"

 

From 2008.igem.org

Home

Team

Project

Notebook

Research Articles

Parts

Protocols

Pictures

Contents 1 Recipes 2 Primers 3 22nd July 4 24th July 5 22nd August 6 25th August 7 26th August 8 27th August 9 28th August 10 2nd September 11 3rd September 12 8th September 13 9th September 14 10th September 15 11th September 16 12th September 17 15th September 18 18th September 19 19th September 20 23rd September 21 24th September 22 25th September 23 30th September 24 1st October 25 3rd October 26 8th October 27 9th October 28 12th October 29 13th October 30 14th October 31 15th October 32 16th October 33 17th October 34 18th October 35 20th October 36 21st October 37 22nd October 38 23rd October 39 24th October 40 25th October 41 26th October 42 27th October

Recipes

• Tris-Cl, 1M
  • Dissolve 121g Tris base in 800ml H2O
  • Adjust to desired pH with concentrated HCl
  • Mix and add H2O to 1 liter
  • (Approximately, 20ml HCl for pH 7.4 and 42ml for pH 8.0)

• EDTA, 0.5M (pH 8.0)
  • Dissolve 186.1g Na2 EDTA-2H2O in 700ml H20
  • Adjust pH to 8.0 with 10M NaOH(~50ml)
  • Add H2O to 1 liter

• Breaking buffer - 100ml
  • 2ml Triton X-100
  • 1ml Sodium dodecyl sulfate (SDS)
  • 0.5844g NaCl (100mM)
  • 1ml 1M Tris-Cl pH 8.0 (10mM)
  • 200uL 0.5M EDTA (1mM)

Primers

PGK promoter 5'TTTT GAATTC AAAGATGCCGATTTGGGCGC 5'TTTT GAGCTC GTTTTATATTTGTTGTAAAA

PGK terminator 5'TTAT GGGCCC GAAATAAATTGAATTGAATT 5'TTTTG AAGCTT CAGCTTTAACGAACGCAGA

Ste2 5'GCCC TCTAGA ATGTCTGATGCGGCTCCTTC 5'TTAT GGGCCC TCATAAATTATTATTATCTT

Fus1 upstream 5'GTGG GAATTC TAATAATCAGAACTCCAACA 5'GGCG TCTAGA TTTGATTTTCAGAAACTTGA

Fus1 downstream: 5'GCGA GGTACC TGAAAATAATATTGACGTTC 5'TTAT GCGGCCGC TATTCACCAGACCCGCTCCT

22nd July

• Yeast obtained from Dr. Zhao
  • W303a S. Cerevisiae

24th July

• Prepared liquid culture for DNA extraction
• Made 1M Tris. Cl pH 8.0
• Made 4M ammonium acetate

22nd August

• Attempted DNA extraction of W303a genomic DNA
  • Protocol from Wiley's Current Protocols in Molecular Biology
  • Result: Failed to finish protocol
• Obtained more yeast from Dr. Zhao
  • W303a S. cerevisiae

25th August

• Prepared overnight culture for DNA extraction (3:27pm)

26th August

• Attempted DNA extraction
• Prepped overnight culture

27th August

• Performed PCR: PGK Terminator

Buffer G	12.5uL	x4	50uL
Forward Primer	0.5uL	x4	2uL
Reverse Primer	0.5uL	x4	2uL
H2O	10.8uL	x4	43.2uL
Taq	0.2uL	x4	0.8uL
template	0.5ul
Negative control	3 H2O

• PCR program:
  • 4 min 94 degrees
  • 25-30x 30s 94 degrees
  • 30s Tm primers
  • 1 min/KB 72 degrees
  • 7 min 72 degrees

• For the gel: 5uL loading dye gel is in cold room

• Prepped 3 overnight cultures

28th August

• Extracted DNA from 4 cultures
• Ran gel of PCR products (1.5% agarose, 200V)
  • Result: No bands present

2nd September

• PCR: PGK Terminator

5 PRIME Mastermix	10uL	x3	30uL
Forward Primer	0.5uL	x3	1.5uL
Reverse Primer	0.5uL	x3	1.5uL
Template	10uL	x3	30uL
H2O	10.8uL	x4	43.2uL
Negative control	25uL H2O

3rd September

• Ran gel
  • Ladder lane 7
  • Sample 7 spilled
  • 1% agarose
  • 120V
    • Too low
  • 50 minutes
• Poor results--no bands present

8th September

• PCR: PGK Terminator

5PRIME Mastermix	10uL	x3	30uL
Forward Primer	0.5uL	x3	1.5uL
Reverse Primer	0.5uL	x3	1.5uL
Template	14uL	x3	42uL

• Prepped 4 overnight cultures
  • Yeast dried out again

9th September

• Signs of life in 3 of the cultures
  • Wait until tomorrow
• Ran gel on PCR from 8th September--no bands present
  • 150V, 50 minutes
  • No sign of DNA
• Ladder from Courtney

10th September

• Split culture
• Ran gel from 8th September again--no bands present
  • 150V, 50 minutes
  • 0.75% gel
  • Ladder from Courtney

11th September

• PCR: PGK Terminator

5 PRIME Mastermix	10uL	x3	30uL
Forward Primer	0.5uL	x3	1.5uL
Reverse Primer	0.5uL	x3	1.5uL
Template	14uL	x3	42uL

12th September

• Isolated genomic DNA from 8 cultures of W303a yeast cells
  • Protocol from Wiley's Current Protocols in Molecular Biology
  • Labeled templates 1,2,3,4 and 1a,2a,3a,4a

• Ran gel of PCR from 11th September
  • 1% agarose
  • 150V
  • 38 mins
    • Poor results

15th September

• PCR PGK Promotor
  • Finnzymes Phusion High Fidelity DNA Polymerase
    • F-530, 20V (2V/uL)

5x Phusion HF Buffer	10uL	x3	30uL
10mM dNTPs	1uL	x3	3uL
Primer A(Forward)	1uL	x3	3uL
Primer B(Reverse)	1uL	x3	3uL
Template 1	10uL	x3	30uL
Phusions DNA polymerase	0.5uL	x3	1.5uL
H2O	26.5uL	x3	79.5uL

18th September

• Ran reaction mentioned on 15th September
• Extracted DNA from gel from 8th September (PGK Terminator)

Tube	Gel(g)
1	0.332
2	0.278
3	0.307
4	0.349
5	0.385

19th September

• Gel of PGK Promotor from 15th September has no DNA present

23rd September

• PCR: Fus1 Downstream
• EPICENTRE Bioetechnologies - MasterAmp(TM) Taq DNA Polymerase

• Per 50uL of reaction,

MasterAmp Taq 10x PCR Buffer	5uL
1mM dNTPs	1uL
Primer 1	0.5uL
Primer 2	0.5uL
25mM MgCl2	2uL
Taq DNA Polymerase	0.25uL
Template 2	20uL
Water	20.75uL

• PCR Settings:
  • 4mins, 94 degree celcius
  • 30s, 94 degree celcius
  • 30s, 5 degrees below primer melting temperature
  • 1 min, 72 degree celcius -- to step 2 -- 30x
  • 7 min, 72 degree celcius

24th September

• Ran gel of Fus1 Downstream from 23rd September
  • Result: No DNA present on gel

25th September

• PCR: Fus1 Upstream

Mastermix	8.25uL	x3	24.75uL
Forward Primer	0.5uL	x3	1.5uL
Reverse Primer	0.5uL	x3	1.5uL
Template 3	20uL	x3	60uL
Water	20.75uL	x3	62.25uL

• • same protocol as 23rd September
  • The master mix contains the buffer, dNTPs, MgCl, and Taq
  • Template 3 (3 reactions run)

30th September

• PCR: Fus1 Upstream

Mastermix	8.25uL	x3	24.75uL
Forward Primer	0.5uL	x3	1.5uL
Reverse Primer	0.5uL	x3	1.5uL
Template 3	20uL	x3	60uL
Water	20.75uL	x3	62.25uL

• • same protocol as 23rd September
  • Template 4 and 1a (3 reactions each)

• • Gel: 1% agarose, 150V, 35 minutes -> poor results
  • lanes 2,3 -> faint smear

1st October

• PCR: Ste2

Mastermix	8.25uL	x3	24.75uL
Forward Primer	0.5uL	x3	1.5uL
Reverse Primer	0.5uL	x3	1.5uL
Template 3	20uL	x3	60uL
Water	20.75uL	x3	62.25uL

• • same protocol as 23rd September
  • Templates 2a, 3a, 4a used (3 reactions each)

3rd October

• Ran Ste2 gel from 1st October

8th October

• PCR: PGK Terminator

PCR Buffer	5uL
10mM dNTPs	1uL
Forward Primer	1uL
Reverse Primer	1uL
MgCl2	5uL
Taq DNA Polymerase	0.25uL
Template	25uL
Water	11.75uL

• • same protocol as 23rd September
  • Use DNA extracted from gel on 18th September (5 reactions)
• Also extracted DNA from gel from 30th September (Fus1 Upstream)

9th October

• PCR: Ste2
  • Protocol is the same as 23rd September
  • Template used is product from 1st October (9 reactions total)

• PCR: Fus1 Upstream
  • Protocal matches 23rd September
  • Template used was DNA extracted from the gel from the 8th October, which came from the PCR run on 30th September (5 reactions total)

• Ran Ste2 gel from today

• Ran PGK terminator gel from yesterday

12th October

• PCR: Fus1 (3 reactions each)
  • Template is products from 9th October

13th October

• Ran gel of PCR with Fus1
• Used 25uL or product, 5uL of loading dye

14th October

• Fus1 PCR

MasterAmp Taq 10x PCR Buffer	5uL
1mM dNTPs	1uL
Primer 1	0.5uL
Primer 2	0.5uL
25mM MgCl2	5uL
Taq DNA Polymerase	0.25uL
Template	25uL
Water	11.75uL

• Template is reaction from 12th October

15th October

• PCR PGK Terminator

5 PRIME MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	25uL
Water	4uL

• Ran gel of Ste2 from 10/14

• Ran gel of Fus1 upstream from 10/14 (no ladder, oops)

16th October

• PCR: Fus1 Downstream, PGK Promoter

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

• • Tube 1: Template 4 - Fus1
  • Tube 2: Template 4a - Fus1
  • Tube 3: Template 4 - PGK Promoter
  • Tube 4: Template 4a - PGK Promoter

• ran Gel of above

• ran Gel of PGK terminator from 10/15

• Extracted Ste2 from 10/15 and re-amplified:

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

17th October

• Ran gel of Ste2 from 10/16
  • Tube 1 - lane 2,3
  • Tube 2 - lane 5,6

• PCR: Fus1 upstream

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

• • template is products from 10/14

• PCR: PGK Terminator

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

• • Template is products from 10/15

• Extracted Ste2(Gel from today)

18th October

Ran gel of Fus1 upstream and PGK terminator from yesterday

20th October

• Extracting chromosomal DNA from yeast cells
  • W303A - Yellow
  • YPD DL
  • YHP1 YPD HD - One is orange (YHP1)(Cap was removed in incubator), Other is Yellow

• • Orange - YHP1 YPD HD
  • Green - YHP2 YPD HD
  • Pink - W303A YPA DL
  • Yellow - WD303A YPD DL

21st October

• PCR: Ste2

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

• 2 tubes
• Block B of black machine
• Annealing temperature: 31 degrees celcius

• Ran gel on Ste2 from today

22nd October

• New primers for biobricks are here
  • Brought to standard concentration, 30uM
  • Added 33.3uL of water per nmol primer

• PCR: Fus1 and PGK Terminator

MasterMix	20uL
Primer Fwd	0.75uL
Primer Rev	0.75uL
Template	25uL
Water	3.5uL

• • Forward and Reverse primers are new biobrick primers that arrived today
  • Template is PCR product from 17th October

• • A,B,C -> Fus1 Upstream -> 1,2,3
  • 1,2 -> PGK Terminator -> 4,5
  • Annealing temperature: 38 degrees celcius
  • In freezer in yellow case

• PCR: Ste2

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	25uL
Water	4uL

• • Forward primer, Reverse Primer are new primers that arrived today
  • Template is PCR product from 21st October
  • Two tubes in block B

• The 3 gels in the cold room do not have EtBr

23rd October

• Ran gel of Fus1 Upstream, PGK Terminator, Ste2 from yesterday
  • 1% Agarose

• PCR: Fus1 Downstream, PGK Promoter

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

• • 4 reactions each of Fus1 Upstream(1,2,3,4) and PGK Promoter(A,B,C,D)
• Gel shows no bands.

• PCR: Fus1 Downstream, Fus1 Upstream, PGK Promoter, PGK Terminator, Ste2
  • Template genomic DNA from 20th October (x4 different reactions)
  • Used all Template

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	20uL
Water	9uL

• Gel shows no bands

24th October

• Ran gel of Fus1 upstream(lanes 3,4,5), PGK terminator(lanes6,7), and Ste2(lanes 8,9) from 10/22
  • ladder is lane 2; 1 and 10 are nothing

• PCR of Fus1 downstream, Fus1 upstream, PGK promoter, PGK terminator, Ste2

MasterMix	20uL
Primer Fwd	0.5uL
Primer Rev	0.5uL
Template	29uL

• • The templates were the rest of the genomic DNA extracts from 9/12
  • Three reactions of each gene were run

• Gel from above:

• (on left)Fus1 downstream lanes 2,3,4; Fus1 upstream lanes 5,6,7; PGK promoter lanes 8,9,10;
• (on right)PGK terminator lanes2,3,10; Ste2 lanes 4,5,6; Fus1 downstream lanes 7,8,9;

25th October

• Extracted DNA from the gel from 10/24
  • FUS1 upstream from the higher bands of lanes 3 and 4
  • PGK terminator from the lower bands of lanes 6 and 7
• DNA ligation

DNA	5uL
buffer	5uL
Re1 (Pst1)	1uL
Re2 (EcoR1)	1uL
Water	37.5uL

26th October

• Incubate for 20mins at 80 degrees celcius

Ligation Buffer	4uL
DNA Ligase	1uL
DNA	3uL
Plasmid	9uL
Water	3uL

• Let sit for 5 min.
• 5uL of above mixture to competent cells
  • 30 min. on ice
• Heat shock 30s (42 degrees)
• Add SOC Media (200uL)
  • Incubate 60 min.(37 degrees)
• Plate 200uL
  • Incubate 37 degrees celcius overnight

27th October

The transformation failed; try again with the same protocol:

• Using extracts 3 and 7 (+Ligation buffers, Ligase, Plasmid, and Water)

• Failed again.

Home

Team

Project

Notebook

Research Articles

Parts

Protocols

Pictures

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Printable version
• Permanent link
• Privacy policy
• Disclaimers