"
Team:Hawaii/Construction of Broad-Host-Range Expression Vector
From 2008.igem.org
| Projects | Events | Resources | ||
|---|---|---|---|---|
| Sponsors | Experiments | Milestones | Protocols | |
| Notebook (t) | Meetings (t) |
Contents |
Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts
This expression vector will pull parts from the RSF1010 derived broad-host-range plamid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the origional DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.
The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into E. coli then conjugatively transferred to SynechocystisPCC6803, followed by the final test of cloning in genes and testing their expression in both E. coli and SynechocystisPCC6803.
Design
Methods
- Design Primers
- Design overlapping oligonucleotides
- Selection of additional BioBrick parts
- Lay-out of the new vector
Results
pRL1383a Genes w/ BioBrick Ends
| name | primer | length | g/c | Tm | Reviewed By | Notes |
|---|---|---|---|---|---|---|
| aadA_fp._sb.1 | cctTTCTAGatgagggaagcggtgatcg | 19 bp, 28 bp | 57.9%, 53.6% | 59.4 C, 65.7 C | NW | isolates the aadA gene only from ATG to TAA-TAA (original name: SmSpOmega_fp._sb.1) |
| aadA_rp._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg | 20 bp, 48 bp | 45%, 50% | 55.4 C, 74.5 C | NW | isolates the aadA gene only from ATG to TAA-TAA (original name: SmSpOmega_rp._sb.1) |
| OmegaInterposon_fo._sb.1 | cctTTCTAGAGggtgattgattgagcaagc | 19 bp, 30 bp | 47.4%, 46.7% | 54.5 C, 65 C | NW | will produce mixture of 4 different products, 2/4 will be correct |
| OmegaInterposon_ro._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc | 19 bp, 44 bp | 47.4%, 54.5% | 54.5 C, 75.5 C | NW | will produce mixture of 4 different products, 2/4 will be correct |
| pRL1383aOriV_fb._sb.1 | cctTTCTAGAGgaacccctgcaataactgtc | 20 bp, 31 bp | 55%, 48.4% | 56.3 C, 65.9 C | NW | |
| pRL1383aOriV_rb._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac | 20 bp, 45 bp | 55%, 57.8% | 58 C, 76.2 C | NW | |
| pRL1383aRep_fp._sp.1 | cctTTCTAGatgaagaacgacaggactttgc | 22 bp, 31 bp | 45.5%, 45.2% | 58.9 C, 64.9 C | NW | Begins with RepB |
| pRL1383aRep_rb._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca | 19 bp, 44 bp | 63.2%, 61.4% | 62.2 C, 78.5 C | NW | Ends with an existing post-RepC terminator (and not the RepC protein stop codon) |
| p1lytic_fb._sb.1 | atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac | 43 | (need to recalculate) | (need to recalculate) | NW | E-N-X for front ligation; for priming out phage induced high-copy-number origin of replication (amplification begins as RBS, amplifies out of ??? plasmid) |
| p1lytic_rp._sb.1 | cTACTAGTATTAttaccctctgaatcctgccg | 32 | (need to recalculate) | (need to recalculate) | NW | S for front ligation, introduce additional TTA (TAA) stop codon; for priming out phage induced high-copy-number origin of replication (amplification end as protein coding region stop codon, amplifies out of ??? plasmid) |
RP4 Origin of Transfer Sequences for Oligonucleotide Extension
| name | oligonucleotide set | Reviewed by | Notes |
|---|---|---|---|
| oriT1_ob._na.1 | ctagaggaataagggacagtgaagaaggaacacccgctcg | NW | complement oriT4 |
| oriT2_ob._na.1 | cgggtgggcctacttcacctatcctgcccggctgacgccg | NW | complement of oriT5 |
| oriT3_ob._na.1 | ttggatacaccaaggaaagtctacatactagtagcggccgctgca | NW | complement of oriT6 |
| oriT4_ob._na.1 | GCGGCCGCTACTAGTAtgtagactttccttggtg | NW | |
| oriT5_ob._na.1 | tatccaacggcgtcagccgggcaggataggtgaagtaggcc | NW | |
| oriT6_ob._na.1 | cacccgcgagcgggtgttccttcttcactgtcccttattcCT | NW |
Discussion
- What was learned and how to do future experiments differently.
[http://manoa.hawaii.edu/ 
][http://manoa.hawaii.edu/ovcrge/ 
][http://www.ctahr.hawaii.edu 
]
