Plate 10: Ligation L4, 900μl

Saturday 28 June 08

Result of transformations:

Plate 3: 1 white; Plate 7: 5 white, 13 blue.
Plate 4: no growth; Plate 8: no growth.
Plate 5: 1 white; Plate 9: 3 white, 20 blue, possible signs of phage.
Plate 6: maybe one tiny white; Plate 10: 7 white, 9 blue.
The white colonies were transferred to fresh plates of the same medium:
Plate 11: possible pSB1A2+dxs transformants.
Plate 12: possible Babel1+glgC transformants.
Plate 13: possible Babel2+glgC transformants.
The new plates were incubated at 37°C. The old plates were left at room temperature to see if any further colonies would appear.

Sunday 29 June 08

Streaks on plate 12 show strong signs of phage infection and are unusable apart from the single white one from plate 5. At least one of the streaks on plate 13 also has a couple of plaques, but plate 11 looks fine. This suggests that phage may have come from the Babel DNA stock (or the PNK, which seems unlikely). Set up overnight cultures (2.5ml LB in 20ml bijoux) for minipreps. Numbers 1 to 6 are pSB1A2+dxs from plate 11, all white, number 7 is from plate 12 (the white clone from plate 5), and 8 to 12 are from plate 13, white or pale blue. Incubated at 37°C with shaking.
Also note: a couple more colonies turned up on plates 5 and 6. The one on 6 looks like an escape, but the one on 5 looks OK. Subbed them both to a fresh plate (Plate 14). Previous plates, apart from plates 4 and 8 which had no growth, were transferred to the cold storage room.

Week 3

Monday 30 June 08

Plasmid DNA minipreps:

M1 to M6: pSB1A2+dxs white colonies
M7: Babel1+glgC white colony
M8 to M12: Babel2+glgC white and pale blue colonies
Minipreps M1 to M6 were digested with EcoRI and PstI (Gel 2). The expected pattern is pSB1A2 vector band at 2.04kb (2079 bp less prefix and suffix) and dxs insert band around 1.9kb. M1 showed bands around 1.1kb and 2.1kb. M5 showed no DNA. The other four showed a vector-like band around 2kb and a fainter, fuzzier band around 3kb, possibly a 'ghost' band. Thus none of the clones show the expected pattern of bands (although it is conceivable, since the vector and insert bands are so close in size, that they may be lying on top of each other; dxs has an internal EcoRV site at +504 and two HindIII sites at +606 and +1230, whereas pSB1A2 lacks such sites so this could be used to check). In conjunction with the total lack of growth on the appY plates, this suggests that something went wrong in the cloning procedure. The next step is to run the remaining ligation material on a gel and see what it looks like.

Tuesday 1 July 2008

Gel 3: minipreps M2, M3, M4 and M6 (pSB1A2+dxs clones) digested with EcoRI alone; lanes 5 and 6, 2.5μl of ligations L1 and L2. Result: all 4 minipreps now give a 4.2kb band (plus the same 3.2kb 'ghost' band as before) consistent with pSB1A2 carrying a 2kb insert. Would be nice to confirm identity using HindIII (2 internal sites). Both ligations show clear signs of insert and vector bands (oddly, the dxs insert band overlaps the pSB1A2 vector band whereas the appY insert band overlaps the lacZ insert excised from Edinbrick1). However, no ligated bands are visible. Thus the DNA purification is fine; if there was a a problem, it is with the ligase or ligase buffer.
Gel 4: Minipreps M7 to M12 (supposed to be glgC in Babel vectors) digested with EcoRI and PstI to excise the inserts. M10 and M11 have a single 3kb band consistent with vector, but no insert band at 1.2kb. M7, M8, M9 and M12 all show a single band at about 2.4kb which is not consistent with Babel vectors if properly digested. Unless the digests totally failed, none of these plasmids would seem to contain glgC.

BUT WAIT: Turns out gel 4 has undigested plasmid DNA rather than the EcoRI/PstI digests. These were run on Gel 5. Since glgC is about 1295bp with internal EcoRI sites at +570 and +1067, we would expect to see a vector band at 3kb and the insert cut into bands of around 570bp, 567bp and 228bp. This is precisely what we see in the case of M10 and M11. We can therefore conclude that M10 and M11 both represent the Babel2+glgC BioBrick. This is not sufficient to determine the orientation, but a single EcoRI digest of these two clones should be sufficient to establish that. Even if both are in the reverse orientation, they can still be used as templates for the three mutagenesis step which will be required to produce the final BioBrick.
Also attempted HindIII digests of M2, M3, M4 and M6 to confirm that the insert is really dxs, despite knowing that the HindIII stock expired in 2002. Results are shown on Gel 6 lanes 1 to 4. In all cases a 0.6kb band was excised, consistent with dxs insert. It therefore seems likely that M2, M3, M4 and M6 all represent pSB1A2+dxs coding sequence BioBrick.
Also did fusion PCR for the BABEL1+glgC and BABEL2+glgC constructs, using 1μl of L3 and L4 as templates (P4 and P5). Kod was used, with primers stdvectf1 and glgCr1, annealing at 65°C and extending for 110 seconds. Results are shown on Gel 6 lanes 5 and 6. P4 (BABEL1) has a strong band the right size and would probably work if self-ligated, but P5 (BABEL2) shows strong bands at 2 and 3 kb, as CK is also seeing. I suspect that primer stdvectf1 does not work well with BABEL2 - possibly mis-anneals to the other end of the vector. In any event, we can delay the decision as to whether or not to carry on with these until we know the results from M10 and M11.

Wednesday 2 July 2008

Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites:

primer glgcm1f: tgttgaaaaacctgctaaccc
primer glgcm1r: aattcgataattttatcgttctc
primer glgcm2f: ctcattctgcaacattgattcc
primer glgcm2r: ttcacgcgaacgcgcgag

Thursday 3 July 2008

Clones M2, M10 and M11 were submitted for sequencing using primers pSB1A2f1 and pSB1A2r1 (for M2) and pTG262f1 and pTG262r1 (for M10 and M11). We should get the results on Monday.
Ordered primers to make carotenoid biosynthesis BioBricks:

primer crtIf2: gat gaattc gcggccgc t tctag atg aaa cca act acg gta att g
22 matches, 8 GC = 32 C, 14 AT = 28 C, total 60°C, total length = 45
83.2°C, moderate, no
primer crtIr2: gct actagt a tta tt a tat cag atc ctc cag cat c
20 matches, 9 GC = 36, 11 AT = 22, total 58°C, length = 35
66.1°C, weak, no
primer crtBf2: gat gaattc gcggccgc t tctag atg aat aat ccg tcg tta ctc
21 matches, 8 GC = 32, 13 AT = 26, total 58°C. length = 44
82.9°C, moderate, no
primer crtYf2: gat gaattc gcggccgc t tctag atg caa ccg cat tat gat ctg
21 matches, 9 GC = 36,12 AT = 24, total 60°C, length = 44
86.4°C, very strong, no
Note that we already have a compliant crtE BioBrick (I hope), and the reverse primers crtBr2 and crtYr2 should be fine (see iGEM2007 lab book, page 90).

Retransformed JM109 with the remainder of the appY ligation (I re-ligated it, and also heat-treated it before the transformation, since Tom Knight reports that this can increase transformation efficiency). Plated this to Plates 15 and 16.

Friday 4 July 2008

Repeat appY transformation has failed: no colonies on plates 15 and 16. It seems unlikely that there is a major problem with the competent cells since other transformations have worked. Other than this, the only way to get no colonies (not even recircularized vector) is if something went seriously wrong in the original digest.
Mutagenic primers for glgC arrived. Prepared 500μM stock solutions and 10μM working solutions. Tried PCR with both primer pairs using M11 (0.5μl) as template, just to check that the primers are OK. Annealing was at 57°C (lowest melting temperature of a primer) and extension for 110 seconds using Kod (PCR reactions P6 and P7). Products (5μl) were run on Gel 8. P6 (M1) shows a single rather faint band at 4.2kb; P7 (M2) shows multiple bands, with the 4.2kb band strongest. Probably both pairs are fine for MABEL. Now we just need to wait for the sequencing results on Monday.
Also ran the other 5μl left from the religated L2 on gel 8. No DNA was visible. Did another digest (30μl total volume with 2μl each P2 and Edinbrick1, using Buffer E with EcoRI and SpeI, digesting at 37°C for about 5 hours, mainly because I forgot about it). Purified and ligated: Ligation L5.

Saturday 5 July 2008

Streaked Pantoea ananatis DSM 30080 from cryogenic stock to LA (Plate 17) and incubated at 30°C so that we will have a fresh stock of cells to make the crt BioBricks. Transformed competent cells tube J21 with ligation L5 (pSB1A2+appY)(Plates 18 and 19).

Sunday 6 July 2008

Result of appY transformation: one white colony (subcultured to plate 20). Several more possible small white ones right at the edge: plate left overnight to grow a bit more.

Week 4

Monday 7 July 2008

Several more white colonies have grown on plate 19, but quite small and close together. Tried to sub these to Plate 21.
Nimisha and the team did two maxipreps - X1 (J33201), and X2 (the dxs clone of miniprep M2). X2 digested with HindIII (single restriction digest).
Purified the mutagenic PCR reactions P6 and P7, and set up self ligations (L6 and L7).
Sequence results for glgC clones M10 and M11 show that both are in reverse orientation. The result for the dxs clones M2 looks OK at first glance, but can't see restriction sites since sequencing primers pSB1A2insf1 and pSB1A2insr1 were used rather than pSB1A2f2 and pSB1A2r2.

Tuesday 8 July 2008

New primers for crt BioBricks arrived. Performed PCR with Kod using primer pairs crtBf2 (new) + crtBr2 (old)(P8), crtIf2 + crtIr2 (both new) (P9), and crtYf2 (new) + crtYr2 (old)(P10). The template for P8 and P10 was a suspension of Pantoea ananatis cells from plate 17; for P9, Douglas's maxiprep DNA from 19 Feb (with the PstI sites mutated out) was used. In all cases annealing was at 55 C and extension for 30 seconds. Gel 9 showed that P8 and P9 had worked, with pure products of the expected size seen, but no product was seen for P10.
glgC mutagenesis: Transformed competent cells with ligation products L6 and L7; plated cells on Plates 22 and 23 (L6) and Plates 24 and 25 (L7).
dxs: Ran gel (Gel 9) to check size of X1 (J33201) and X2 (pSB1A2+dxs) HindIII restriction digest. The digest looked fine.

Wednesday 9 July 2008

Results of L6 and L7 transformations: no colonies for L6, but 9 colonies were obtained from L7. These were subcultured to plates 26 and 27. By the end of the day, these had grown sufficiently for 6 overnight cultures to be set up for minipreps tomorrow. In theory, some or all of these should be glgC with EcoRI site 2 mutated out.
Minipreps M13 to M18 of possible pSB1A2+appY' transformants. Digests with EcoRI/PstI were run on Gel 10. All but M13 looked OK (insert band on M14 was so faint as to be ambiguous, but M15 to M18 all look good).
Digests and ligation L8 for addition of a synthetic ribosome binding site M2 (which has now been entered into the Registry as BBa_K118000).

Thursday 10 July 2008

Subitted M15 (possible pSB1A2+appY) for sequencing with primers pSB1A2insf2 and pSB1A2insr2.
Minipreps M19 to M24 of possible glgC mutants with EcoRI site 2 removed. EcoRI digests were run on Gel 11. The insert bands are a bit fuzzy, but it looks as though M19, M21 and M22 may have lost the site, and M20, M23 and M24 may still have it.
PCR P11 using ligation L8 as template to generate a fusion product of rbs+dxs. Run on Gel 11, last lane. No product visible.
Digested P8 and P9 (crtB and crtI-mut PCR products) with EcoRI/SpeI together with Edinbrick1, purified and ligated (ligations L9 and L10) at 16°C overnight.

Friday 11 July 2008

Submitted M19, M21 and M22 for sequencing using primer pTG262f1, to check for clean removal of the EcoRI site.
Revived Cellulomonas fimi in NB and plated to NA and NA+glucose. Plates 28 and 29 incubated at 30°C.
ZY and XH repeated rbs+dxs ligation (L11).
Transformation of JM109 with L9 (pSB1A2+crtB )and L10 (pSB1A2+crtI-mut). Plates 30 to 33.
possible rbs+dxs clones from un-numbered plates were streaked to plate 34.

Saturday 12 July 2008

Result of transformation: crtB 100μl, 22 white and 10 blue; 900μl, too numerous to count, about two thirds white; a few blue showed signs of phage-like lysis. For crtI mutant, 100μl, 4 white and 2 blue; 900μl, 143 white and 25 blue. White crtB colonies were patched to Plate 35, crtI to Plate 36.
Set up overnight cultures of possible rbs+dxs clones from plate 34 for minipreps.

Sunday 13 July 2008

Signs of growth on Cellulomonas plates 28 and 29.
Minipreps M25 to M30 of possible rbs+dxs clones from plate 34.
PCR P12 to obtain rbs+dxs fusion product in case minipreps didn't work. Template was ligation L11, and primers were rbs2clonf1 and pSB1A2insr1. Annealing was 58°C, extension 40 seconds using Kod.

Week 5

Monday 14 July 08

Digests and ligation L12 to add rbs to appY clone M15 (sequence back today, seems OK).
Minipreps M31 to M42 of crtB and crtI clones. Digests with EcoRI/PstI. (AM)

Tuesday 15 July 08

PCR P15: fusion PCR of rbs+appY using L15 as template. Extension 20 seconds, annealing 58°C, same primer set as before. Gel 13 shows that it worked OK.
Gel 13 also shows digests of M31 to M42 from yesterday.
Transformation of JM109 with ligations L13 and L15 (glgC mutation and rbs+dxs cloning). Plated to plates 39 to 41.

Wednesday 16 July 08

Meeting with other UK iGEM teams.

Thursday 17 July 08

PCR for cenA, cenB, cenC and cex (P16, P17, P18, P19). Annealing 58°C, extension 115 seconds (cenB and cenC are both over 3kb) and included 5% v/v glycerol in the reactions since in the past that has been helpful with high GC templates. PCR products purified to be run on gel tomorrow (against wisdom, since they should have been run on gel both before and after purification).
Results of transformations: plenty of colonies for glgC mutation (mutating site 1 in the mutant which already has site 2 mutated). Subbed some of these to plates 42, 44 and 45 (poor communications). Only a few colonies for rbs+dxs, and only one of these was white. Subbed this to plate 43. Apparently there may have been some problem with the purification of this digest - may need to repeat.
Re-digested M32, M36 (pSB1A2-crtB), M39 and M40 (pSB1A2-crtI) and ran on Gel 15. Gel unsuccessful - stain smeared over 0.5-2kb region, exactly where crtB and crtI bands are expected to appear. Perhaps too much loading buffer or problem with the tank (tank with 'loose wire' was used). (AM)
pSB1A2+appY cultures set up in beaker for maxiprep tomorrow (X3). (AM)

Friday 18 July 08

Made pSB1A2+appY Maxiprep *X3*. (AM)
Purified PCR products for cenA, cenB, cenC and cex (P16, P17, P18, P19) run on Gel 16. No visible bands. (AM)
Second attempt at PCR for cenA, cenB, cenC and cex (P20, P21, P22, P23). Annealing 55°C, extension 85 seconds; did not include glycerol. Ran unpurified PCR products on Gel 17 - no bands apart from thick bands in the <0.5kb region = primers. Hence, PCR was unsuccessful. (AM)

Saturday 19 July 08

Minipreps M43 to M47 of possible glgC double mutants (both EcoRI sites gone), and M48 of the only white colony from the pSB1A2+rbs+dxs transformation. Gel 18 shows EcoRI/PstI digests of 3μl. M43 to M47 all look about right: send one for sequencing. M48 is ambiguous, could be incomplete deigestion, need to repeat. (CF)
PCR P24 and P25, repeat PCR for cenA and cex (the two shorter genes) using Pfu polymerase instead of Kod, adding 5% glycerol - this worked well for high-GC genes from Saccharothrix espanaensis last year. (CF)

Sunday 20 July 08

Ran P24 and P25 on Gel 19. No amplification products. Time to do some trouble shooting. The fault is in either the primers, the template, or the reactions. All previous reactions have been fine, so most likely the primers or template. To check this, we need to do a positive control using universal primers such as fd1 and rd1 (amplify 16S rRNA gene rrnB) which should definitely give a product. If these fail, then it is most likely that the template is at fault - we should prepare genomic DNA and try using this as template rather than cells; also do a Gram stain to confirm that the cells look OK. If the control reaction works, try remaking the primer solutions, though it seems unlikely that all four sets could be wrong, unless I was having a really bad day. (CF)
Redid digest of M48 with SacI/Spe1. Does not look good. Also repeated digests of crtB and crtI clones M36 and M42; alternating single digests (EcoRI) and double digests (EcoRI/PstI) to check for inserts. Look OK. Submit for sequencing. (CF)
Also: I have a plan for in vitro assembly to cut down on transformations and minipreps. Could have a try of this next week if there are some students with some free time. (CF)

Week 6

Monday 21 July 08

M36 (crtB), M42 (crtI) and M43 (glgC-mut1,2) submitted for sequencing. (AH)
Plates 46 and 46 have no colonies (white or blue) - Something went wrong with the transformation. (AH)

Tuesday 22 July 08

Positive control PCR with universal primers fd1 and rd1 to amplify 16S rRNA gene rrnB from C. fimi (P26); PCR products run on Gel 21 - failed. (AM)
Made overnight culture of C. fimi from plate 37 for chromosomal DNA purification tomorrow. (AM)
M36 (crtB) and M42 (crtI) double digested, ligated with rbs to make L17 (M36) and L18 (M42). (YAN & OG)
L15 (rbs+dxs ligation to Edinbrick1) and L16 (rbs+appY ligation to Edinbrick1) run on gel, the result showed the ligations into edinbrick1 failed. (YAN & OG)

Wednesday 23 July 08

M43 (glgC-mut1,2) sequence results received. First and second mutation sites successfully removed. (AH)
Overnight culture of C. fimi did not yield sufficient cells. Made two more cultures in nutrient broth; all cultures incubated at 30°C with shaking. (AM)
PCR of crtY from P. ananatis cells (P27) and crtB and crtI from ligations L17 and L18 respectively (P28, P29). PCR products were run on Gel 22 ~ P28 and P29 successful, P27 unsuccessful. (AM, YZJ, OG)
Re-did positive control PCR for rrnB from C. fimi (P30) ~ denaturing at 95°C for 20s, annealing at 55°C for 1 minute, extension at 70°C for 30s. The first two settings were in error; denaturing should have been set to 1 minute and annealing to 10 sec as usual. HOWEVER, annealing for 1 minute appears to have worked, so it might be worth trying this for PCRing the cellulases. (AM)
P30 (the above) and pZntA were run on Gel 23. Both successful. (AM)

Thursday 24 July 08

Purified PCR products P28 and P29 (OG)
Double digestions using XbaI/PstI (buffer H) to add P12 (rbs+dxs), P15 (rbs+appY), P28 (rbs+crtB) and P29 (rbs+crtI) to Edinbrick1. (Yan, OG)
Double digestion using SacI/SpeI (BufferE) to add P31 (pZntA) to Edinbrick1. (Yan, OG)
Purified genomic DNA from C. fimi culture (made from plate 37, incubated in 25ml bottle at 30C for 48 hours with shaking). Used Promega Wizard Genomic DNA Purification Kit, lysozyme and RNAse+EDTA (as replacement for proprietary RNAse Solution, of which none was left). Final solution left overnight in refrigerator at 4°C. (AM)
Plated C. fimi culture from plate 37...
- Incubated in 25ml bottle for 48 hours at 30°C with shaking ... to Plate 48.
- Incubated in 50ml bottle for 24 hours at 30°C with shaking ... to Plate 49.
- Incubated in 250ml flask for 24 hours at 30°C with shaking ... to Plate 50. (AM)
PCR of cenA (P32), cenB (P33), cenC (P34), cex (P35), annealing 1 min 55°C, extension 90 sec 70°C. Run on Gel 24 ~ unsuccessful. (AM)

Friday 25 July 08

Made maxiprep X4 (pSB1A2-crtB as M36; BBa_K118002) and X5 (pSB1A2-crtI as M42; BBa_K118003) (AH, XH)
Ligation of P29 into Edinbrick1 to make L22 (pSB1A2+rbs+crtI). (Yan, OG)
Ligation of P28 into Edinbrick1 to make L21 (pSB1A2+rbs+crtB). (Yan, OG)
Ligation of P12 into Edinbrick1 to make L19 (pSB1A2+rbs+dxs). (Yan, OG)
Ligation of P15 into Edinbrick1 to make L20 (pSB1A2+rbs+appY). (Yan, OG)
Ligation of P31 into Edinbrick1 to make L23 (pSB1A2+pZntA). (Yan, OG)
C. fimi Plate 48 appears to be contaminated (mix of opaque and clear colonies). The same culture was used for genomic DNA purification yesterday ~ this preparation is therefore inadequate for sequencing purpose but might be worth using for PCR. (AM)
No growth of C. fimi on Plates 49 and 50, but C. fimi takes a relatively long time to form colonies so we should check again on Monday. (AM)
PCR P36 of M43 (glgC-mut1,2) to excise the gene from BABEL and rectify its orientation and P37 of crtY from P. ananatis (Plate 17) cell suspension - repeat of P27.
- P36 and P37 run on Gel 25. P36 tentatively successful (larger than desirable smear in the region of interest), P37 failed.
Also did preparations to transfer crtE from BABEL2 vector to pSB1A2. This is necessary, because we are supposed to use Registry standard vectors for all BioBricks we make (in fact, we should even stop using pSB1A2and move to pSB1A3). So, digested the BABEL2+crtE clone that Douglas Leslie made with EcoRI and PstI, and also Edinbrick1 - in both cases, 3μl in 20μl total volume. Ran both on a gel and excised the appropriate bands, eluted each to 10μl EB and set up a ligation using 4μl of each in 10μl total volume. Ligated at 16°C. (CF)

Saturday 26 July 08

Transformed JM109 with 5μl of ligations labelled as L12, L15, L28, L29, L31 (note: these ligations seem to have been numbered based on the PCR product they were derived from rather than sequentially; they have been renumbered as L19 to L23), plus my own ligation (L24) which was to transfer crtE from the BABEL vector (which is not an 'official' BioBrick vector, though it is fully compliant) to pSB1A2, so that we can submit it to the Registry. These were plated on plates 51 to 62. (CF)

Sunday 27 July 08

Result of transformations: no growth for 'L12' (L19), 'L15' (L20) or 'L28' (L21). For 'L29' (L22) there are some blue and white colonies. For 'L31' (L23) there are many blue colonies but only a few white ones, suggesting that the SacI/SpeI double digest is less efficient than the XbaI/PstI which was (I hope) used for the others. For the crtE ligation, there are many white colonies and very few blue - this is as expected, since in this case the vector and insert bands were purified from a gel. (CF)

Week 7

Monday 28 July 08

Repeated transformation of L20 (pSB1A2+rbs+appY) and L21 (pSB1A2+rbs+crtB), and plated on plates 63 to 66. (YAN and Omar).
PCR of cenA, cenB, cenC and cex from cell suspension (P38-41; cell solution incubated at 73-80°C for 8 minutes to kill cells/inactivate DNAse) and DNA solution 'purified' from contaminated cell culture (P42-45). Denaturing 95°C for 1 min, annealing 55°C for 10s, extension 70°C for 90s. PCR products run on Gel 26. (AM)
Prepared L25 of P36 (glgC-mut1,2 PCRed with primers f2 and r2) and Edinbrick 1. (AM)
Minipreps M49 to M54 of pSB1A2+rbs+crtI transformants. (CF)

Tuesday 29 July 08

Transformation of L20 and L21 failed.
Transformation of glgC-mut1,2 ligation product, made plate 67 & 68 (Yan)
Cut out putative cenA and cex (both ~1.5kb) fragments from gel 27 (repeat of Gel 26 but stained with SYBRsafe). Purified DNA from gel fragments: F1 (putative cenA) and F2 (putative cex). (AM)
Digests of M49 to M54 (pSB1A2+rbs+crtI) with EcoRI alone. This should generate a single 4 kb band (doing an EcoRI/PstI double digest would give a vector and insert band both around 2 kb, which would probably run at the same place, making it hard to tell whether there was an insert). These were run on Gel 28. All showed a single band at the expected place. (CF)
Minipreps of pSB1A2+pZntA (M55 to M60) from L23 (Yan, Nimisha)
Minipreps of pSB1A2+rbs+crtE (M61 to M66) from L22 (Yan, Nimisha)
- Double digests of M55 to M60 and M61 to M66 with EcoRI/PstI. This should generate the following bands: ~2.2 kb for pZntA (M55 to M60), ~1.1 kb for rbs+crtE (M61 to M66), and ~2 kb for the pSB1A2 vector. These were run on Gel 29. M55 to M60 unsuccessful; M61 to M66 showed a band at the expected location for rbs+crtE but seemed to be indicate that L22 was still ligated into BABEL instead of pSB1A2. (Yan & AM)

Wednesday 30 July 08

P48 (crtY) and P49 (Recreation of P12, rbs+dxs) created (30.07.08: CF)
Ligated F1 (putative cenA) and F2 (putative cex) to Edinbrick 1 (L28 and L29 respectively). All were digested with EcoRI/SpeI, purified and stored overnight in the 16°C water bath. (AM)
Repeated PCR for cenA and cex (P46, P47) from heat killed cell solution. Denaturing 95°C for 1 min, annealing 65°C for 10s, extension 70°C for 40s. Run on Gel 30. Unsuccessful, perhaps because annealing temperature was too high (temperature was decided based on stock solution label, which took the prefix/suffix into consideration). (AM)
Gel 31: M49 and M50 (pSB1A2-rbs+crtI digested with a) XbaI, b) SpeI/XbaI, c) sac/speI), M63 (BABEL2+rbs+crtE digested with a) EcoRI, b) EcoRI/PstI), M67 (pSB1A2+rbs+crtB digested with a) EcoRI/PstI, b) sacI/speI) and P48 (crtY). (OG)
Re-digested M55 to M60 (pSB1A2+pZntA) with a) EcoRI and b) EcoRI/PstI. (This time, the amount of DNA for digestion is increased). (Yan)
- Gel 32 results look promising for M57, but not for the others. (Yan)
Purified P15 (rbs+appY) and P28 (crtB), digested each with EdinbrickI using XbaI/PstI and set-up for ligations (*L26* and *L27*). Stored overnight in the 16°C water bath.(HX)

Thursday 31 July 08

M50 (pSB1A2+rbs+crtI), M63 (BABEL2+rbs+crtE) and M67 (rbs+crtB) submitted for sequencing. (CF)
Transformation of L26 (pSB1A2+rbs+appY) to Plates 75 and 76, L27 (pSB1A2+crtB) to Plates 77 and 78, L28 (pSB1A2+cenA) to plates 79 and 80 and L29 (pSB1A2+cex) to plates 81 and 82. (HX)
Minipreps of M68-M71 (pSB1A2+glgC-mut1,2), M72-M75 (pSB1A2+rbs+dxs) and *M76-M79* (BABEL2+crtE). (YAN, AM)

Friday 1 August 08

Primers for pCstA ordered. (CF)
White colonies from Thursday's transformations were subplated as follows...
- Plate 76 (L26: pSB1A2+rbs+appY) to Plate 83
- Plate 77 (L27: pSB1A2+rbs+crtB) to Plate 84
- Plate 80 (L28: pSB1A2+cenA) to Plate 85
- Plates 81/82 (L29: pSB1A2+cex) to Plate 86. (AM/HX/OG)
First digestion: M68 to M71 (pSB1A2+glgC-mut1,2) with EcoRI/PstI, M72 to M75 (pSB1A2+rbs+dxs) with EcoRI, M76 to M79 (BABEL2+crtE) with EcoRI/PstI. Run on Gel 33. Results: M68, 69, 71: vector band around 2 kb, no glgC band; M72, 73, 74: single band around 4 kb, expected length for vector+gene; M76-79: crtE band <1 kb, vector band ~2 kb. It is not clear into which vector crtE (M76~79) is inserted, so sequencing will be necessary.
Second digestion: M68 and M69 with a) EcoRI, b) EcoRI/PstI; M72 with a) EcoRI b) SacI/SpeI. Run on Gel 34. Results: Single and double digests of M68 and M69 yielded similar results, hence pSB1A2+glgC-mut1,2 ligation or transformation failed; digests of M72 yielded expected bands, hence pSB1A2+rbs+dxs successful. (AM)
P36 (glgC-mut1,2 excision from BABEL2) and L25 (P36 + Edinbrick1) were run again on Gel 35. Results: P36 viewed at lower illumination yields one band of the desired length (1.5kb); L25 yields two bands around 1.5kb, a thick band at 3kb and several fainter bands including one at 2kb (length of pSB1A2). (AM)

Week 8

Monday 4 August

Made 17 minipreps from transformations of L26, L27, L28, L29: M80 to M83 (L26: rbs+appY in Edinbrick1), M84 to M85 (L27: rbs+crtB in Edinbrick1), M86 to M90 (L28: cenA in Edinbrick1) and M91 to M96 (L29: cex in Edinbrick1). This was followed by double digestion of all the miniprep products (M80 to M96) with EcoRI/PstI. (Yan, OG)
Third glgC mutagenesis made by MABEL on BABEL2+glgC-mut1,2 (since pSB1A2+glgC-mut1,2 appears to have failed) performed: P50 (Yan)
Double digestions of M80 to M96 and P50 were run on gel 36. Results were good for M80-82 (pSB1A2+rbs+appY), M84-85 (pSB1A2+rbs+crtB), M92 (pSB1A2+cex) and P50 (glgC-mut1,2,3). Other results were poor, with bands in the wrong position for M86-M90 (pSB1A2+cenA). (Yan, OG)
Sequencing results back today indicate that M50 = pSB1A2+rbs+crtI, M63 = BABEL2+rbs+crtE and M67 = pSB1A2+rbs+crtB. (AH)

Tuesday 5 August

M72 (pSB1A2+rbs+dxs), M79 (BABEL2+crtE) and M82 (rbs\-_appY_\-pSB1A2) submitted for seqencing. (CF)
Minipreps of CenA (2, 7-13), made *M97* to *M104* (CenA in Edi); Minipreps of Cex (7-10), made *M105* to *M108* (Cex in Edi) (YAN).
M97 to M108 were double-digested with EcoRI and PstI,and run on *gel 37*.(YAN)
Purify P50 (3rd mutagenesis of _glgc_ mutant1&2) and self-ligate it (L30). (HX)
M68-69 (_glgC_\-mut1+2 in pSB1A2) and M92 (_cex_\-pSB1A2) were digested with a) PstI and b) EcoRI and PstI, but gel leaked. Entire process neeeds repeating tomorrow\! (CF & OG)
Digested p36 with Edinbrick1 using Spe1 and EcoR1, to be continued tomorrow (OG)
*Plate 93* created from subculture of plate 56 (M67, pSB1A2-rbs\-_crtB_)

Wednesday 6 August 08

*L31* ligation of P36 (_glgC_\-mut1+2, hopefully, could be P39) to Edinbrick1 completed (OG)
Primers have arrived for PcstA. Chris carried out the PCR (that would be *P51*). Unsuccessful. (CF)
Digestion of M67 (rbs-crtB) with EcoRI/SpeI, M50 (rbs-crtI) with EcoRI/XbaI, in preparation for combining the two with the former as insert and the latter as vector. (CF)
- Not enough time to purify/ligate due to high demand for agarose gel following lunchtime. Shall do tomorrow morning at 9. (AM)
Re-digestion of M97, M98, M99, M101 (all pSB1A2\-_cenA_) and M105, M108 (pSB1A2\-_cex_) with 1)EcoRI and 2) EcorI/PstI; and M92 with 1)PstI and 2)EcoRI and PstI, run on gel 38 (because gel 37 did not look good). (YAN)
Transformation of L30 on blue white plate (plate 89,90) and L31 on blue white plate (plate 91,92). (HX)
Maxipreps X6 (from M50: rbs+crtI) and X7 (from M63: BABEL2-rbs+crtE). (AM)
Overnight culture made from plate 93 (M67, pSB1A2-rbs\-_crtB_) ready for maxiprep tomorrow. (AM, AH)
Analytical digests using a) EcoRI and b) EcoRI/PstI of M70, M71 (both pSB1A2\-_glgC_ mut1+2) and M92 (pSB1A2\-_cex_). Run on *gel 38*. Results do not look good. Bands are wrong size to correspond to vector and no bands match an expected insert size. (CF)

Thursday 7 August 08

Subculture from Plate 89,90 (transformation of L30) to Plate 94; Plate 91 (L31) showed no growth, s was discarded. Plate 92 (L31) had a blue smear and two white colonies. These colonies were subbed to Plate 95. (HX)
Maxiprep *X8* (pSB1A2-rbs\-_crtB_, as M67) made. Slight hiccup after step 6. (Cold solution 3 was added and incubation on ice was skipped. Centrifugation continued for 2 minutes before mistake was realised, after which the solution was mixed and incubated on ice for ten minutes (continuing with step 7). (AM & AH)
Combination (Ligation) of Biobricks of CrtB (from M67) and CrtI (from M50):CrtB as an insert cut with EcoRI/SpeI; CrtI as a vector cut with EcoRI/XbaI (*L32*). (YAN, AM)
Double digestion of three biobricks: 2 of dxs (from M72), CrtE (from M63) and Lims (from 0713536 in igem 07 box): dxs as a vector cut with SpeI/PstI; CrtE as an insert cut with XbaI/PstI; Lims as a vector cut with XbaI/PstI.
Made PCR of CenA and CeX again, stored in *P52* (CenA) and *P53*(CeX). The PCR products were checked on gel, but failed again\! (YAN, AM)
PCR *P54* of PcstA. Run on *gel 40*. Results look promising (fairly prominent band <500bp). Purified. (CF)
Plates made for testing glycogen assay. 2x LB agar, ampicillin; 2x LB agar, ampicillin, 2% glucose ready for spreading with E. coli. (SK)
Plates 96/97 (glycogen assay) were spread with subcultures from Plate 43. (HX)

Summary of samples:

PCR products

P1: dxs from Eschaerichia coli JM109 (or K12?)
P2: appY from E. coli JM109 (or K12?)
P3: glgC from E. coli JM109 (or K12?)
P4: fusion PCR for BABEL1+glgC
P5: fusion PCR for BABEL2+glgC
P6: mutagenic PCR to remove EcoRI site 1 from glgC
P7: mutagenic PCR to remove EcoRI site 2 from glgC
P8: crtB (from Pantoea ananatis cells)
P9: crtI (from Douglas's maxiprep of the mutated crtIB plasmid)
P10: crtY (from P. ananatis cells). Failed.
P11: fusion PCR for rbs+dxs. Failed.
P12: repeat fusion PCR for rbs+dxs, using L11 and primers rbs2fclon1+pSB1A2insr1.
P13 and P14: MABEL mutation of site 1 on glgC mutant clones M19 and M22.
P15: fusion PCR for rbs+appY
P16, P17, P18 and P19: first attempts at cenA, cenB, cenC and cex.
P20, P21, P22 and P23: second attempts at cenA, cenB, cenC and cex.
P24, P25: repeat PCR for cenA and cex using Pfu. Failed.
P26: Positive control PCR with primers fd1 and rd1 to amplify 16S rRNA gene rrnB from Cellulomonas fimi.
P27: crtY from P. ananatis cells. - Failed
P28, P29: crtB and crtI from L18 and L19.
P30: Repeat positive control rrnB from C. fimi, annealing 1 minute.
P31: pZntA promoter
P32-P35: repeat PCR for cenA, cenB, cenC and cex, annealing 1 minute. Failed.
P36: M43 (glgC-mut1,2) with primers glgCf2/glgCr2 (25.07.08: AM)
P37: crtY from P. ananatis. (25.07.08: AM) - Failed
P38~P41: cenA, cenB, cenC and cex from heat-killed cell suspension.
P42~P45: cenA, cenB, cenC and cex from 'impure' DNA solution.
P46~P47: cenA and cex from 'impure' DNA solution, annealing 65C. Failed.
P48: crtY (new primer mixture) (previously P38a) (30.07.08: CF) - Failed
P49: Recreation of P12 (rbs+dxs) (previously P39a) (30.07.08: CF)
P50: third mutagenesis of glgc-mut1,2 (04.08.08: YAN)
P51: pCstA from E. coli cells (06.08.08: CF) - Failed
P52: cenA from heat killed C. fimi (07/08/08: YAN, AM) - Failed
P53: cex from heat killed C. fimi (07/08/08: YAN, AM) - Failed
P54: pCstA from E. coli cells - Purified (07.08.08: CF)

Ligations

L1: Edinbrick1+dxs
L2: Edinbrick1+appY
L3: Babel1+glgC
L4: Babel2+glgC
L5: Edinbrick1+appY repeat (initially labelled L4 in error)
L6: Self ligation of mutagenic PCR P6
L7: Self ligation of mutagenic PCR P7
L8: Ligation of synthetic ribosome binding site to M2 (BBa_K118000)
L9: Edinbrick1+crtB
L10: Edinbrick1+crtI (mutant lacking PstI sites, I hope)
L11: repeat ligation of synthetic ribosome binding site to M2 (BBa_K118000)
L12: rbs ligated with appY.
L13 and L14: self ligations of glgC mutation reactions P13 and P14.
L15: ligation of Edinbrick1 with rbs+dxs fusion PCR product (P12). - Failed
L16: Ligation of Edinbrick1 with rbs+appY fusion PCR product (P15) (17/07/08) - Failed
L17: Ligation of crtB (M36) to rbs (22/07/08)
L18: Ligation of crtI (M42) to rbs (22/07/08)
L19: pSB1A2+rbs+dxs ligation product (From P12) (25/07/08: Yan/OG)
L20: pSB1A2+rbs+appY ligation product (From P15) (25/07/08: Yan/OG)
L21: pSB1A2+rbs+crtB ligation product (From P28) (25/07/08: Yan/OG)
L22: pSB1A2+rbs+crtI ligation product (From P29) (25/07/08: Yan/OG)
L23: PzntA+pSB1A2 ligation product (From P31) (25/07/08: Yan/OG)
L24: Ligation of crtE to pSB1A2 (25/07/08: CF)
L25: Ligation of glgC double mutant (P36) to Edinbrick 1 (28.07.2008: AM)
L26: Ligation of Edi+P15 XP - rbs+appY (30.07.2008: HX)
L27: Ligation of Edi+P28 XP - rbs+crtB (30.07.2008: HX)
L28: Putative cenA ligated to Edinbrick1 (30.07.08: AM)
L29: Putative cex ligated to Edinbrick1 (30.07.08: AM)
L30: Self-ligation of P15 (3rd mutagenesis of glgC-mut1,2) (05.08.08: HX)
L31: Ligation of P36 (glgC-mut1,2, hopefully, could be P39) to Edinbrick1 (05.08.08: OG)
L32: Ligation of rbs+crtB (M67) to rbs+crtI (M50) to create crtB/crtI (07.08.08: AM, Yan)
L33: Ligation of PcstA (P54) to Edinbrick1 (08.08.08: OG)

Minipreps

M1 to M6: pSB1A2+dxs transformants. *M2, M3, M4 and M6* all looked correct on a gel. *M2* was sequenced to confirm identity and was maxiprepped as *X2*.
M7: Babel1+glgC transformant. Did not look right on gel.
M8 to M12: Babel2+glgC_ transformants. *M10 and M11* both looked good on a gel, but sequencing showed that both had the insert in the reverse orientation.
M13 to M18: pSB1A2+appY transformants. Gel 10 showed that M15 to M18, and possibly M14, all seemed to have inserts the right size.
M19 to M24: Babel2+glgC clones after mutation of EcoRI site 2. EcoRI digests on *Gel 11* suggest that *M19, M21 and M22* may have lost the EcoRI site.
M25 to M30: possible rbs+dxs transformants.
M31 to M36: crtB clones.
M37 to M42: crtI clones.
M43 to M47: possible glgC double mutants (both EcoRI sites gone)
M48: a possible rbs+dxs clone.
M49 to M54: pSB1A2-rbs+crtI
M55 to M60: PZntA promoter
M61 to M66: BABEL2+rbs+crtE
M67: rbs+crtB
M68 to M71: pSB1A2+glgC-mut1,2 (31.07.08: AM, YAN)
M72 to M75: pSB1A2+rbs+dxs (31.07.08: AM, YAN)
M76 to M79: BABEL2+crtE (31.07.08: AM, YAN)
M80 to M83: pSB1A2+rbs+appY (04/08/08: YAN and OG)
M84 to M85: pSB1A2+rbs+crtB (04/08/08: YAN and OG)
M86 to M90: pSB1A2+cenA (04/08/08: YAN and OG)
M91 to M96: pSB1A2+cex(04/08/08: YAN and OG)
M97 to M104: pSB1A2+cenA (05.08.08: YAN)
M105 to M108: pSB1A2+cex (05.08.08: YAN)

Maxipreps

X1: BioBrick J33201
X2: pSB1A2+dxs clone (as M2; BBa_K118000)
X3: pSB1A2+appY (from Plate 21, streak 3) (18 July 2008)
X4: pSB1A2+crtB (as M36; BBa_K118002) (25.07.08: AH, XH)
X5: pSB1A2+crtI (as M42; BBa_K118003) (25.07.08: AH, XH)
X6: pSB1A2+rbs+crtI (as M50) (06/08/08: AM)
X7: BABEL2+rbs+crtE (as M63) (06/08/08: AM)
X8: pSB1A2+rbs+crtB (as M67) (06/08/08: AM + AH)

Gel DNA Fragments

F1: Putative cenA from P38/Gel 27.
F2: Putative cex from P41/Gel 27.

Plates

1 and 2: transformation with a BioBrick from the Registry stock: failed.
3 and 7: L1 transformation, 100 and 900 microlitres
4 and 8: L2 transformation, 100 and 900 microlitres. Failed.
5 and 9: L3 transformation, 100 and 900 microlitres
6 and 10: L4 transformation, 100 and 900 microlitres
Plate 11: possible pSB1A2+dxs transformants.
Plate 12: possible Babel1+glgC transformants.
Plate 13: possible Babel2+glgC transformants.
Plate 14: more subcultures from plates 5 and 6.
Plates 15 and 16: retransformation of religated L2. Failed again.
Plate 17: Pantoea ananatis for crt PCR reactions.
Plates 18 and 19: L5 transformation, 100 and 900 microlitres.
Plates 20 and 21: subculturees from 18 and 19.
Plates 22 and 23: L6 transformation. No colonies.
Plates 24 and 25: L7 transformation.
Plates 26 and 27: subcultures from plates 24 and 25 (L7).
Plates 28 and 29: Cellulomonas from initial stock.
Plates 30 and 31: possible pSB1A2+crtB transformants.
Plates 32 and 33: possible pSB1A2+crtI (mutant) transformants.
Plate 34: possible rbs+dxs clones from Nimisha's plates.
Plate 35: patches of possible pSB1A2+crtB transformants from Plate 30.
Plate 36: patches of possible pSB1A2+crtI(mutant) transformants from Plates 32 and 33.
Plate 37: subcultuure of Cellulomonas fimi on NA with filter paper (cellulose)
Plates 38 and 39: L15 transformation (rbs+dxs PCR product with Edinbrick1)
Plates 40 and 41: L13 transformation (glgC M19 PCR produce to mutate site 1)
Plates 42, 44 and 45: Patches of possible glgC M19 transformants - subcultures from plate 41
Plate 43: Patches of possible rbs+dxs transformants - subculture from plate 38 or 39
Plates 46~47: L16 transformation (rbs+appY PCR product with Edinbrick 1) (18/07/08)
Plates 48~50: _Cellulomonas fimi_ from overnight cultures made from plate 37. (24/07/08)
Plates 51/52: L19 Transforations (rbs+dxs+Edinbrick) (26/07/08: CF)
Plates 53/54: L20 Transforations (rbs+appY+Edinbrick) (26/07/08: CF)
Plates 55/56: L21 Transforations (rbs+crtB+Edinbrick) (26/07/08: CF)
Plates 57/58: L22 Transforations (rbs+crtI+Edinbrick) (26/07/08: CF)
Plates 59/60: L23 Transforations (PzntA+Edinbrick) (26/07/08: CF)
Plates 61/62: L24 Transforations (crtE+pSB1A2 - from BABEL) (26/07/08: CF)
Plates 63/64: Repeat transformations of L20 (28/07/08: Yan, OG)
Plates 65/66: Repeat transformations of L21 (28/07/08: Yan, OG)
Plates 67/68: glgc-mut1,2 transformation (29.07.2008: Yan)
Plates 69/70: rbs+dxs, 100 and 900 µl (30.07.2008: CF)
Plates 71/72: crtE coding sequence in Babel2, 100 and 900 µl (30.07.2008: CF)
Plate 73: Subs from Plate 67 (30.07.2008: CF)
Plate 74: Subs from Plates 69-72 (30.07.2008: CF)
Plates 75/76: L26 (pSB1A2+rbs+appY) 100 microlitres/900 microlitres (31.07.2008: HX)
Plates 77/78: L27 (pSB1A2+rbs+crtB) 100 microlitres/900 microlitres (31.07.2008: HX)
Plates 79/80: L28 (pSB1A2+cenA) 100 microlitres/900 microlitres (31.07.2008: HX)
Plates 81/82: L29 (pSB1A2+cex') 100 microlitres/900 microlitres (31.07.2008: HX)
Plate 83: Subs from Plate 76 (L26: pSB1A2+rbs+appY) (01.08.2008: OG)
Plate 84: Subs from Plate 77 (L27: pSB1A2+rbs+crtB) (01.08.2008: HX)
Plate 85: Subs from Plate 80 (L28: pSB1A2+cenA) (01.08.2008: AM)
Plate 86: Subs from Plates 81/82 (L29: pSB1A2+cex) (01.08.2008: AM)
Plate 89/90: L30 (Self-ligation of P15) 100ml/900ml (06.08.2008: HX)
Plate 91/92: L31 (Double digestion of P36/P39 by OG) 100ml/900ml (06.08.2008: HX)
Plate 93: Subculture from Plate 56 (M67, pSB1A2+rbs+crtB) (05.08.08: CF)
Plate 94: Subculture from Plate 89,90 (07.08.08: HX)
Plate 95: Subculture from Plate 92 (07.08.08: HX)
Plate 96: LB, ampicillin plate spread with subcultures from plate 43. (HX, 07.08.08)
Plate 97: LB, ampicillin, 2% glucose plate spread with subcultures from plate 43. (HX, 07.08.08)
Plates 98/99: Transformation of L32 (crtB/crtI) (08.08.08: HX)
Plate 100/101: Repeat transformation of L31 (Double digestion of P36/P39 by OG) (08.08.08: HX)

Gels

Gel 1: PCR reactions P1, P2, P3
Gel 2: minipreps M1 to M6, EcoRI/PstI
Gel 3: minipreps M2, M3, M4, M6, EcoRI, plus L1 and L2
Gel 4: minipreps M7 to M12, undigested
Gel 5: minipreps M7 to M12, EcoRI/PstI
Gel 6: minipreps M2, M3, M4, M6, HindIII; also P4 and P5 (fusion PCR)
Gel 7: minipreps M10 and M11, EcoRI (two versions of this gel)
Gel 8: PCR products P6 and P7 (mutagenic PCR on M11)
*Gel 9: maxipreps X1 and X2, etc.
Gel 10: minipreps M13 to M18, E/P digests.
Gel 11: minipreps M19 to M24, EcoRI digests, plus PCR P11.
Gel 12: minipreps M25 to M30 of possible rbs+dxs clones: none look right.
Gel 13: PCR P13 and P14 to mutated second EcoRI site on glgC clones M19 and M22.
Gel 14: minipreps M31 to M42 (crtB and crtI clones) E/P, and P15 (rbs+appY)
Gel 15: redigest of M32, M36 (crtB), M39, M40 (crtI) E/P; unsuccessful.
Gel 16: purified PCR products for cenA, cenB, cenC, cex (P16, 17, 18, 19); unsuccessful.
Gel 17: PCR products for cenA, cenB, cenC, cex (P20, 21, 22, 23) ~ second attempt; unsuccessful.
Gel 21: P26 (rrnB from C. fimi); unsuccessful.
Gel 22: P27 (crtY ~ unsuccessful), P28, P29 (crtB, crtI ~ successful).
Gel 23: P30 (repeat rrnB from C. fimi) and PzntA. Successful.
Gel 25: P36 (glgC excision ~ successful), P37 (crtY ~ failed).
Gel 26: P38~43 (cenA, cenB, cenC, cex from heat-killed cell suspension; cenA and cenB from 'impure' DNA solution.
Gel 27: Repeat of Gel 26 but stained with SYBRsafe; putative cenA and cex fragments cut out.
Gel 28: M49~54 (pSB1A2-rbs+crtI) digested with EcoRI.
Gel 29: M55~60 (PZntA), M61~66 (RBS+CrtE) all digested with EcoRI and PstI.
Gel 30: P46 (cenA), P47 (cex) from heat killed cell soln, annealing 65C. Failed. (30/07/08)
Gel 31: M49 (X,SX,sac/spt), M50(X,SX,sac/spt), M63(E,EP), M67(E/P, sac1/spe1), P38(cenA). (30/07/08: OG)
Gel 32: M55 to M60 double digestion with EcoRI and PstI, and single digestion with EcoRI only. (30/07/08: Yan)
Gel 33: M68~71 (pSB1A2+glgC-mut1,2) digested with EcoRI+PstI, M72~75 (pSB1A2+rbs+dxs) digested with EcoRI, M76~79 (Babel2+crtE) digested with EcoRI+PstI. See 01.08.2008 entry for results.
Gel 34: M68~69 (pSB1A2+glgC-mut1,2) digested with EcoRI alone and EcoRI+PstI, M72 (pSB1A2+rbs+dxs) digested with EcoRI alone and SacI+SpeI. See 01.08.2008 entry for results.
Gel 35: P36 and L25. P36 successful, L25 yields clear glgC-length band but faint vector-length band.
Gel 36: Double digestion of M80 to M96 with EcoRI and PstI, and PCR production of third mutagenesis of glgC-mut1,2. Results were good for M80-82 (pSB1A2+rbs+appY), M84-85 (pSB1A2+rbs+crtB), M92 (pSB1A2+cex) and P50 (glgC-mut1,2,3). Other results were poor. (YAN&OG).
Gel 37: Double digestion of M97 to M108 with EcoRI and PstI.
Gel 39: Analytical digests using a) EcoRI and b) EcoRI/PstI of M70, M71 (both pSB1A2+glgC-mut1,2) and M92 (pSB1A2+cex). Results do not look good. Bands are wrong size to correspond to vector and no bands match an expected insert size. (06/08/08: CF)
Gel 40: PCR products of PcstA (P54) (and SOB). Results look promising (fairly prominent band <500bp). (07.08.08: CF)

Team:Edinburgh/Notebook